Loading...

Table of Content

    01 April 2024, Volume 57 Issue 7
    SPECIAL FOCUS: SEED GERMINATION AND PRE-HARVEST SPROUTING
    Seed Germination and Pre-Harvest Sprouting
    DONG HuiXue, WANG JiRui
    Scientia Agricultura Sinica. 2024, 57(7):  1215-1219.  doi:10.3864/j.issn.0578-1752.2024.07.001
    Abstract ( 1957 )   HTML ( 67 )   PDF (302KB) ( 1420 )   Save
    References | Related Articles | Metrics
    Physiological and Molecular Effects of Salicylic Acid on Rice Seed Germination at Low Temperature
    CHEN BingXian, ZHANG Qi, DAI ZhangYan, ZHOU Xu, LIU Jun
    Scientia Agricultura Sinica. 2024, 57(7):  1220-1236.  doi:10.3864/j.issn.0578-1752.2024.07.002
    Abstract ( 1792 )   HTML ( 82 )   PDF (5946KB) ( 2980 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】The study investigated the impact of salicylic acid (SA) priming on the germination vigor and physiological response of rice seeds under low temperatures. It aimed to reveal the expression patterns of genes related to abscisic acid (ABA) and gibberellin (GA) metabolic pathways as well as cell wall relaxation genes by SA priming. This research provided a theoretical basis for the study of rice seed germination at low temperatures.【Method】Using indica three-line hybrid rice Taifengyou 208 seeds as materials, the effects of SA on seed germination vigor and physiology responses under low temperature were analyzed through seed priming treatment, and the expression patterns of genes related to ABA, GA and expansin in response to SA were analyzed by qRT-PCR.【Result】Low temperature (15 ℃) significantly delayed the germination process of rice seeds. In seeds germinated at low temperatures for one day, the endogenous SA concentration was 1.7 times higher than that at normal temperatures (28 ℃). However, for five-day-old seedlings, the SA concentration under low temperature was only 0.6% of that at normal temperatures. SA could effectively enhanced germination vigor of seeds at low temperature, with the most significant effects observed at 2 000 μmol·L-1 SA. This concentration significantly increased the germination index, vigor index, shoot length, root length, fresh weight, and dry weight of seeds under low temperature conditions. Notably, the vigor index was three times that of non-primed seeds (CK1) and two times that of water-primed seeds (CK2). In terms of physiological indexes, SA priming increased the contents of soluble sugar, proline and active oxygen, enhanced the activities of total amylase, β-amylase, superoxide dismutase (SOD) and catalase (CAT), and decreased the content of malondialdehyde (MDA). Compared with CK1, 2 000 μmol·L-1 SA decreased the ABA content by 79%, and increased the IAA and GA1 contents by 32.2% and 2.66 times, respectively. In terms of gene expression, the expression levels of ABA synthesizing genes OsNCED2 and OsNCED3 were decreased by 94.26% and 90.24% compared with CK1 in seeds primed by 2 000 μmol·L-1 SA, respectively, whereas the expression levels of ABA decomposing genes OsABA8’ox2 and OsABA8’ox3 were 5.9 and 3.9 times higher than that of CK1, respectively. Compared with CK1, SA priming significantly upregulated the expression of GA synthesizing genes OsCPS1, OsKAO and OsGA20ox1, while it significantly downregulated the expression of GA decomposing genes OsGA2ox2 and OsGA2ox6. In several candidate genes encoding cell wall relaxation protein, e.t. expansin, all but OsEXPB11 were significantly upregulated to some extent by priming. Compared with CK1, 2 000 μmol·L-1 SA increased the expression levels of OsEXPA2, OsEXPB4 and OsEXPB6 to 12.2, 5.9 and 6.1 times, respectively.【Conclusion】SA priming can significantly alleviate the impact of low temperatures on rice seed germination and seedling growth, which is likely due to SA enhancing the activity of antioxidant enzymes such as SOD and CAT, reducing the production of MDA, and increasing the content of soluble sugars and proline, thereby strengthening the tolerance of seeds and seedlings to low temperatures. On the other hand, SA priming decreases endogenous ABA content, increases GA1 content, enhances the activities of total amylase and β-amylase, and promotes the expression of genes related to cell wall relaxation, thus facilitating seed germination and seedling growth at low temperature.

    Research on the Mechanisms of Pre-Harvest Sprouting and Resistant Breeding in Wheat
    DONG HuiXue, CHEN Qian, GUO XiaoJiang, WANG JiRui
    Scientia Agricultura Sinica. 2024, 57(7):  1237-1254.  doi:10.3864/j.issn.0578-1752.2024.07.003
    Abstract ( 1488 )   HTML ( 82 )   PDF (692KB) ( 9741 )   Save
    Figures and Tables | References | Related Articles | Metrics

    Pre-harvest sprouting (PHS) refers to the germination of cereal crops on the spike in high humidity conditions before grain harvest. Wheat PHS is a significant problem that affects both the yield and quality of wheat. Seed dormancy level is a major factor influencing the resistance of wheat PHS, and domesticated crops often exhibit reduced seed dormancy levels, making cultivated wheat more prone to PHS compared to its wild ancestors. Wheat PHS is mainly regulated by external environmental factors such as temperature and humidity, as well as internal plant hormones (GAs, ABA, IAA, MeJA, ET, BR). Researchers have identified a range of materials resistant to PHS, cloned key genes regulating PHS resistance, such as PM19, MFT, MKK3, Myb10-3D, Vp1. New wheat materials resistant to PHS have been successfully developed through molecular marker-assisted selection, artificial synthesis of wheat, and CRISPR/Cas9 gene editing technology. This article reviews the genetic mechanism of PHS resistance in wheat and the latest progress in PHS resistance breeding research. In the future, it is necessary to continue exploring key genes related to PHS resistance, and employ biotechnological breeding methods to cultivate new PHS-resistant wheat varieties.

    Utilization Efficiency of Improving the Resistance for Pre-Harvest Sprouting by Synthetic Hexaploid Wheat and Chinese Wheat Landrace
    LIU ZeHou, WANG Qin, YE MeiJin, WAN HongShen, YANG Ning, YANG ManYu, YANG WuYun, LI Jun
    Scientia Agricultura Sinica. 2024, 57(7):  1255-1266.  doi:10.3864/j.issn.0578-1752.2024.07.004
    Abstract ( 1221 )   HTML ( 19 )   PDF (774KB) ( 683 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】Pre-harvest sprouting (PHS) is a serious limiting factor for wheat (Triticum aestivum L.) grain yield and end-use quality. Synthetic hexaploid wheats (SHW) and wheat landraces (WL) are important germplasm resources for improving PHS resistance in wheat. The objective of this study is to utilize PHS-resistant loci from SHW and WL for breeding PHS-resistant elite materials, which will provide a theoretical basis for improving PHS resistance of wheat cultivars.【Method】In this study, SYN792 (a synthetic hexaploid wheat from CIMMYT) and Fulingxuxumai (a Chinese wheat landrace) were used as female parents to cross and backcross with Chuanmai 45 (a sensitive variety to PHS), respectively. Two BC1F7 populations including 1 796 lines were established. Seed germination index (GI) and seed germination rate of each spike (SGR) in different environments were used to evaluate PHS resistance. Two germination temperature of 25 ℃ (18GI) and 32 ℃ (19GI) were set to examine seed germinability in 2018 and 2019. 1 796 BC1F7 lines were evaluated preliminarily by SGR phenotype and molecular markers detection in 2017, and the introgression lines with PHS-3D and PHS-A1 resistant loci and SGR less than 35% were screened. Introgression lines with PHS-3D and PHS-A1 resistant loci were used to analyze utilization efficiency of SHW and WL in PHS-resistance breeding by identifying PHS-resistance and yield related traits in 2018 and 2019.【Result】PHS resistance of 1 796 lines was evaluated preliminarily, and 537 lines with SGR value less than 35% were screened for further molecular marker detection. A total of 332 lines with PHS-3D and PHS-A1 were selected by SSR marker, and the frequency of WL introgression lines was significantly higher than that of SHW introgression lines. 332 introgression lines were used to analyze PHS-resistance and yield related traits in 2018 and 2019. There was a significant positive correlation between different PHS indexes in different years, but there was no significant difference in the values of 18GI, 18SGR and 19SGR between SHW and WL introgression lines. The average values of 18SGR, 19SGR and 18GI in SHW and WL introgression lines were lower than 23%. As far as GI value was concerned, there was obvious difference between different germination temperatures. At the germination temperature of 32 ℃, the mean 19GI value of SHW PHS-3D introgression lines was significantly lower than that of WL PHS-A1 introgression lines. Grain color was associated with PHS resistance in SHW introgression lines, and the red-grained SHW introgression lines had lower the mean GI and SGR values than the white-grained lines. Among 73 SHW introgression lines, 11 white-grained lines showed medium or higher resistance to PHS,and the GI values of 14 red-grained lines at different germination temperatures were lower than 35%. According to the data of agronomic traits in 2018 and 2019, thousand grain weight of SHW introgression lines was significantly higher than that of WL introgression lines, but the number of grains per spike was significantly lower than that of WL introgression lines. 23 elite introgression lines including seven SHW introgression lines and 16 WL introgression lines were selected. Two SHW white-grained introgression lines had better resistance to PHS, and the GI values of two red-grained introgression lines at different germination temperatures were lower than 25%.【Conclusion】It is feasible to transfer PHS-3D and PHS-A1 resistance loci to PHS from SHW and WL for improving PHS-resistance of modern wheat cultivars. In this study, the breeding efficiency of WL for PHS-resistance was better than that of SHW. However, the stability of PHS-resistance of SHW introgression lines was better than that of WL introgression lines. 23 SHW and WL elite introgression lines could be used as parents to improve the PHS-resistance and yield traits in wheat. In particular, the white-grained SHW introgression line No.5201 and the red-grained SHW introgression lines No.5497 and No.5505 were very valuable parents for wheat breeding of PHS resistance.

    Effect of Flour and Cooking/Baking Qualities by Sprouted Wheat
    LIANG WangZhuang, TANG YaNan, LIU JiaHui, GUO XiaoJiang, DONG HuiXue, QI PengFei, WANG JiRui
    Scientia Agricultura Sinica. 2024, 57(7):  1267-1280.  doi:10.3864/j.issn.0578-1752.2024.07.005
    Abstract ( 1695 )   HTML ( 31 )   PDF (4286KB) ( 363 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】Continuous rainy weather during the wheat harvest season can cause wheat pre-harvest sprouting (PHS) and even germination, thus impacting wheat yield and quality. Evaluating the effect of flour made by blending different proportions of sprouted wheat with regular wheat on the baking/steaming quality of flour processing products can explore the possibility of using a slight degree of sprouted wheat to examine the possibility of reducing food waste. 【Method】In this study, blends of Zhengmai 583 (Zheng 583) and Kechengmai 6 (Ke 6) wheat with 30%, 50%, and 100% sprouted wheat were prepared, respectively. The degradation of wheat flour from blended wheat was evaluated by the falling number, sedimentation value, wet/dry gluten content, dough development time, and dough stability time. The baking/steaming characteristics of bread, dumpling wrapper, Chinese steamed bread (CSB), sponge cake, noodle, and cookie made from blended wheat were evaluated by sensory scores and quality parameters. 【Result】As the proportion of sprouted wheat increased (30%, 50%, and 100%), the dough development time of Zheng 583 flour first increased and then decreased, while the dough stability time gradually reduced. However, the changes in the two parameters of Ke 6 both showed a trend of first decreasing, then increasing, and finally decreasing. The falling number, sedimentation value, wet/dry gluten content, and farinogram parameters of mixed wheat decreased in both cultivars. The specific volume of Zheng 583 CSB increased and then decreased, while the particular volume of Ke 6 CSB gradually reduced. The exact volume of the Zheng 583 sponge cake gradually increased, while the specific volume of the Ke 6 sponge cake remained unchanged. The particular volume of the bread, area of the cookies, cooking loss of the noodles, and turbidity index (A*) of the dumpling soup changed the same trend in both cultivars. Compared to the control (without sprouted wheat), the specific volume of bread decreased by 11.33% and 17.44%, the cookies area increased by 24.10% and 7.49%, the noodles cooking loss increased by 22.99% and 9.69%, and the A* value of the dumpling soup increased by 8.93% and 13.32% in Z583 and Ke 6 of 100% SW, respectively. The bread, Chinese steamed bread, the dumpling wrapper of two cultivars, and the noodles of Zheng 583 showed significant deterioration in the 30% SW gradient. The sponge cake and cookie of the two cultivars showed significant deterioration in the 50% SW gradient. The noodles of Ke 6 showed significant deterioration in the 100% SW gradient. 【Conclusion】The baking/steaming quality of bread, dumpling wrappers, Chinese steamed bread, sponge cake, noodle, and the cookie was seriously affected by PHS. The influence of PHS is different in various wheat cultivars but has the same trend. When the degree of PHS is slight, it has little effect on the baking quality of cookies and sponge cakes.

    TILLAGE & CULTIVATION·PHYSIOLOGY & BIOCHEMISTRY·AGRICULTURE INFORMATION TECHNOLOGY
    The Related Driving Factors of Water Use Efficiency and Its Prediction Model Construction in Winter Wheat
    GAO ChenKai, LIU ShuiMiao, LI YuMing, ZHAO ZhiHeng, SHAO Jing, YU HaoLin, WU PengNian, WANG YanLi, GUAN XiaoKang, WANG TongChao, WEN PengFei
    Scientia Agricultura Sinica. 2024, 57(7):  1281-1294.  doi:10.3864/j.issn.0578-1752.2024.07.006
    Abstract ( 519 )   HTML ( 20 )   PDF (686KB) ( 2163 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】The water use efficiency can comprehensively reflect the growth suitability and energy conversion efficiency of winter wheat. The driving factors of winter wheat in response to standardized water use efficiency (WP*) at different growth stages were screened and explored, and the WP* prediction model of related driving factors was constructed, which was of great significance for the monitoring of water use efficiency and efficient use of water resources in winter wheat in the Huang-Huai-Hai Plain.【Method】Three water treatments were set up, including water deficit treatments (W1:35 mm, and W2:48 mm) and control treatment (W3: 68 mm), and the canopy temperature parameters, physiological indexes and standardized WP* of winter wheat at the jointing, booting and filling stages were measured. Stepwise regression and pathway analysis were used to screen the main driving factors in response to WP* changes at each growth stage, the relationship between WP* and related drivers was explored, and finally the partial least squares regression (PLSR) and support vector machine (SVM) methods were used to construct a driver-based WP* prediction model in each growth stage. 【Result】 Compared with W3, the canopy temperature parameters, physiological indexes and WP* of winter wheat under the water deficit treatments showed significant differences. Based on the stepwise regression method, the main driving factors in response to WP* at each growth stage were screened, and the sensitivity of each driving factor in response to WP* was ranked by pathway analysis, that is, maximum temperature difference (MTD), stomatal conductance (Gs), leaf water content (LWC) and POD were selected at the jointing stage; canopy relative temperature difference (CRTD), equivalent water thickness (EWT), soluble sugar content (SSC) and crop water stress index (CWSI) were selected at the booting stage; SSC, standard deviation of canopy temperature (CTSD), LWC and Gs were selected at the filling stage. Finally, the driver-based WP* prediction model for each growth stage was construct by using PLSR and SVM. Among them, the prediction model of WP* at booting stage constructed by SVM had the best accuracy, with R2cal (R2val), RMSEcal (RMSEval) and nRMSEcal (nRMSEval) of 0.945 (0.926), 0.533 g·m-2 (0.580 g·m-2) and 2.844% (3.075%), respectively. 【Conclusion】 By screening the relevant driving factors of WP* at each growth stage of winter wheat and constructing a prediction model of winter wheat water use efficiency, this paper provided a theoretical basis for accurate monitoring and management of winter wheat moisture in the Huang-Huai-Hai Plain.

    Nitrogen Fertilizer Postponing Application Benefits Wheat-Maize Intercropping by Reducing Soil Evaporation and Improving Water Use Efficiency
    REN Qiang, XU Ke, FAN ZhiLong, YIN Wen, FAN Hong, HE Wei, HU FaLong, CHAI Qiang
    Scientia Agricultura Sinica. 2024, 57(7):  1295-1307.  doi:10.3864/j.issn.0578-1752.2024.07.007
    Abstract ( 508 )   HTML ( 35 )   PDF (590KB) ( 1135 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】Aiming at the problem of insufficient excavation of the potential of efficient water utilization of wheat-maize intercropping in the oasis irrigation area, which restricted the stable development of multi-maturing cultivation, this study was intended to provide the theoretical basis for the creation of a model of efficient water utilization of wheat-maize intercropping in the oasis irrigation area by investigating the effects of different nitrogen fertilizer postponing application on water consumption characteristics and water utilization of wheat-maize intercropping.【Method】The experiment was carried out in the oasis agricultural comprehensive experimental station of Gansu Agricultural University from 2020 to 2021. Three planting patterns of wheat-maize intercropping, monocropping wheat and monocropping maize were set up. Four treatments application systems were set up for maize: no nitrogen application (N0), 20% nitrogen fertilizer postponing (N1), 10% nitrogen fertilizer postponing (N2), and traditional nitrogen fertilizer without postponing (N3). The total nitrogen application rates of intercropping maize and monocropping maize were 210 and 360 kg·hm-2, respectively. The effects of different planting systems and nitrogen fertilizer postponing ratios on soil evaporation, water consumption characteristics and water use of wheat and maize were studied.【Result】During wheat and maize independent growth stage, the intercropping tree evaporation was greater than that of monocropping, the intercropping wheat tree evaporation increased 15.9%-16.7% than that of monocropping wheat, and the intercropping maize tree evaporation increased 5.4%-14.7% than that of monocropping maize, while wheat and maize symbiosis of intercropping tree evaporation compared with the monocropping weighted reduction of 4.6%-6.1%; the total amount of evaporation during the whole life cycle tree performance: wheat maize in the intercropping mode, intertree evaporation was reduced by 6.5% in the 20% N fertilization setback treatment compared with N3, and intertree evaporation in the wheat belt increased by 12.6%-17.3% compared with that in the maize belt, which was the main source of intertree evaporation in the intercropping system. In the intercropping system, water consumption was 34.3 and 18.9 mm lower than that of traditional N application under the 20% and 10% N fertilizer setback treatments, respectively, but the difference between E/ET and traditional N application was not significant. The seed yield of intercropping system was increased by 21.1%-39.0% compared with the weighted average of monocrop, and the seed yield of intercropping system with 20% N fertilizer setback treatment was increased by 28.8% compared with the traditional N application, among which the intercropped wheat and intercropped maize with 20% N fertilizer setback treatments were increased by 24.3% and 30.8%, respectively, compared with the traditional application of N. The water consumption during the whole growth period under intercropping system with 20% and 10% N fertilizer setback treatment was decreased by 34.3 and 18.9 mm that under traditional application of N, respectively. The E/ET of intercropping system with 20% N fertilization was increased by 20% than that under the traditional N application. The water use efficiency of intercropping planting pattern nitrogen fertilizer setback treatment was significantly increased by 15.0% and 12.3% than that under the weighted average of monocrops; among which the nitrogen fertilizer setback 20% treatment was increased by 35.9% compared with the traditional nitrogen application, and the nitrogen fertilizer setback 10% treatment was increased by 19.3% compared with the traditional nitrogen application.【Conclusion】The wheat-maize intercropping pattern combined with 20% nitrogen fertilizer postponing could reduce soil evaporation and water consumption during the whole growth period, and increase yield and water productivity, which was a nitrogen application system that could be used for high-yield and high-efficiency production of wheat-maize intercropping in oasis irrigation areas.

    PLANT PROTECTION
    Bioinformatics and Expression Pattern Analysis of Maize ACO Gene Family
    WANG ChengZe, ZHANG Yan, FU Wei, JIA JingZhe, DONG JinGao, SHEN Shen, HAO ZhiMin
    Scientia Agricultura Sinica. 2024, 57(7):  1308-1318.  doi:10.3864/j.issn.0578-1752.2024.07.008
    Abstract ( 664 )   HTML ( 61 )   PDF (1712KB) ( 2492 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】The objective of this study is to perform the genome-wide identification of the maize ACO (1-aminocyclopropane- 1-carboxylate oxidase) gene family, analyze its expression patterns in different organs and developmental stages of maize, as well as in response to exogenous hormones and pathogen infection, and to lay the foundation for clarifying the function of the maize ACO gene family.【Method】Using bioinformatics methods, the ACO was identified in the genome of maize B73 inbred line, and its gene structure, protein physicochemical properties, phylogenetic relationships among family members, and conserved motifs were analyzed. The expression patterns of the ZmACO gene family were analyzed using real-time fluorescence quantitative PCR (qRT-PCR) technology.【Result】Except for ZmACO11, all members of the ZmACO family have Fe2+ binding sites and substrate ascorbic acid binding sites. The phylogenetic tree showed that ZmACO2 and ScACO are in the same branch and have a close genetic relationship, with a Bootstrap value of 98. The gene expression analysis indicated that ZmACO2, 5, 9, 15, 20 and 35 were actively expressed at various developmental stages and exhibited dominant expression in leaves, so the six genes mentioned above were selected for the next step of testing. Spraying ethephon resulted in fluctuations in the expression of all six genes mentioned above, the expression level of ZmACO2 was significantly affected, with a variation multiple of about 8 times. The expression levels of these six genes fluctuated within 0-24 h of ethephon treatment. But after 24 h of treatment, all gene expression levels were close to 0. After salicylic acid treatment, the expression level of ZmACO5 was significantly affected, with a variation multiple of about 2 times. The expression levels of other genes were close to 0 at 24 h after treatment. The expression levels of ZmACO9, 35 fluctuated between 3 to 12 h, and the expression levels of ZmACO2, 15, 20 showed a downward trend. In response to biological stress, the expression levels of ZmACO5, 9 showed the greatest changes after inoculation with the Setosphaeria turcica, and on the 10th day after inoculation, the expression levels of these two genes increased by 50 and 60 times, respectively, compared to the control group. After inoculation with the Cochlibolus heterostrophus, the expression level of ZmACO5 changed significantly, with a variation multiple of 40-90 times. After inoculation with Rhizoctonia solani, the expression levels of ZmACO5, 35 showed the greatest changes, reaching 200 times on the 3rd day of inoculation.【Conclusion】The expression changes of ZmACO2, 5, 20 and 35 are most active during the growth and development of maize; The application of exogenous ethephon and salicylic acid can significantly affect the expression level of ZmACO genes. The expression level of ZmACO genes significantly changes after bacterial infection in maize, which is closely related to the response to biological stress.

    Screening of Actinomycetes Against Ralstonia solanacearum and Its Disease Prevention Function
    LIAO XinLin, GUO Xin, YANG JiXue, SHAO JiaZhu, YUAN XinYu, HU JiaYan, CHEN XiaoXiao, JIANG DongHua
    Scientia Agricultura Sinica. 2024, 57(7):  1319-1334.  doi:10.3864/j.issn.0578-1752.2024.07.009
    Abstract ( 591 )   HTML ( 24 )   PDF (5172KB) ( 4006 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】Tobacco bacterial wilt caused by Ralstonia solanacearum is the main disease of tobacco in cash crops. In this paper, the actinomycetes with strong antagonism against R. solanacearum were screened from the soil of different habitats, and their antibacterial mechanism and biocontrol effect were determined, which provided a theoretical basis for the further development of anti-disease microbial agents.【Method】After screening the target actinomycetes by co-culture method and Oxford cup method, the target strain was identified by morphological studies, physiological and biochemical experiments and polygenic phylogenetic analysis. The minimum inhibitory concentration (MIC) of actinomycetes crude extract against R. solanacearum was determined by the 96-well plate method. After co-culture treatment of R. solanacearum with crude extract, the growth dynamics of R. solanacearum were detected and the morphological changes of R. solanacearum were observed. The effects on membrane permeability and membrane composition were observed by measuring β-galactosidase activity and propidium iodide (PI) fluorescence experiments and Fourier transform infrared spectroscopy. The antibacterial activity and mechanism of target actinomyces antagonistic R. solanacearum were preliminarily explored by measuring protein synthesis, extracellular polysaccharides (EPS), intracellular reactive oxygen species (ROS), and so on. The effect of the target actinomycetes on tobacco bacterial wilt control was determined by pot experiments.【Result】According to the morphological characteristics, physiological and biochemical experimental results and sequencing results, the target actinomyces strain Sa-21 was identified as Streptomyces rapamycinicus, and the diameter of the inhibition zone against R. solanacearum was 47.9 mm. The results of mechanism experiments showed that the minimum inhibitory concentration of Sa-21 strain crude extract inhibiting R. solanacearum was 0.5 μg·mL-1, which also had a significant inhibitory effect on bacterial proliferation, and the inhibitory effect increased with the increase of crude extract concentration in the test range. Scanning electron microscopy showed that the structure of R. solanacearum changed after crude extract treatment, resulting in perforation and shrinkage of the bacteria, and with the increase of the concentration of crude extract in the test range, the number of ruptured bacteria increased, and the degree of shrinkage increased. After crude extract treatment, propidium iodide could pass through the cell membrane and bind to intracellular substances to fluoresce, and the activity of β-galactosidase was significantly increased, indicating that the permeability of the cell membrane of R. solanacearum was improved. Further studies showed that crude extract treatment could lead to the accumulation of intracellular reactive oxygen species and the decrease of extracellular polysaccharide production in R. solanacearium, indicating that the cell membrane was damaged to a certain extent. The results of potted plant disease control test showed that the relative control effect of 10-fold dilution of fermentation filtrate of treatment group was 67.61%, while the relative control effect of 10-fold dilution of fermentation filtrate of prevention group was 85.89%.【Conclusion】Streptomyces Sa-21 can inhibit the proliferation of R. solanacearum and destroy the cell membrane structure, which has a good control effect on tobacco bacterial wilt, and has certain development potential and application value.

    SOIL & FERTILIZER·WATER-SAVING IRRIGATION·AGROECOLOGY & ENVIRONMENT
    Effects of Potassium Application Dosage on Yield, Quality and Light Temperature Physiological Characteristics of Summer Peanut
    YANG QiRui, LI LanTao, ZHANG Xiao, ZHANG Qian, ZHANG YinJie, ZHANG Duo, WANG YiLun
    Scientia Agricultura Sinica. 2024, 57(7):  1335-1349.  doi:10.3864/j.issn.0578-1752.2024.07.010
    Abstract ( 610 )   HTML ( 30 )   PDF (3844KB) ( 274 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】The effects of different potassium levels on the yield and quality of summer peanuts at the maturity stage, the dynamics of potassium accumulation at the growth stage, physiological characteristics of light and temperature, and root morphology were explored to provide a scientific basis for rational application of potassium in peanut. 【Method】A field experiment was conducted in Wen County, Henan Province, from 2021 to 2022. The peanut cultivar of Yuhua 22 was used as test material, and 5 potassium fertilizer treatments was set, including 0 (K0), 45 (K45), 90 (K90), 135 (K135) and 180 (K180) kg·hm-2. The yield and quality indexes of summer peanut pods were determined at the maturity stage. Leaf SPAD value, canopy photosynthetically active radiation and canopy temperature were measured at the seedling stage, flowering-pegging stage, pod-setting stage and pod-filling stage, respectively. The potassium accumulation in plants and root morphology were analyzed too. 【Result】With the increase of potassium application rate, the pod yield of peanut in 2 years could be fitted by “linear + platforms trends” and “quadratic equation with one variable”, respectively, and the appropriate potassium application rate was 164 and 135 kg·hm-2, respectively. Potassium application increased yield by 17% on average. The content of crude protein, oil and amino acid in grain at maturity showed a trend of “first increasing and then stabilizing” with the increase of potassium application. Compared with no potassium application, the average increase of crude protein, oil and amino acid contents in grain under potassium application was 7.85%, 3.98% and 13.97%, respectively. The Logistic equation was applied to the nonlinear regression fitting of potassium accumulation in summer peanuts. The results showed that potassium application mainly increased the maximum accumulation rate (Vmax) and average accumulation rate (Vmean), delayed the occurrence of peak absorption (Tmax), and prolonged the rapid accumulation period (Δt) and active accumulation period (Taas) to promote the sustainable and rapid growth of summer peanuts. In addition, the maximum, minimum and mean canopy temperatures decreased significantly with increasing potassium application at all fertility stages. Compared with K0, 135 kg hm-2 treatment significantly increased the leaf SPAD value and canopy photosynthetically active radiation (APAR) and component (FPAR) of peanut and had a positive effect on root morphology. The utilization efficiency of potassium fertilizer decreased gradually with the increase of potassium application. 【Conclusion】Reasonable application of potassium could significantly improve the yield and quality of summer peanut, promote the accumulation and utilization of potassium, and significantly improve the physiological properties of light and temperature during the growth period. The recommended potassium application amount of summer peanuts under this test condition was 135-160 kg·hm-2.

    SOIL & FERTILIZER·WATER-SAVING IRRIGATION·AGROECOLOGY & ENVIRONMENT
    Response of Cultivated-Layer Water-Holding and Drought Resistance Performance and Productivity to Erosion Degree in Purple Soil Sloping Farmland
    NI ShuHui, SHI DongMei, PAN LiDong, YE Qing, WU JunHao
    Scientia Agricultura Sinica. 2024, 57(7):  1350-1362.  doi:10.3864/j.issn.0578-1752.2024.07.011
    Abstract ( 461 )   HTML ( 11 )   PDF (548KB) ( 148 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】 The aim of this study was to analyze the water-holding performance and yield response characteristics of purple soil slope farmland under erosion conditions, so as to provide the theoretical basis for regulating seasonal drought and moisture use efficiency of sloping farmland, and improve yield of sloping farmland under erosion conditions.【Method】 Soil erosion simulation method was adopted, with the non-eroded plot as the control group (S-0), and based on erosion degrees of 5 cm (S-5), 10 cm (S-10), 15 cm (S-15), 20 cm (S-20) and 3 management measures (no fertilizer (CK), fertilizer (F), biochar + fertilizer (BF)). The variation of water retention and drought resistance of slope soil layer and the variation of corn yield and response to erosion degree were compared and analyzed.【Result】(1) The core soil layer soil water-holding performance was stronger. At the same level of soil moisture suction, the reduction amplitude of soil volume moisture content in the tillage layer (13.9%-18.2%) was greater than that in the core soil layer (9.8%); with interannual changes, the volumetric moisture content of the cultivated soil increased maximum at S-5 (14.2%), while the core soil layer showed the maximum at S-15 (33.2%). (2) The total storage capacity, active storage capacity, maximum effective storage capacity, and effective moisture content of sloping farmland soil showed a parabolic variation pattern with increasing erosion. With interannual changes, the maximum increase in maximum effective storage capacity (44.7%) at various erosion levels was at a relatively strong erosion level (S-15), while the maximum increase in effective moisture content, maximum water storage capacity, and maximum single acceptance rainfall was at weak erosion levels (S-0 to S-10). (3) The corn yield of slope cultivated land decreased with the increase of erosion, which was positively correlated with the maximum effective storage capacity and field water capacity; with interannual changes, the yield reduction effect of sloping farmland decreased under different degrees of erosion, and the yield change showed a certain lag with the deterioration of erosion, that is, there was no significant reduction in yield in the year of erosion. (4) The maximum effective storage capacity of sloping farmland soil under erosion conditions was significantly affected by the clay content, capillary porosity, and organic matter content (P<0.01); The field water capacity was significantly correlated with soil depth, organic matter, silt, and porosity (P<0.01).【Conclusion】The strength of the soil water-holding and drought performance was mainly affected by the merits of the soil structure. The soil structure of slope farmland under erosion conditions could be improved by combining deep tillage and biochar+fertilizer management measures, which could effectively regulate the water-holding and drought resistance of erosive cultivated-layer of sloping farmland and improve crop yield of sloping farmland under erosion conditions.

    HORTICULTURE
    Functional Analysis of VvARF18 Gene in Red Globe Grape
    YUAN Miao, ZHOU Juan, DANG ShiZhuo, TANG XueShen, ZHANG YaHong
    Scientia Agricultura Sinica. 2024, 57(7):  1363-1376.  doi:10.3864/j.issn.0578-1752.2024.07.012
    Abstract ( 388 )   HTML ( 23 )   PDF (3353KB) ( 1275 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】Auxin response factor (ARF) is a significant regulatory factor in the auxin signaling pathway and plays an important role in plant growth and development as well as various physiological processes. Analysis of the Red Globe grape VvARF18 promoter, heterologous expression, endogenous hormone content and its expression in response to hormones was made in order to explore the mechanism of VvARF18 gene in the auxin (IAA) signaling pathway and flower bud differentiation process in Red Globe grapes. 【Method】The VvARF18 gene sequence was obtained by homologous cloning by using facility Red Globe grape flower buds as experimental materials. The cis-acting elements of the promoter were analyzed using the online database PLACE. The plant overexpression vector pC2300-VvARF18 was constructed based on the pCAMBIAI2300 plant expression vector by double enzyme digestion and homologous recombination method. The recombinant vector pC2300-VvARF18 was transformed into Agrobacterium tumefaciens strain GV3101 by using electrical shock method. The tobacco leaves were used as explants and transferred into tobacco by Agrobacterium-mediated callus transformation method, and positive transgenic seedlings were obtained by PCR. The quantitative real-time PCR (qRT-PCR) was used to analyze the expression level of VvARF18 transgenic tobacco lines, and the transgenic lines with high expression level were screened and cultured to T3 generation, and treated with IAA and GA3 to analyze the expression level of VvARF18. The content of IAA, GA, ABA and CTK in flower buds and leaves of transgenic tobacco were determined by enzyme-linked immunosorbent assay. 【Result】VvARF18 of Red Globe grape located on chromosome 13, and contained 3 exons and 2 introns. There are multiple cis-acting elements in the VvARF18 promoter region that respond to light, plant hormones, and stress. The phenotypic analysis found that the process of flower bud differentiation was faster in transgenic tobacco than in wild-type tobacco. The qRT-PCR results showed that the expression of VvARF18 showed an increasing and then decreasing trend during the four periods of flower bud development in transgenic tobacco, and the highest expression level was reached in the S3 stage. The results of IAA, CTK, GA and ABA determination in flower buds and leaves of transgenic tobacco plants showed that the content of four plant hormones in flower buds and leaves of transgenic tobacco plants were higher than those of wild-type plants. The change trend of GA/IAA during the four periods of transgenic tobacco flower bud development were consistent with the expression trend of VvARF18. The expression level of VvARF18 in transgenic tobacco plants treated with IAA and GA3 decreased with the increase of IAA treatment concentration and also decreased with the extension of GA3 treatment time. 【Conclusion】Grape VvARF18 negatively regulated auxin to participate in the process of plant flower bud differentiation, which could interact with key factors in the gibberellin signaling pathway to synergistically regulate hormone levels in plant flower buds and had a facilitative effect on plant flower bud differentiation.

    Effect of Methyl Jasmonate on Energy Metabolism and Membrane Lipid Metabolism During Resistance to Botryosphaeria dothidea in Kiwifruit
    XIAO LiuHua, KANG NaiHui, LI ShuCheng, ZHENG ZhiYuan, LUO RaoRao, CHEN JinYin, CHEN Ming, XIANG MiaoLian
    Scientia Agricultura Sinica. 2024, 57(7):  1377-1393.  doi:10.3864/j.issn.0578-1752.2024.07.013
    Abstract ( 531 )   HTML ( 21 )   PDF (4553KB) ( 294 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】Soft rot caused by Botryosphaeria dothidea is one of important diseases during kiwifruit storage, which causes serious economic losses for kiwifruit industry. Methyl jasmonate (MeJA) is a kind of biological signal molecule widely existing in plants, which had been found that it could effectively induce kiwifruit’s resistance to B. dothidea in previous studies. In order to further investigate the mechanism of MeJA-mediated resistance to disease in postharvest kiwifruit, the effects of MeJA on energy metabolism and membrane lipid metabolism were analyzed in this study. 【Method】 Hongyang kiwifruit (Actinidia chinensis cv. Hongyang) were used as experiment material and divided into three groups as follows: inoculation group, which the fruits were inoculated with B. dothidea without MeJA treatment; MeJA+inoculation group, which the fruits were fumigated with 0.1 mmol·L-1 MeJA for 24 h then inoculated with B. dothidea; control group, the fruits without MeJA treatment or inoculation with B. dothidea. All fruits were stored in an incubator ((20±1) ℃, 90%-95% relative humidity) for 8 d. The reactive oxygen species (ROS) accumulation was analyzed by 2, 7-dichlorodihydrofluorescein acetoacetate (H2DCFDA) method, malondialdehyde (MDA) content and relative conductivity were also measured. Meanwhile, phospholipase D (PLD), lipase (LPS), lipoxygenase (LOX), succinate dehydrogenase (SDH), malate dehydrogenase (MDH), H+-ATPase, Ca2+-ATPase and cytochrome C oxidase (CCO) activities and the related genes expression were analyzed. The content of Adenosine triphosphate (ATP), Adenosine diphosphate (ADP), Adenosine monophosphate (AMP), oxaloacetic acid and fenugreek acid were determined by high performance liquid chromatography (HPLC). Then the correlation between membrane lipid metabolism and energy metabolism of kiwifruit in inoculation group and MeJA+ inoculation group was analyzed. 【Result】Compared with the inoculated group, MeJA treatment could inhibit the excessive accumulation of ROS in inoculated B. dothidea fruits, slowed down the degree of membrane lipid peroxidation, and effectively decreased PLD, LPS, and LOX activities and the expression levels of AcLOXs, AcPLD and AcLPS. However, MeJA increased the activities of SDH, MDH, H+-ATPase, Ca2+-ATPase and CCO and the transcription levels of AcSDH, AcMDH, AcH+-ATPase, AcCa2+-ATPase and AcCCO, promoted the production of ATP, ADP, oxaloacetic acid and fumaric acid, delayed the decline of fruit energy charge then ensured the energy required for fruit resistance to pathogens. In addition, correlation analysis showed that kiwifruit membrane lipid metabolism was positively correlated with ROS accumulation, but negatively correlated with energy charge. 【Conclusion】The above results indicated that MeJA-induced resistance to B. dothidea in kiwifruit was related to its regulation of fruit energy levels and mitigation of ROS-involved membrane lipid metabolism.

    ANIMAL SCIENCE·VETERINARY SCIENCE
    Integrated Aanalysis of Genome and DNA Methylation for Screening Key Genes Related to Pork Quality Traits
    ZHAO ZhenJian, WANG Kai, CHEN Dong, SHEN Qi, YU Yang, CUI ShengDi, WANG JunGe, CHEN ZiYang, YU ShiXin, CHEN JiaMiao, WANG XiangFeng, TANG GuoQing
    Scientia Agricultura Sinica. 2024, 57(7):  1394-1406.  doi:10.3864/j.issn.0578-1752.2024.07.014
    Abstract ( 805 )   HTML ( 29 )   PDF (1869KB) ( 232 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Background】 The meat quality traits of pigs are important economic traits. Studying the molecular mechanisms that affect various meat quality traits and discovering key genes can guide genetic improvement of pigs and have significant implications for improving pork quality. Currently, those researches on meat-related mechanisms were mainly based on DNA genomics, while studies on DNA methylation related to meat quality traits, as well as integrated analysis of combining genomics and methylation, are scarce. 【Objective】 The potential key genes affecting pork meat quality were screened and identified by combined analysis of genome and DNA methylome, so as to provide a reference for the genetic improvement of pork quality. 【Method】 In this study, 28 meat quality traits of the ongissimus dorsi muscle of 140 Large White pigs were examined. Epigenome-wide association analysis (EWAS) and genome-wide association analysis (GWAS) were performed to identify CpG and SNP sites significantly associated with each trait. Subsequently, the conditional association analysis was performed by using SNPs as covariates on the significantly associated sites overlapping between GWAS and EWAS to further identify CpG sites with independent effects. Association analysis was then conducted to identify methylation quantitative trait loci (meQTL) by using the methylation levels of CpG sites as the dependent variable and SNPs as the independent variable. Finally, the cis-methylation quantitative trait loci (cis-meQTL) were used as instrumental variables for Mendelian randomization analysis to infer the causal relationship between cis-meQTL and phenotypes, while potential key genes at the loci were annotated and identified. 【Result】 (1) The significant associated sites were identified in the same genomic regions for the meat quality traits, namely yellowness value at slaughter 45 minutes postmortem (b45min), drip loss (DL), and docosahexaenoic acid (C22:6n-3), by both EWAS and GWAS. (2) After conditional association analysis, seven CpG sites for b45min and one CpG site for DL remained significant, while the three sites for C22:6n-3 were no longer significant after using SNPs as covariates, indicating that the significant associations of the seven CpG sites for b45min and one CpG site for DL identified by EWAS were not influenced by nearby significant SNPs. (3) A total of ten meQTL were identified for the seven CpG sites for b45min and one CpG site for DL, but the majority were trans-meQTL, with only one CpG site (SSC12:44 254 675 bp) identifying a cis-meQTL, suggesting that this site might be regulated by nearby SNPs. (4) Mendelian randomization analysis showed a causal relationship between the CpG site (SSC12:44 254 675 bp) and the b45min phenotype. (5) annotation of the locus revealed that the nearest gene to the CpG site (SSC12:44 254 675 bp) and its cis-meQTL was NOS2, and the CpG site was located within the NOS2 gene. 【Conclusion】 Based on the integrated analysis of DNA methylation and genomics data, this study proposed that the NOS2 gene might be a key candidate gene for meat color traits. DNA methylation and SNP jointly regulated gene expression, thereby affecting the expression of genes related to meat color traits.

    Effect of 12 Nucleotides Natural Insertion within the Internal Ribosome Entry Site Core Region on the Replication and Cellular Tropism of Porcine Senecavirus A
    ZHANG XiaoZhan, DONG XuanZhi, LÜ NanNan, LIU YiWen, MA XinTian, WANG LinQing, XIA YanXun, JIANG ZengHai, GUO YunZe, ZHAO PanDeng, SONG YuZhen, YANG DeCheng, BIAN Chuanzhou
    Scientia Agricultura Sinica. 2024, 57(7):  1407-1416.  doi:10.3864/j.issn.0578-1752.2024.07.015
    Abstract ( 401 )   HTML ( 10 )   PDF (2642KB) ( 170 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Background】Senecavirus A (SVA) is a newly emerged picornavirus causing swine idiopathic vesicular disease and epidemic transient neonatal losses. The internal ribosome entry site (IRES) located in 5’ untranslated region (UTR) of SVA genome plays a critical role in virus replication. In 2017, a natural mutant SVA strain, with 12 nucleotides discontinuously inserted into the IRES core region Domain II, was identified in China, and its replication capacity and pathogenicity changed significantly. 【Objective】The aim of this study was to investigate the effects of IRES Domain II mutations on SVA replication and cell tropism, and to lay a foundation for further understanding the pathogenesis of SVA. 【Method】An IRES mutant plasmid of pHeN-1/2018-i12 based on the background of pHeN-1/2018 were constructed, and the DNA-launched infectious clone of HeN-1/2018, with 9 nucleotides in IRES region of HeN-1/2018 genome (308-317 nt, ACTCAAGCG), were gradually replaced by the 21 nucleotides in GD04/2017 genome (308-328 nt, CACGCCTGCCGATAGACGATT) through multiple site-directed mutagenesis. The recombinant virus rHeN-1/2018-i12 was rescued and then identified by viral nucleotide genome examination, indirect immunofluorescence assay and Western blot assay, which was further examined the effect of 12 nucleotides natural insertion within the IRES core region Domain II on the replication and cellular tropism of SVA. 【Result】The pHeN-1/2018-i12 was then directly transfected into PK-15 cells and the recombinant virus rHeN-1/2018-i12 caused stable cytopathic effect was harvested after twice blind passages. Furthermore, the cellular tropism and growth kinetic of rHeN-1/2018-i12 was further investigated via virus infection assays. The viral genome of the IRES mutant virus rHeN-1/2018-i12 in the fifth and tenth passage were sequenced, and results showed that the IRES mutations passed on to the progeny viruses stably, with no nucleotide mutation in viral genome at fifth passage, and no nucleotide mutation in viral 5’-UTR region at tenth passage. Moreover, the growth characteristics of low passage recombinant virus rHeN-1/2018-i12 were further investigated in porcine cell lines PK-15 and IBRS-2, and hamster cell line BHK-21. The results showed that the recombinant virus rHeN-1/2018-i12 shared similar cellular tropism and growth dynamics with parental virus rHeN-1/2018, and all the two viruses could cause obvious CPE in PK-15 cells, IBRS-2 cells and BHK-21 cells, which indicated the mutation of 12 nucleotides insertion in the IRES core region Domain II had no significant difference in cellular tropism. Importantly, the virus-induced CPE time of rHeN-1/2018-i12 was later than that of rHeN-1/2018, and the viral titer of rHeN-1/2018-i12 was also lower than that of rHeN-1/2018 at the same time point post infection, especially at the 24 hpi, the difference of virus titer between the two viruses can be up to 10 times. 【Conclusion】The IRES mutant virus rHeN-1/2018-i12 was constructed and rescued, and further confirmed the influence of IRES mutation on SVA viral biological characteristics in this study, which provided an insight of the pathogenesis of SVA, and broadened our understanding of the function of viral type IV IRES.