Scientia Agricultura Sinica ›› 2024, Vol. 57 ›› Issue (3): 597-612.doi: 10.3864/j.issn.0578-1752.2024.03.013

• ANIMAL SCIENCE·VETERINARY SCIENCE • Previous Articles     Next Articles

Estrogen Mediates CircZNF423 as a Sponge for oar-miR-541-3p to Target CALM3 for Regulating Myoblast Proliferation in Sheep

CHI RunQing1,2(), HAN HaiYin1(), WANG Peng1, LI KaiYang3, CHU MingXing2(), LIU YuFang2()   

  1. 1 College of Life Science and Food Engineering, Hebei University of Engineering, Handan 056021, Hebei
    2 Key Laboratory of Animal Genetics, Breeding and Reproduction of Ministry of Agriculture and Rural Affairs/Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing 100193
    3 Beijing General Station of Animal Husbandry, Beijing 100107
  • Received:2023-06-07 Accepted:2023-09-10 Online:2024-02-01 Published:2024-02-05

Abstract:

【Background】Estrogen is the main hormone secreted by female mammalian ovarian tissue, and it plays an important regulatory role in muscle growth and development. The circRNA has been found to be involved in a variety of signaling pathways related to muscle growth and development. 【Objective】According to the whole transcriptome integration analysis of ovariectomized and not ovariectomized Sunite sheep in our previous study, the circZNF423 was found to regulate the expression of oar-miR-541-3p/CALM3 as ceRNA. To further investigate the molecular mechanism of estrogen in sheep muscle growth, the effect of exogenous addition of estrogen-mediated regulation of oar-miR-541-3p/CALM3 by circZNF423 on myoblast proliferation was examined by sheep primary myoblast in vitro culture. This study could provide a theoretical basis for further study of the role of estrogen and circRNA in sheep growth and development trait, and also provide new research ideas for sheep molecular design breeding. 【Method】In this study, the sheep longissimus dorsi tissue was collected, and the sheep primary myoblast were isolated and cultured in vitro. The location of circZNF423 expression in myoblast was determined by immunofluorescence staining, RNA in situ hybridization (FISH) and nucleoplasmic separation experiments. RNA hybrid online software was used to predict the existence of binding relationship between circZNF423, oar-miR-541-3p and CALM3, and the binding of circZNF423 to oar-miR-541-3p, oar-miR-541-3p and CALM3 was verified by dual luciferase activity assay and biotin-labeled miRNA pull-down assay. The synthetic circZNF423 overexpression or interference plasmids, oar-miR-541-3p mimics (mimics) or inhibitors (inhibitors), and CALM3 overexpression or interference vectors were constructed in vitro and transfected in primary sheep myoblast, and the expression of proliferation markers and myoblast proliferation rate were detected using RT-qPCR, Western blot, EdU and CCK-8. To further clarify the role of estrogen in sheep muscle growth and development, the exogenous estradiol (E2) was added at different concentrations in vitro, and the changes in the expression of sheep myoblast proliferation were detected using RT-qPCR, Western blot, CCK-8, and EdU. 【Result】Immunofluorescence staining showed that the isolated primary myoblast were sheep myoblast and could be used for subsequent functional validation experiments. RNA in situ hybridization and nucleoplasmic isolation experiments showed that circZNF423 was mainly expressed in the cytoplasm of sheep myoblast. The results of RNAhybrid, dual luciferase activity assay and biotin-labeled miRNA pull-down assay showed a significant binding relationship between both circZNF423 and oar-miR-541-3p, oar-miR-541-3p and CALM3 3’UTR. The expression of proliferation markers PCNA, CDK2 and Pax7 in sheep myoblast was significant increased after circZNF423/CALM3 inhibition or oar-miR-541-3p overexpression (P<0.05 or P<0.01). The EdU and CCK8 results indicated that the proliferation rate of sheep myoblast was significantly increased after circZNF423/ CALM3 inhibition or oar-miR-541-3p overexpression (P<0.05), while the opposite was true after circZNF423/CALM3 overexpression or oar-miR-541-3p inhibition. The expression of sheep myoblast proliferation markers was significantly higher at 10 nmol·L-1 than that at 1 nmol·L-1 and 100 nmol·L-1 after the addition of different concentrations of exogenous estradiol (E2) (P<0.05 or P<0.01). The mRNA and protein expression levels of the proliferation markers PCNA, CDK2 and Pax7 significantly increased in sheep myoblast, while the expression of circZNF423 and CALM3 were significantly decreased and the expression of oar-miR-541-3p was significantly increased (P<0.05 or P<0.01). The results of EdU and CCK8 showed that the proliferation rate of sheep myoblast was significantly increased after the addition of estradiol in vitro (P<0.05). 【Conclusion】CircZNF423 as ceRNA regulated the binding and expression of oar-miR-541-3p and CALM3 in sheep myoblast, and the addition of exogenous estrogen promoted the proliferation of sheep myoblast by inhibiting the circZNF423/oar-miR-541-3p/CALM3 pathway. These results provided a theoretical basis for revealing the molecular mechanisms of estrogen and circZNF423 in the developmental traits of sheep skeletal muscle.

Key words: sheep, muscle development, estrogen, circZNF423, oar-miR-541-3p, CALM3

Table 1

Vector sequence information"

载体名称
Vector name
载体序列
Vector sequence (5′-3′)
siRNA-circZNF423 F: UCCUGGAGUUGAAGAGGGGTT
R: CCCCUCUUCAACUCCAGGATT
siRNA-CALM3 F: GAGGAGGUGGACGAAAUGATT
R: UCAUUUCGUCCACCUCCUCTT
oar-miR-541-3p mimics F: UGGUGGGCACAGAAUCCGGCCUCU
R: AGGCCGGAUUCUGUGCCCACCAUU
mimics NC/ siRNA NC F: UUCUCCGAACGUGUCACGUTT
R: ACGUGACACGUUCGGAGAATT
oar-miR-541-3p inhibitor F: AGAGGCCGGAUUCUGUGCCCACCA
inhibitor NC F: CAGUACUUUUGUGUAGUACAA

Table 2

Primer information for RT-qPCR"

基因名称
Gene name
引物序列
Primer sequence (5′-3′)
退火温度
Tm (℃)
circZNF423 F: CTGGAAGACAGGAACAGCGT 60
R: CTGACAGTGATCGCAGGTGT
oar-miR-541-3p F: TGGTGGGCACAGAATCCG 58
R: CAGTTTTTTTTTTTTTTTGGGCAG
CALM3 F: GGAGCAGATCGCAGAGTTCA 60
R: GCTCTGCGGCACTGATGTAC
PCNA F: TTGAAGAAAGTGCTGGAGGC 60
R: TTGGACATGCTGGTGAGGTT
CDK2 F: AAGTGGCTGCATCACAAGGA 60
R: CAAGCTCCGTCCATCTTCAT
Pax7 F: CGTGCCCTCAGTGAGTTCGA 60
R: CCAGACGGTTCCCTTTGTCG
β-actin F: AGCCTTCCTTCCTGGGCATGGA 60
R: GCTCTGCGGCACTGATGTAC
U6 F: AACGCTTCACGAATTTGCGT 60
R: CTCGCTTCGGCAGCACA
GAPDH F: CACGGCACAGTCAAGGCAG 60
R: AGATGATGACCCTCTTGGCG

Fig. 1

Identification and expression level analysis of circZNF423 A. Sanger sequencing; B. RNase R experiments; C. Nucleoplasm separation experiments; D. RNA fluorescence in situ hybridization experiments; E. Immunofluorescence staining assay. *P<0.05, **P<0.01, *** P<0.001; ns, not significant"

Fig. 2

Expression analysis of circZNF423, oar-miR-541-3p and CALM3 in sheep muscle tissue A. Relative expression of circZNF423; B. Relative expression of CALM3; C. Relative expression of oar-miR-541-3p; D Protein expression of CALM3 in sheep muscle tissues with GAPDH as an internal control and Western blot to quantify the results. E. RNAhybrid prediction analysis; F. Dual luciferase reporter gene assay; G. RNA pull-down experiments with biotin-labeled oar-miR-541-3p.*. P<0.05; **. P<0.01; ***. P<0.001; ns, not significant"

Fig. 3

Effect of circZNF423 on the proliferation of sheep myoblasts A. The relative expression of CALM3, Pax7, PCNA, CDK2 and oar-miR-541-3p in sheep myoblasts after overexpression of circZNF423; B. The relative expression of CALM3, Pax7, PCNA, CDK2 and oar-miR-541-3p in sheep myoblasts after inhibition of circZNF423; C. The protein expression of CALM3, Pax7, PCNA and CDK2 in sheep myoblasts after overexpression/inhibition of circZNF423 and the gray value analysis; D, E. The CCK-8 assay of the myoblast proliferation after overexpression or inhibition of circZNF423; F, G. The EdU assay of the myoblast proliferation after overexpression or inhibition of circZNF423. *. P<0.05; **. P<0.01; ***. P<0.001; ns, not significant"

Fig. 4

Effect of oar-miR-541-3p on the proliferation of sheep myogenic cells by regulating the expression of CALM3 and circZNF423 A. The relative expression of CALM3, circZNF423, PCNA, Pax7 and CDK2 after oar-miR-541-3p overexpression; B. The relative expression of CALM3, circZNF423, PCNA, Pax7 and CDK2 after oar-miR-541-3p inhibition. C. The protein expression of CALM3, PCNA, Pax7 and CDK2 after oar-miR-541-3p overexpression or inhibition and the gray value analysis; D, E. The EdU assay of the myoblast proliferation after oar-miR-541-3p overexpression or inhibition; F,G. The CCK-8 assay of the myoblast proliferation after oar-miR-541-3p overexpression or inhibition. *. P<0.05; **. P<0.01; ***P<0.001; ns, not significant"

Fig. 5

Effect of CALM3 on the proliferation of sheep myoblasts A. The relative expression of CALM3, Pax7, PCNA and CDK2 in sheep myoblasts after overexpression of CALM3; B. The relative expression of CALM3, Pax7, PCNA and CDK2 in sheep myoblasts after inhibition of CALM3; C. The protein expression of CALM3, Pax7, PCNA and CDK2 in sheep myoblasts after overexpression/inhibition of CALM3 and the gray value analysis; D, E. The CCK-8 assay of the myoblast proliferation after overexpression or inhibition of CALM3; F, G. The EdU assay of the myoblast proliferation after overexpression or inhibition of CALM3. *. P<0.05; **. P<0.01; ***. P<0.001; ns, not significant"

Fig. 6

Effect of estradiol on the proliferation of sheep myoblasts A. In vitro addition of different concentrations of estradiol was tested for the optimal concentration affecting sheep myogenic cell proliferation; B. Protein expression and gray value analysis of PCNA, Pax7 and CDK2 in sheep myogenic cells after the addition of 10 nmol·L-1 estradiol; C. CCK-8 assay for myoblast proliferation; D. EdU assay for myoblast proliferation; E. Relative expression of circZNF423, oar-miR-541-3p, and CALM3 in sheep myocytes after the addition of 10 nmol·L-1 estradiol; F. Analysis of the protein expression and grayscale values of CALM3 after the addition of 10 nmol·L-1 estradiol. *. P<0.05; **. P<0.01; ns, not significant"

[1]
LI R Y, LI B J, JIANG A W, CAO Y, HOU L M, ZHANG Z K, ZHANG X Y, LIU H L, KIM K H, WU W J. Exploring the lncRNAs related to skeletal muscle fiber types and meat quality traits in pigs. Genes, 2020, 11(8): 883.

doi: 10.3390/genes11080883
[2]
WANG S S, JIN J J, XU Z Y, ZUO B. Functions and regulatory mechanisms of lncRNAs in skeletal myogenesis, muscle disease and meat production. Cells, 2019, 8(9): 1107.

doi: 10.3390/cells8091107
[3]
PELLEGRINO A, TIIDUS P M, VANDENBOOM R. Mechanisms of estrogen influence on skeletal muscle: mass, regeneration, and mitochondrial function. Sports Medicine, 2022, 52(12): 2853-2869.

doi: 10.1007/s40279-022-01733-9
[4]
SALZMAN J, GAWAD C, WANG P L, LACAYO N, BROWN P O. Circular RNAs are the predominant transcript isoform from hundreds of human genes in diverse cell types. PLoS ONE, 2012, 7(2): e30733.

doi: 10.1371/journal.pone.0030733
[5]
SALZMAN J, CHEN R E, OLSEN M N, WANG P L, BROWN P O. Cell-type specific features of circular RNA expression. PLoS Genetics, 2013, 9(9): e1003777.

doi: 10.1371/journal.pgen.1003777
[6]
JECK W R, SORRENTINO J A, WANG K, SLEVIN M K, BURD C E, LIU J Z, MARZLUFF W F, SHARPLESS N E. Circular RNAs are abundant, conserved, and associated with ALU repeats. RNA, 2013, 19(2): 141-157.

doi: 10.1261/rna.035667.112 pmid: 23249747
[7]
DAUBAS P, BUCKINGHAM M E. Direct molecular regulation of the myogenic determination gene Myf5 by Pax3, with modulation by Six1/4 factors, is exemplified by the -111 kb-Myf5 enhancer. Developmental Biology, 2013, 376(2): 236-244.

doi: 10.1016/j.ydbio.2013.01.028
[8]
KASSAR-DUCHOSSOY L, GAYRAUD-MOREL B, GOMÈS D, ROCANCOURT D, BUCKINGHAM M, SHININ V, TAJBAKHSH S. Mrf4 determines skeletal muscle identity in Myf5: Myod double- mutant mice. Nature, 2004, 431(7007): 466-471.

doi: 10.1038/nature02876
[9]
BUCKINGHAM M, RELAIX F. PAX3 and PAX7 as upstream regulators of myogenesis. Seminars in Cell & Developmental Biology, 2015, 44: 115-125.
[10]
HUDMON A, SCHULMAN H. Structure-function of the multifunctional Ca2+/calmodulin-dependent protein kinase II. The Biochemical Journal, 2002, 364(Pt 3): 593-611.

doi: 10.1042/bj20020228
[11]
CABELKA C A, BAUMANN C W, COLLINS B C, NASH N, LE G Y, LINDSAY A, SPANGENBURG E E, LOWE D A. Effects of ovarian hormones and estrogen receptor α on physical activity and skeletal muscle fatigue in female mice. Experimental Gerontology, 2019, 115: 155-164.

doi: S0531-5565(18)30604-1 pmid: 30415069
[12]
HANSEN M. Female hormones: Do they influence muscle and tendon protein metabolism? The Proceedings of the Nutrition Society, 2018, 77(1): 32-41.
[13]
KARVINEN S, JUPPI H K, LE G Y, CABELKA C A, MADER T L, LOWE D A, LAAKKONEN E K. Estradiol deficiency and skeletal muscle apoptosis: Possible contribution of microRNAs. Experimental Gerontology, 2021, 147: 111267.

doi: 10.1016/j.exger.2021.111267
[14]
HANSEN T B, JENSEN T I, CLAUSEN B H, BRAMSEN J B, FINSEN B, DAMGAARD C K, KJEMS J. Natural RNA circles function as efficient microRNA sponges. Nature, 2013, 495(7441): 384-388.

doi: 10.1038/nature11993
[15]
LI F, ZHANG L Y, LI W, DENG J Q, ZHENG J, AN M X, LU J C, ZHOU Y F. Circular RNA ITCH has inhibitory effect on ESCC by suppressing the Wnt/β-catenin pathway. Oncotarget, 2015, 6(8): 6001-6013.

doi: 10.18632/oncotarget.3469 pmid: 25749389
[16]
BAK R O, MIKKELSEN J G. miRNAsponges: soakingupmiRNAs for regulation of gene expression. Wiley Interdisciplinary Reviews: RNA, 2014, 5(3): 317-333.

doi: 10.1002/wrna.2014.5.issue-3
[17]
RONG D W, SUN H D, LI Z X, LIU S H, DONG C X, FU K, TANG W W, CAO H Y. An emerging function of circRNA-miRNAs-mRNA axis in human diseases. Oncotarget, 2017, 8(42): 73271-73281.

doi: 10.18632/oncotarget.19154 pmid: 29069868
[18]
SUZUKI H, ZUO Y H, WANG J H, ZHANG M Q, MALHOTRA A, MAYEDA A. Characterization of RNase R-digested cellular RNA source that consists of lariat and circular RNAs from pre-mRNA splicing. Nucleic Acids Research, 2006, 34(8): e63.

doi: 10.1093/nar/gkl151 pmid: 16682442
[19]
JECK W R, SHARPLESS N E. Detecting and characterizing circular RNAs. Nature Biotechnology, 2014, 32(5): 453-461.

doi: 10.1038/nbt.2890 pmid: 24811520
[20]
QI A, RU W X, YANG H Y, YANG Y, TANG J, YANG S L, LAN X Y, LEI C Z, SUN X Z, CHEN H. Circular RNA ACTA1 acts as a sponge for miR-199a-5p and miR-433 to regulate bovine myoblast development through the MAP3K11/MAP2K7/JNK pathway. Journal of Agricultural and Food Chemistry, 2022, 70(10): 3357-3373.

doi: 10.1021/acs.jafc.1c07762 pmid: 35234473
[21]
CHEN B, YU J, GUO L J, BYERS M S, WANG Z J, CHEN X L, XU H P, NIE Q H. Circular RNA circHIPK3 promotes the proliferation and differentiation of chicken myoblast cells by sponging miR-30a-3p. Cells, 2019, 8(2): 177.

doi: 10.3390/cells8020177
[22]
ZHANG L, ZHOU C F, JIANG X Y, HUANG S T, LI Y H, SU T, WANG G W, ZHOU Y, LIU M, XU D Q. Circ0001470 acts as a miR-140-3p sponge to facilitate the progression of embryonic development through regulating PTGFR expression. Cells, 2022, 11(11): 1746.

doi: 10.3390/cells11111746
[23]
SZABO L, SALZMAN J. Detecting circular RNAs: Bioinformatic and experimental challenges. Nature Reviews Genetics, 2016, 17(11): 679-692.

doi: 10.1038/nrg.2016.114 pmid: 27739534
[24]
ELNOUR I E, WANG X G, ZHANSAYA T, AKHATAYEVA Z, KHAN R, CHENG J, HUNG Y, LAN X Y, LEI C Z, CHEN H. Circular RNA circMYL1 inhibit proliferation and promote differentiation of myoblasts by sponging miR-2400. Cells, 2021, 10(1): 176.

doi: 10.3390/cells10010176
[25]
YANG Z X, SONG C C, JIANG R, HUANG Y Z, LAN X Y, LEI C Z, QI X L, ZHANG C L, HUANG B Z, CHEN H. CircNDST1 regulates bovine myoblasts proliferation and differentiation via the miR-411a/ Smad4 axis. Journal of Agricultural and Food Chemistry, 2022, 70(32): 10044-10057.

doi: 10.1021/acs.jafc.1c08167
[26]
YUE B L, WANG J, RU W X, WU J Y, CAO X K, YANG H Y, HUANG Y Z, LAN X Y, LEI C Z, HUANG B Z, CHEN H. The circular RNA circHUWE1 sponges the miR-29b-AKT3 axis to regulate myoblast development. Molecular Therapy Nucleic Acids, 2020, 19: 1086-1097.

doi: 10.1016/j.omtn.2019.12.039
[27]
CHEN X L, OUYANG H J, WANG Z J, CHEN B, NIE Q H. A novel circular RNA generated by FGFR2 gene promotes myoblast proliferation and differentiation by sponging miR-133a-5p and miR-29b-1-5p. Cells, 2018, 7(11): 199.

doi: 10.3390/cells7110199
[28]
TOUTENHOOFD S L, FOLETTI D, WICKI R, RHYNER J A, GARCIA F, TOLON R, STREHLER E E. Characterization of the human CALM2 calmodulin gene and comparison of the transcriptional activity of CALM1, CALM2 and CALMS. Cell Calcium, 1998, 23(5): 323-338.

doi: 10.1016/S0143-4160(98)90028-8
[29]
KUMAR A, RANI B, SHARMA R, KAUR G, PRASAD R, BAHL A, KHULLAR M. Correction to: ACE2, CALM3 and TNNI3K polymorphisms as potential disease modifiers in hypertrophic and dilated cardiomyopathies. Molecular and Cellular Biochemistry, 2019, 450(1/2): 209-210.

doi: 10.1007/s11010-018-3482-x
[30]
PHAN N N, WANG C Y, LIN Y C. The novel regulations of MEF2A, CAMKK2, CALM3, and TNNI3 in ventricular hypertrophy induced by arsenic exposure in rats. Toxicology, 2014, 324: 123-135.

doi: 10.1016/j.tox.2014.07.010
[31]
ZHAO Z L, XUE F, GU Y P, HAN J X, JIA Y X, YE K Q, ZHANG Y. Crosstalk between the muscular estrogen receptor α and BDNF/TrkB signaling alleviates metabolic syndrome via 7, 8-dihydroxyflavone in female mice. Molecular Metabolism, 2021, 45: 101149.

doi: 10.1016/j.molmet.2020.101149
[32]
OOSTHUYSE T, BOSCH A N. The effect of the menstrual cycle on exercise metabolism: implications for exercise performance in eumenorrhoeic women. Sports Medicine, 2010, 40(3): 207-227.

doi: 10.2165/11317090-000000000-00000 pmid: 20199120
[33]
COUNTS B R, FIX D K, HETZLER K L, CARSON J A. The effect of estradiol administration on muscle mass loss and Cachexia progression in female apc (Min/+) mice. Frontiers in Endocrinology, 2019, 10: 720.

doi: 10.3389/fendo.2019.00720
[34]
ZHAO J, IMBRIE G A, BAUR W E, IYER L K, ARONOVITZ M J, KERSHAW T B, HASELMANN G M, LU Q, KARAS R H. Estrogen receptor-mediated regulation of microRNA inhibits proliferation of vascular smooth muscle cells. Arteriosclerosis, Thrombosis, and Vascular Biology, 2013, 33(2): 257-265.

doi: 10.1161/ATVBAHA.112.300200
[35]
HEVENER A L, RIBAS V, MOORE T M, ZHOU Z Q. ERα in the control of mitochondrial function and metabolic health. Trends in Molecular Medicine, 2021, 27(1): 31-46.

doi: 10.1016/j.molmed.2020.09.006 pmid: 33020031
[36]
KO S H, JUNG Y. Energy metabolism changes and dysregulated lipid metabolism in postmenopausal women. Nutrients, 2021, 13(12): 4556.

doi: 10.3390/nu13124556
[37]
SEKO D, FUJITA R, KITAJIMA Y, NAKAMURA K, IMAI Y, ONO Y. Estrogen receptor β controls muscle growth and regeneration in young female mice. Stem Cell Reports, 2020, 15(3): 577-586.

doi: S2213-6711(20)30294-0 pmid: 32822588
[38]
LIU S Q, LIU Z Y, WANG P, LI W T, ZHAO S G, LIU Y F, CHU M X. Estrogen-mediated oar-miR-485-5p targets PPP1R13B to regulate myoblast proliferation in sheep. International Journal of Biological Macromolecules, 2023, 236: 123987.

doi: 10.1016/j.ijbiomac.2023.123987
[1] GAO YunJie, GUO RuoNan, CHEN ChunWen, DUAN YiFan, ZHANG ZhenJun, NIE ChanChan, LI MengYu, WANG Hui, FENG TingTing, CUI YingYing, DANG GuangHui, LIU SiGuo. Establishment and Preliminary Application of Indirect ELISA Antibody Detection Method for Mycobacterium avium subsp. paratuberculosis in Sheep [J]. Scientia Agricultura Sinica, 2026, 59(3): 655-667.
[2] YAN ChuanBo, GONG Ping, ZHENG WenXin, CHEN XinWen, GUO LeiFeng. Research on Sheep Mounting Behavior Recognition in Complex Scenes Based on an Improved YOLOv11 [J]. Scientia Agricultura Sinica, 2025, 58(18): 3783-3798.
[3] ZHANG YingXin, YANG Min, BAI XueBing, CHEN Chang, WU RuiZhi, YANG Ping, CHEN QiuSheng. Morphological Characteristics of Telocytes at Sheep Acupoints and Its Relationship with Surrounding Structures [J]. Scientia Agricultura Sinica, 2023, 56(7): 1417-1428.
[4] ZHAO WeiHong, HAN WenXiong, YANG Bo, MENG WeiKang, CHAI HaiLiang, MA YiMin, ZHANG ZhanSheng, WANG LiFeng, WANG Yan, WANG MingYuan, ZHANG Shan, DING YuLin, WANG JinLing, JIRINTAI Sulijid, WANG FengLong, ZHAO Li, LIU YongHong. Isolation and Genotyping of Mycobacterium avium subsp. paratuberculosis from Sheep in Inner Mongolia [J]. Scientia Agricultura Sinica, 2023, 56(6): 1204-1214.
[5] GUO ZeYuan, DU ZhangSheng, ZHANG YaQi, CHEN ChunLu, MA XiaoYan, CHENG Ying, WANG Kai, LÜ LiHua. Effects of Smad7-Mediated TGF-β Signaling Pathway on Proliferation of Sheep Granulosa Cells [J]. Scientia Agricultura Sinica, 2023, 56(13): 2597-2608.
[6] AYIMUGULI Abudureyimu, ZHANG Chen, CAI Yong, QIN Sheng, LUO WenXue, ZHAXIYINGPAI. The Micro-Structure of Tibetan Sheep Lung and Its HIF-1α and AQP1 Expression Characteristics [J]. Scientia Agricultura Sinica, 2023, 56(11): 2202-2211.
[7] LIU YuFang,CHEN YuLin,ZHOU ZuYang,CHU MingXing. miR-221-3p Regulates Ovarian Granulosa Cells Apoptosis by Targeting BCL2L11 in Small-Tail Han Sheep [J]. Scientia Agricultura Sinica, 2022, 55(9): 1868-1876.
[8] CHE DaLu,ZHAO LiChen,CHENG SuCai,LIU AiYu,LI XiaoYu,ZHAO ShouPei,WANG JianCheng,WANG Yuan,GAO YuHong,SUN XinSheng. Effect of Litter Bed on Growth Performance and Odor Emission in Fattening Lamb [J]. Scientia Agricultura Sinica, 2022, 55(24): 4943-4956.
[9] SONG ShuZhen, GAO LiangShuang, LI Hong, GONG XuYin, LIU LiShan, WEI YuBing. Effects of Feeding Levels on Muscle Tissue Structure and Muscle Fiber Composition Related Genes in Sheep [J]. Scientia Agricultura Sinica, 2022, 55(21): 4304-4314.
[10] ChunTao ZHANG,Tao MA,Yan TU,QiYu DIAO. Effects of Circadian Rhythm on Rumen Fermentation and Nutrient Digestion of Mutton Sheep [J]. Scientia Agricultura Sinica, 2022, 55(18): 3664-3674.
[11] LIU WangJing,TANG DeFu,AO ChangJin. Effect of Allium mongolicum Regel and Its Extracts on the Growth Performance, Carcass Characteristics, Meat Quality and Serum Biochemical Indices of Captive Small-Tailed Han Sheep [J]. Scientia Agricultura Sinica, 2022, 55(17): 3461-3472.
[12] LIANG Peng,ZHANG TianWen,MENG Ke,SHAO ShunCheng,ZOU ShiFan,RONG Xuan,QIANG Hao,FENG DengZhen. Association Analysis of the ADIPOQ Variation with Sheep Growth Traits [J]. Scientia Agricultura Sinica, 2022, 55(11): 2239-2256.
[13] KE Na,HAO ZhiYun,WANG JianQing,ZHEN HuiMin,LUO YuZhu,HU Jiang,LIU Xiu,LI ShaoBin,ZHAO ZhiDong,HUANG ZhaoChun,LIANG WeiWei,WANG JiQing. The miR-221 Inhibits the Viability and Proliferation of Ovine Mammary Epithelial Cells by Targeting IRS1 [J]. Scientia Agricultura Sinica, 2022, 55(10): 2047-2056.
[14] WANG Qian,LI Zheng,ZHAO ShanShan,QIE MengJie,ZHANG JiuKai,WANG MingLin,GUO Jun,ZHAO Yan. Application of Stable Isotope Technology in the Origin Traceability of Sheep [J]. Scientia Agricultura Sinica, 2021, 54(2): 392-399.
[15] LI SongMei,QIU YuGe,CHEN ShengNan,WANG XiaoMeng,WANG ChunSheng. CRISPR/Cas9 Mediated Exogenous Gene Knock-in at ROSA26 Locus in Sheep Umbilical Cord Mesenchymal Stem Cells [J]. Scientia Agricultura Sinica, 2021, 54(2): 400-411.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!