Scientia Agricultura Sinica ›› 2018, Vol. 51 ›› Issue (18): 3582-3590.doi: 10.3864/j.issn.0578-1752.2018.18.014

• ANIMAL SCIENCE·VETERINARY SCIENCE·RESOURCE INSECT • Previous Articles     Next Articles

Effects of FSH Treatment on Steroidogenic Enzymes Expression and Histone H3 Modification in Pig Granulosa Cells

JinBi ZHANG(), Wang YAO, ZengXiang PAN, HongLin LIU()   

  1. College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095
  • Received:2017-04-25 Accepted:2018-07-06 Online:2018-09-16 Published:2018-09-16

Abstract:

【Objective】The objective of this study was to explore whether FSH treatment affect expressions of genes including steroidogenic enzymes, pituitary hormone receptors and apoptosis related genes in porcine granulosa cells, and to detect the histone H3 modification on specific gene regulation regions involved in this process. 【Method】 Firstly, ovary granulosa cells were collected using syringe extraction method from porcine ovaries and cultured in media with serum until the cells attached. After 16 h of non-serum culture, granulosa cells were treated by 5 IU?mL-1 FSH for another 24 h culture and harvested for following experiment. Secondly, transcriptional expression changes of steroidogenic enzymes (STAR, CYP11A1, HSD3B and CYP19A1), pituitary hormone receptors (FSHR and LHR) and apoptosis related genes (XIAP and FasL) were detected using qRT-PCR method. Finally, histone H3 modification (H3K4me2, H3K4me3, H3K9ac and H3K14ac) status on regulatory regions of STAR, CYP19A1 and HSD3B genes were detected by ChIP-qPCR.【Result】 Treatment of 5 IU?mL-1 FSH induced a significant upregulation of STAR, CYP19A1 and HSD3B genes with fold changes of 2 (P<0.01), 2.8 (P<0.0), and 3.6 (P<0.05), respectively, but had no significant effect on CYP11A1, pituitary hormone receptors FSHR, LHR and apoptosis related genes XIAP, FasL. Among the three steroidogenic genes, the histone modifications of HSD3B regulatory region were the most significant. The fold change of H3K4me2, H3K4me3, H3K9ac and H3K14ac was 14.7 (P<0.01), 13.6 (P<0.01), 19.7 (P<0.01) and 2.5 (P<0.05), respectively. H3K9ac on STAR gene regulation region decreased 11.1 (P<0.01) times. H3K4me3 on CYP19A regulation region increased 0.5 (P<0.01) times while H3K9ac decreased 10.4 (P<0.01) times. Other histone modification changes were not significant. 【Conclusion】24 h of FSH treatment enhanced the transcription levels of steroidogenic enzymes in pig granulosa cells. The up-regulation process involved H3 histone modifications in a gene-specific manner. Independent FSH treatment was not capable to induce significant effect on candidate pituitary hormone receptor and apoptosis related genes.

Key words: pig, FSH, granulosa cells, steroidogenic enzymes, histone modification

Table 1

Primer and PCR reaction conditions"

基因Gene 登陆号Acc. No. 引物(5'- 3')Primer (5'- 3') 产物长度Product length(bp)
STAR XM_005671764.2 F: GCTGAGCCCTTTCGTGTCTA 140
R: CATAGGACCTGCCGTGTCTG
CYP11A1 NM_214427.1 F: AGACACTGAGACTCCACCCCA 110
R: GACGGCCACTTGTACCAATGT
HSD3B NM_001004049.1 F: CCCAGTGTTTTCTGGTTCCT 131
R: TTCTCCTCCAGCAACAAGTG
CYP19A NM_214431.1 F: TGCTGGACACCTCTAACAA 264
R: TCAACTCAGTGGCGAAAT
FSHR NM_214386.3 F: GAATTGAAAAGGCCAACAAC 214
R: CTTTCAAAACTTAGTCCCACG
LHR NM_214449.1 F: ACTCCAATGTGCTCCCGAAC 222
R: AGTAGCAGGTAGAGCCCCAT
XIAP NM_001097436.1 F: ACTGGCCAGACTATGCTCAC 107
R: CAGTTTCCCGCCACAACAAA
FasL-2 AY033634 F: CCACCACTCCTGCCATCAA 135
R: CAGCCCCAATCCAACCA
GAPDH AF017079 F: GGACTCATGACCACGGTCCAT 220
R: TCAGATCCACAACCGACACGT
STAR-ChIP chr15:55501189
-55501271
F: GAGCAACATTCCTCCCTAGACT 83
R: CAGCCCCAATCCAACCA
HSD3B-ChIP chr4:111565035
-111565175
F: GCCGGCTGTGACTATTTGGA 141
R: TGCTTCAAGGACTGTGTCCC
CYP19A-ChIP chr1:133903003
-133903130
F: ACCCTTAACTCAAAAGAACCCA 128
R: AATTTTGCAGTGGCGGGATT

Fig. 1

Steroidogenic enzymes expression in response to FSH treatment in granulosa cells *. P<0.05,**. P<0.01 The same as below"

Fig. 2

Pituitary hormone receptors expression in response to FSH treatment in granulosa cells"

Fig. 3

Apoptosis related genes expression in response to FSH treatment in granulosa cells"

Fig. 4

Histone modification on HSD3B gene regulatory region in response to FSH treatment in granulosa cells"

Fig. 5

Histone modification on STAR gene regulatory region in response to FSH treatment in granulosa cells"

Fig. 6

Histone modification on CYP19A gene regulatory region in response to FSH treatment in granulosa cells"

Fig. 7

Biosynthesis of steroid hormones Steroid hormones are in bold, steroidogenic enzymes are encircled"

[1] TURNER B M.Histone acetylation and an epigenetic code. Bioessays, 2000, 22(9): 836-845.
[2] KOUZARIDES T.Histone methylation in transcriptional control. Current Opinion in Genetics & Development, 2002, 12(2): 198-209.
[3] ROSSETTO D, AVVAKUMOV N, COTE J.Histone phosphorylation. Journal of the Dna Methylation Society, 2012, 7(10): 1098-1108.
[4] QIN W, WOLF P, LIU N, LINK S, SMETS M, MASTRA F L, FORN, EACUTE I, PICHLER G, H RL D, FELLINGER K.DNA methylation requires a DNMT1 ubiquitin interacting motif (UIM) and histone ubiquitination. Cell Research, 2015, 25(8): 911-929.
doi: 10.1038/cr.2015.72 pmid: 4528052
[5] MESSNER S, HOTTIGER M O.Histone ADP-ribosylation in DNA repair, replication and transcription. Trends in Cell Biology, 2011, 21(9): 534.
doi: 10.1016/j.tcb.2011.06.001 pmid: 21741840
[6] GOUGEON A.Dynamics of follicular growth in the human: a model from preliminary results. Human Reproduction, 1986, 1(2): 81-87.
doi: 10.1016/0028-2243(86)90053-5 pmid: 3558758
[7] HUNZICKERDUNN M, MAIZELS E T.FSH signaling pathways in immature granulosa cells that regulate target gene expression: Branching out from protein kinase A. Cellular Signalling, 2006, 18(9): 1351-1359.
doi: 10.1016/j.cellsig.2006.02.011 pmid: 16616457
[8] ASAHARA S, SATO A, ALJONAID A A, MARUO T.Thyroid hormone synergizes with follicle stimulating hormone to inhibit apoptosis in porcine granulosa cells selectively from small follicles. Kobe Journal of Medical Sciences, 2003, 49(5-6): 107-116.
doi: 10.1029/JA079i025p03791 pmid: 15141146
[9] MAKRIGIANNAKIS A, COUKOS G, CHRISTOFIDOU- SOLOMIDOU M, MONTAS S, COUTIFARIS C.Progesterone is an autocrine/paracrine regulator of human granulosa cell survivalin vitro. Annals of the New York Academy of Sciences, 2000, 900(1): 16-25.
doi: 10.1111/j.1749-6632.2000.tb06212.x pmid: 10818388
[10] PAYNE A H, HALES D B.Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid hormones. Endocrine Reviews, 2005, 25(6): 947-970.
doi: 10.1210/er.2003-0030 pmid: 15583024
[11] CHRISTENSON L K, STOUFFER R L, RD S J.Quantitative analysis of the hormone-induced hyperacetylation of histone H3 associated with the steroidogenic acute regulatory protein gene promoter. Journal of Biological Chemistry, 2001, 276(29): 27392-27399.
doi: 10.1074/jbc.M101650200 pmid: 11346648
[12] RODGERS R J, RODGERS H F, WATERMAN M R, SIMPSON E R.Immunolocalization of cholesterol side-chain-cleavage cytochrome P-450 and ultrastructural studies of bovine corpora lutea. Journal of Reproduction & Fertility, 1986, 78(2): 639-652.
doi: 10.1530/jrf.0.0780639 pmid: 3543334
[13] BELIN F, GOUDET G, DUCHAMP G, G RARD N. Intrafollicular concentrations of steroids and steroidogenic enzymes in relation to follicular development in the mare. Biology of Reproduction, 2001, 62(5): 1335.
doi: 10.1095/biolreprod62.5.1335 pmid: 10775185
[14] LI H, CHEN Y, YAN L Y, QIAO J.Increased expression of P450scc and CYP17 in development of endogenous hyperandrogenism in a rat model of PCOS. Endocrine, 2013, 43(1): 184-190.
doi: 10.1007/s12020-012-9739-3 pmid: 22798247
[15] MURRAY A A, SWALES A K, SMITH R E, MOLINEK M D, HILLIER S G, SPEARS N.Follicular growth and oocyte competence in the in vitro cultured mouse follicle: effects of gonadotrophins and steroids. Molecular Human Reproduction, 2008, 14(2): 75-83.
doi: 10.1093/molehr/gam092 pmid: 18204068
[16] KRISHANPAL K, KREBS A R, MUSTAPHA O A, HIROSHI K, LASZLO T.H3K9 and H3K14 acetylation co-occur at many gene regulatory elements, while H3K14ac marks a subset of inactive inducible promoters in mouse embryonic stem cells. Bmc Genomics, 2012, 13(1): 424.
doi: 10.1186/1471-2164-13-424
[17] KLEIN B J, SIMITHY J, WANG X, AHN J W, ANDREWS F H, YI Z, C T J, SHI X, GARCIA B A, KUTATELADZE T G. Recognition of Histone H3K14 Acylation by MORF. Structure, 2017.
doi: 10.1016/j.str.2017.02.003 pmid: 28286003
[18] LIVAK K J, SCHMITTGEN T D.Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001, 25(4): 402-408.
doi: 10.1006/meth.2001.1262
[19] HOWLES C M.Role of LH, FSH in ovarian function. Molecular & Cellular Endocrinology, 2000, 161(1-2): 25-30.
doi: 10.1016/S0303-7207(99)00219-1 pmid: 10773387
[20] LIU Z, RUDD M D, HERNANDEZGONZALEZ I, GONZALEZROBAYNA I, FAN H Y, ZELEZNIK A J, RICHARDS J S.FSH and FOXO1 regulate genes in the sterol/steroid and lipid biosynthetic pathways in granulosa cells.Molecular Endocrinology, 2009. 23(5): 649-661.
doi: 10.1210/me.2008-0412 pmid: 20202
[21] TILLY J L, LAPOLT P S, HSUEH A J.Hormonal regulation of follicle-stimulating hormone receptor messenger ribonucleic acid levels in cultured rat granulosa cells. Endocrinology, 1992, 130(3): 1296-1302.
doi: 10.1210/endo.130.3.1311235 pmid: 1311235
[22] LU C, YANG W, CHEN M, LIU T, YANG J, TAN P, LI L, HU X, FAN C, HU Z.Inhibin A inhibits follicle-stimulating hormone (FSH) action by suppressing its receptor expression in cultured rat granulosa cells. Molecular & Cellular Endocrinology, 2009, 298(1-2): 48-56.
doi: 10.1016/j.mce.2008.09.039 pmid: 18992787
[23] WEI S, GONG Z, SHENG L, LIANG H, LAI L, DENG Y.Maturation rates of oocytes and levels of FSHR, LHR and GnRHR of COCs response to FSH concentrations in IVM media for sheep. Journal of Applied Biomedicine, 2017, 15(3): 180-186.
doi: 10.1016/j.jab.2017.01.001
[24] LUO W, WILTBANK M C.Distinct Regulation by Steroids of Messenger RNAs for FSHR and CYP19A1 in Bovine Granulosa Cells. Biology of Reproduction, 2006, 75(2): 217-225.
doi: 10.1095/biolreprod.105.047407 pmid: 16641147
[25] ERICKSON G F, WANG C,HSUEH A J W. FSH induction of functional LH receptors in granulosa cells cultured in a chemically defined medium. Nature, 1979, 279(5711): 336-338.
[26] WANG Y, RIPPSTEIN P U, TSANG B K.Role and gonadotrophic regulation of X. Biology of Reproduction, 2003, 68(2): 610-619.
[27] WANG Y, ASSELIN E, TSANG B K, Involvement of transforming growth factor α in the regulation of rat ovarian x-linked inhibitor of apoptosis protein expression and follicular growth by follicle- stimulating hormone1. Biology of Reproduction, 2002, 66(6): 1672-1680.
[28] LIN P, RUI R.Effects of follicular size and FSH on granulosa cell apoptosis and atresia in porcine antral follicles. Molecular Reproduction & Development, 2010, 77(8): 670-678.
doi: 10.1002/mrd.21202 pmid: 20652999
[29] ZHANG C, XIA G, TSANG B K.Interactions of thyroid hormone and FSH in the regulation of rat granulosa cell apoptosis. Frontiers in Bioscience, 2011, 3(4): 1401-1413.
pmid: 21622145
[30] LEE L, ASADA H, KIZUKA F, TAMURA I, MAEKAWA R, TAKETANI T, SATO S, YAMAGATA Y, TAMURA H, SUGINO N.Changes in histone modification and DNA methylation of the StAR and Cyp19a1 promoter regions in granulosa cells undergoing luteinization during ovulation in rats. Endocrinology, 2013, 154(1): 458-470.
doi: 10.1210/en.2012-1610 pmid: 23183184
[31] DEMANNO D A, COTTOM J E, KLINE M P, PETERS C A, MAIZELS E T, HUNZICKERDUNN M.Follicle-stimulating hormone promotes histone H3 phosphorylation on serine-10. Molecular Endocrinology, 1999, 13(1): 91-105.
doi: 10.1210/mend.13.1.0222
[32] RIDDIHOUGH G.Deciphering the histone code. Science, 2016, 352(6286): 668-670.
[1] YUE XiaoYu, ZHAO ShiChen, WANG Qin. The miR-362-3p Regulates the Proliferation and Steroid Hormone Synthesis of Mare Follicular Granulosa Cells by Targeting BMPR2 [J]. Scientia Agricultura Sinica, 2026, 59(7): 1564-1575.
[2] CHEN YaRu, WANG Lei, FU Ming, HUANG Tao, ZHANG Hao, LIANG ZhenHua, PI JinSong, WU Yan. Molecular Mechanism of USP18 Facilitating Ferroptosis by Suppressing GPX4 Ubiquitination and Degradation in Duck Granulosa Cells [J]. Scientia Agricultura Sinica, 2026, 59(5): 1128-1140.
[3] ZHOU Qi, ZHANG ShiHao, ZHANG Liang, PAN Yu, ZHANG LiJuan, TU Zhi, PAN HongMei, LONG Xi. Prediction of the Potential Habitat Suitability of Luopanshan Pigs in Chongqing Based on the Optimized MaxEnt Model [J]. Scientia Agricultura Sinica, 2026, 59(1): 205-219.
[4] WANG JiYing, LI JingXuan, WANG YanPing, GUO JianFeng, LIN HaiChao, ZHAO XueYan. Weighted Gene Co-Expression Network Analysis Reveals Potential Candidate Genes Affecting Fat Deposition in Pigs [J]. Scientia Agricultura Sinica, 2025, 58(9): 1845-1855.
[5] JIN YiDan, HE NiQing, CHENG ZhaoPing, LIN ShaoJun, HUANG FengHuang, BAI KangCheng, ZHANG Tao, WANG WenXiao, YU MinXiang, YANG DeWei. Screening and Identification of Pigm-1 Interaction Proteins for Disease Resistance of Rice Blast [J]. Scientia Agricultura Sinica, 2025, 58(6): 1043-1051.
[6] LIU Jing, ZHAO ShiLin, YANG XiaoTing, WEI YiXuan, LI JiaPeng, ZHAO Yan. Study on the Origin Traceability of Beijing Black Pig Based on Stable Isotope Technology [J]. Scientia Agricultura Sinica, 2025, 58(23): 5071-5080.
[7] GAO Rong, LI HengYu, CHEN LiJuan, MA HuiLing. Physiological Effects of 5-AzaC on Alleviating Salt‑Alkali Stress in Alfalfa and Its Impact on the Expression of DNA Methylation Enzyme Genes [J]. Scientia Agricultura Sinica, 2025, 58(21): 4482-4496.
[8] GAO XiaoPing, PAN HongMei, GUO ZongYi, ZHANG JunJie, LIN Yan, ZHANG Liang. Post-Freezing Quality and Targeted Lipidomics Analysis of Rongchang Pig Spermatozoa with Different Freezing Tolerance [J]. Scientia Agricultura Sinica, 2025, 58(2): 387-400.
[9] XU YuanYuan, HUANG LiQing, LU XingRong, FENG Chao, SHANG JiangHua. Effects of β-mercaptoethanol on Rapamycin Induced Autophagy, Apoptosis and Steroid Hormone Synthesis in Buffalo Granulosa Cells [J]. Scientia Agricultura Sinica, 2025, 58(11): 2265-2274.
[10] ZHANG HuaPeng, ZHANG QingZe, HE Fan, QI MengFan, FU BinBin, LI QingChun, LI MengXun, MA LiPeng, LIU Yi, HUANG Tao. Cloning and Identification of Differentially Expressed lncRNAs in Follicles of Meishan Pigs and Duroc Pigs with Their Correlation Analysis with miRNAs [J]. Scientia Agricultura Sinica, 2024, 57(9): 1807-1819.
[11] ZHAO ZhenJian, WANG Kai, CHEN Dong, SHEN Qi, YU Yang, CUI ShengDi, WANG JunGe, CHEN ZiYang, YU ShiXin, CHEN JiaMiao, WANG XiangFeng, TANG GuoQing. Integrated Aanalysis of Genome and DNA Methylation for Screening Key Genes Related to Pork Quality Traits [J]. Scientia Agricultura Sinica, 2024, 57(7): 1394-1406.
[12] LIU ZhuoLin, LIU HongYun. The Potential and Mechanisms of Apigenin to Relieve Heat Stress and Hypoxia in Dairy Cows Based on Network Pharmacology and Molecular Docking [J]. Scientia Agricultura Sinica, 2024, 57(5): 1010-1022.
[13] MENG ZhaoYi, WANG YunLu, YAO YiLong, XI GuangYin, NIU JiaQiang, SOLANGSIZHU, GUO Min, XU YeFen. lncRNA-MSTRG.7889.1 Competitively Binds to bta-miR-146a Targeting Smad4 to Regulate Apoptosis of Yak Granulosa Cells [J]. Scientia Agricultura Sinica, 2024, 57(4): 797-809.
[14] ZHOU YuanQing, DONG HongMin, ZHU ZhiPing, WANG Yue, LI NanXi. Review on Carbon Footprint Assessment of Pig Farming System [J]. Scientia Agricultura Sinica, 2024, 57(2): 379-389.
[15] CAI RuiJie, CHU YiXin, SHI XinE, JIN JianJun, YANG GongShe. Dietary Addition of Cordyceps Militaris Can Alleviate Lipopolysaccharide- Induced Liver Damage and Skeletal Muscle Protein Degradation in Early Weaning Piglets [J]. Scientia Agricultura Sinica, 2024, 57(12): 2467-2482.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!