Scientia Agricultura Sinica ›› 2018, Vol. 51 ›› Issue (18): 3582-3590.doi: 10.3864/j.issn.0578-1752.2018.18.014

• ANIMAL SCIENCE·VETERINARY SCIENCE·RESOURCE INSECT • Previous Articles     Next Articles

Effects of FSH Treatment on Steroidogenic Enzymes Expression and Histone H3 Modification in Pig Granulosa Cells

JinBi ZHANG(), Wang YAO, ZengXiang PAN, HongLin LIU()   

  1. College of Animal Science and Technology, Nanjing Agricultural University, Nanjing 210095
  • Received:2017-04-25 Accepted:2018-07-06 Online:2018-09-16 Published:2018-09-16

RichHTML

10

PDF

110

Abstract:

【Objective】The objective of this study was to explore whether FSH treatment affect expressions of genes including steroidogenic enzymes, pituitary hormone receptors and apoptosis related genes in porcine granulosa cells, and to detect the histone H3 modification on specific gene regulation regions involved in this process. 【Method】 Firstly, ovary granulosa cells were collected using syringe extraction method from porcine ovaries and cultured in media with serum until the cells attached. After 16 h of non-serum culture, granulosa cells were treated by 5 IU?mL-1 FSH for another 24 h culture and harvested for following experiment. Secondly, transcriptional expression changes of steroidogenic enzymes (STAR, CYP11A1, HSD3B and CYP19A1), pituitary hormone receptors (FSHR and LHR) and apoptosis related genes (XIAP and FasL) were detected using qRT-PCR method. Finally, histone H3 modification (H3K4me2, H3K4me3, H3K9ac and H3K14ac) status on regulatory regions of STAR, CYP19A1 and HSD3B genes were detected by ChIP-qPCR.【Result】 Treatment of 5 IU?mL-1 FSH induced a significant upregulation of STAR, CYP19A1 and HSD3B genes with fold changes of 2 (P<0.01), 2.8 (P<0.0), and 3.6 (P<0.05), respectively, but had no significant effect on CYP11A1, pituitary hormone receptors FSHR, LHR and apoptosis related genes XIAP, FasL. Among the three steroidogenic genes, the histone modifications of HSD3B regulatory region were the most significant. The fold change of H3K4me2, H3K4me3, H3K9ac and H3K14ac was 14.7 (P<0.01), 13.6 (P<0.01), 19.7 (P<0.01) and 2.5 (P<0.05), respectively. H3K9ac on STAR gene regulation region decreased 11.1 (P<0.01) times. H3K4me3 on CYP19A regulation region increased 0.5 (P<0.01) times while H3K9ac decreased 10.4 (P<0.01) times. Other histone modification changes were not significant. 【Conclusion】24 h of FSH treatment enhanced the transcription levels of steroidogenic enzymes in pig granulosa cells. The up-regulation process involved H3 histone modifications in a gene-specific manner. Independent FSH treatment was not capable to induce significant effect on candidate pituitary hormone receptor and apoptosis related genes.

Key words: pig, FSH, granulosa cells, steroidogenic enzymes, histone modification

Table 1

Primer and PCR reaction conditions"

基因Gene 登陆号Acc. No. 引物(5'- 3')Primer (5'- 3') 产物长度Product length（bp）
STAR XM_005671764.2 F: GCTGAGCCCTTTCGTGTCTA 140
R: CATAGGACCTGCCGTGTCTG
CYP11A1 NM_214427.1 F: AGACACTGAGACTCCACCCCA 110
R: GACGGCCACTTGTACCAATGT
HSD3B NM_001004049.1 F: CCCAGTGTTTTCTGGTTCCT 131
R: TTCTCCTCCAGCAACAAGTG
CYP19A NM_214431.1 F: TGCTGGACACCTCTAACAA 264
R: TCAACTCAGTGGCGAAAT
FSHR NM_214386.3 F: GAATTGAAAAGGCCAACAAC 214
R: CTTTCAAAACTTAGTCCCACG
LHR NM_214449.1 F: ACTCCAATGTGCTCCCGAAC 222
R: AGTAGCAGGTAGAGCCCCAT
XIAP NM_001097436.1 F: ACTGGCCAGACTATGCTCAC 107
R: CAGTTTCCCGCCACAACAAA
FasL-2 AY033634 F: CCACCACTCCTGCCATCAA 135
R: CAGCCCCAATCCAACCA
GAPDH AF017079 F: GGACTCATGACCACGGTCCAT 220
R: TCAGATCCACAACCGACACGT
STAR-ChIP chr15:55501189
-55501271		 F: GAGCAACATTCCTCCCTAGACT 83
R: CAGCCCCAATCCAACCA
HSD3B-ChIP chr4:111565035
-111565175		 F: GCCGGCTGTGACTATTTGGA 141
R: TGCTTCAAGGACTGTGTCCC
CYP19A-ChIP chr1:133903003
-133903130		 F: ACCCTTAACTCAAAAGAACCCA 128
R: AATTTTGCAGTGGCGGGATT

Fig. 1

Steroidogenic enzymes expression in response to FSH treatment in granulosa cells *. P<0.05,**. P<0.01 The same as below"

Fig. 2

Pituitary hormone receptors expression in response to FSH treatment in granulosa cells"

Fig. 3

Apoptosis related genes expression in response to FSH treatment in granulosa cells"

Fig. 4

Histone modification on HSD3B gene regulatory region in response to FSH treatment in granulosa cells"

Fig. 5

Histone modification on STAR gene regulatory region in response to FSH treatment in granulosa cells"

Fig. 6

Histone modification on CYP19A gene regulatory region in response to FSH treatment in granulosa cells"

Fig. 7

Biosynthesis of steroid hormones Steroid hormones are in bold, steroidogenic enzymes are encircled"

[1] TURNER B M.Histone acetylation and an epigenetic code. Bioessays, 2000, 22(9): 836-845.
[2] KOUZARIDES T.Histone methylation in transcriptional control. Current Opinion in Genetics & Development, 2002, 12(2): 198-209.
[3] ROSSETTO D, AVVAKUMOV N, COTE J.Histone phosphorylation. Journal of the Dna Methylation Society, 2012, 7(10): 1098-1108.
[4] QIN W, WOLF P, LIU N, LINK S, SMETS M, MASTRA F L, FORN, EACUTE I, PICHLER G, H RL D, FELLINGER K.DNA methylation requires a DNMT1 ubiquitin interacting motif (UIM) and histone ubiquitination. Cell Research, 2015, 25(8): 911-929.
doi: 10.1038/cr.2015.72 pmid: 4528052
[5] MESSNER S, HOTTIGER M O.Histone ADP-ribosylation in DNA repair, replication and transcription. Trends in Cell Biology, 2011, 21(9): 534.
doi: 10.1016/j.tcb.2011.06.001 pmid: 21741840
[6] GOUGEON A.Dynamics of follicular growth in the human: a model from preliminary results. Human Reproduction, 1986, 1(2): 81-87.
doi: 10.1016/0028-2243(86)90053-5 pmid: 3558758
[7] HUNZICKERDUNN M, MAIZELS E T.FSH signaling pathways in immature granulosa cells that regulate target gene expression: Branching out from protein kinase A. Cellular Signalling, 2006, 18(9): 1351-1359.
doi: 10.1016/j.cellsig.2006.02.011 pmid: 16616457
[8] ASAHARA S, SATO A, ALJONAID A A, MARUO T.Thyroid hormone synergizes with follicle stimulating hormone to inhibit apoptosis in porcine granulosa cells selectively from small follicles. Kobe Journal of Medical Sciences, 2003, 49(5-6): 107-116.
doi: 10.1029/JA079i025p03791 pmid: 15141146
[9] MAKRIGIANNAKIS A, COUKOS G, CHRISTOFIDOU- SOLOMIDOU M, MONTAS S, COUTIFARIS C.Progesterone is an autocrine/paracrine regulator of human granulosa cell survivalin vitro. Annals of the New York Academy of Sciences, 2000, 900(1): 16-25.
doi: 10.1111/j.1749-6632.2000.tb06212.x pmid: 10818388
[10] PAYNE A H, HALES D B.Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid hormones. Endocrine Reviews, 2005, 25(6): 947-970.
doi: 10.1210/er.2003-0030 pmid: 15583024
[11] CHRISTENSON L K, STOUFFER R L, RD S J.Quantitative analysis of the hormone-induced hyperacetylation of histone H3 associated with the steroidogenic acute regulatory protein gene promoter. Journal of Biological Chemistry, 2001, 276(29): 27392-27399.
doi: 10.1074/jbc.M101650200 pmid: 11346648
[12] RODGERS R J, RODGERS H F, WATERMAN M R, SIMPSON E R.Immunolocalization of cholesterol side-chain-cleavage cytochrome P-450 and ultrastructural studies of bovine corpora lutea. Journal of Reproduction & Fertility, 1986, 78(2): 639-652.
doi: 10.1530/jrf.0.0780639 pmid: 3543334
[13] BELIN F, GOUDET G, DUCHAMP G, G RARD N. Intrafollicular concentrations of steroids and steroidogenic enzymes in relation to follicular development in the mare. Biology of Reproduction, 2001, 62(5): 1335.
doi: 10.1095/biolreprod62.5.1335 pmid: 10775185
[14] LI H, CHEN Y, YAN L Y, QIAO J.Increased expression of P450scc and CYP17 in development of endogenous hyperandrogenism in a rat model of PCOS. Endocrine, 2013, 43(1): 184-190.
doi: 10.1007/s12020-012-9739-3 pmid: 22798247
[15] MURRAY A A, SWALES A K, SMITH R E, MOLINEK M D, HILLIER S G, SPEARS N.Follicular growth and oocyte competence in the in vitro cultured mouse follicle: effects of gonadotrophins and steroids. Molecular Human Reproduction, 2008, 14(2): 75-83.
doi: 10.1093/molehr/gam092 pmid: 18204068
[16] KRISHANPAL K, KREBS A R, MUSTAPHA O A, HIROSHI K, LASZLO T.H3K9 and H3K14 acetylation co-occur at many gene regulatory elements, while H3K14ac marks a subset of inactive inducible promoters in mouse embryonic stem cells. Bmc Genomics, 2012, 13(1): 424.
doi: 10.1186/1471-2164-13-424
[17] KLEIN B J, SIMITHY J, WANG X, AHN J W, ANDREWS F H, YI Z, C T J, SHI X, GARCIA B A, KUTATELADZE T G. Recognition of Histone H3K14 Acylation by MORF. Structure, 2017.
doi: 10.1016/j.str.2017.02.003 pmid: 28286003
[18] LIVAK K J, SCHMITTGEN T D.Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001, 25(4): 402-408.
doi: 10.1006/meth.2001.1262
[19] HOWLES C M.Role of LH, FSH in ovarian function. Molecular & Cellular Endocrinology, 2000, 161(1-2): 25-30.
doi: 10.1016/S0303-7207(99)00219-1 pmid: 10773387
[20] LIU Z, RUDD M D, HERNANDEZGONZALEZ I, GONZALEZROBAYNA I, FAN H Y, ZELEZNIK A J, RICHARDS J S.FSH and FOXO1 regulate genes in the sterol/steroid and lipid biosynthetic pathways in granulosa cells.Molecular Endocrinology, 2009. 23(5): 649-661.
doi: 10.1210/me.2008-0412 pmid: 20202
[21] TILLY J L, LAPOLT P S, HSUEH A J.Hormonal regulation of follicle-stimulating hormone receptor messenger ribonucleic acid levels in cultured rat granulosa cells. Endocrinology, 1992, 130(3): 1296-1302.
doi: 10.1210/endo.130.3.1311235 pmid: 1311235
[22] LU C, YANG W, CHEN M, LIU T, YANG J, TAN P, LI L, HU X, FAN C, HU Z.Inhibin A inhibits follicle-stimulating hormone (FSH) action by suppressing its receptor expression in cultured rat granulosa cells. Molecular & Cellular Endocrinology, 2009, 298(1-2): 48-56.
doi: 10.1016/j.mce.2008.09.039 pmid: 18992787
[23] WEI S, GONG Z, SHENG L, LIANG H, LAI L, DENG Y.Maturation rates of oocytes and levels of FSHR, LHR and GnRHR of COCs response to FSH concentrations in IVM media for sheep. Journal of Applied Biomedicine, 2017, 15(3): 180-186.
doi: 10.1016/j.jab.2017.01.001
[24] LUO W, WILTBANK M C.Distinct Regulation by Steroids of Messenger RNAs for FSHR and CYP19A1 in Bovine Granulosa Cells. Biology of Reproduction, 2006, 75(2): 217-225.
doi: 10.1095/biolreprod.105.047407 pmid: 16641147
[25] ERICKSON G F, WANG C,HSUEH A J W. FSH induction of functional LH receptors in granulosa cells cultured in a chemically defined medium. Nature, 1979, 279(5711): 336-338.
[26] WANG Y, RIPPSTEIN P U, TSANG B K.Role and gonadotrophic regulation of X. Biology of Reproduction, 2003, 68(2): 610-619.
[27] WANG Y, ASSELIN E, TSANG B K, Involvement of transforming growth factor α in the regulation of rat ovarian x-linked inhibitor of apoptosis protein expression and follicular growth by follicle- stimulating hormone1. Biology of Reproduction, 2002, 66(6): 1672-1680.
[28] LIN P, RUI R.Effects of follicular size and FSH on granulosa cell apoptosis and atresia in porcine antral follicles. Molecular Reproduction & Development, 2010, 77(8): 670-678.
doi: 10.1002/mrd.21202 pmid: 20652999
[29] ZHANG C, XIA G, TSANG B K.Interactions of thyroid hormone and FSH in the regulation of rat granulosa cell apoptosis. Frontiers in Bioscience, 2011, 3(4): 1401-1413.
pmid: 21622145
[30] LEE L, ASADA H, KIZUKA F, TAMURA I, MAEKAWA R, TAKETANI T, SATO S, YAMAGATA Y, TAMURA H, SUGINO N.Changes in histone modification and DNA methylation of the StAR and Cyp19a1 promoter regions in granulosa cells undergoing luteinization during ovulation in rats. Endocrinology, 2013, 154(1): 458-470.
doi: 10.1210/en.2012-1610 pmid: 23183184
[31] DEMANNO D A, COTTOM J E, KLINE M P, PETERS C A, MAIZELS E T, HUNZICKERDUNN M.Follicle-stimulating hormone promotes histone H3 phosphorylation on serine-10. Molecular Endocrinology, 1999, 13(1): 91-105.
doi: 10.1210/mend.13.1.0222
[32] RIDDIHOUGH G.Deciphering the histone code. Science, 2016, 352(6286): 668-670.
[1] LIU YuFang,CHEN YuLin,ZHOU ZuYang,CHU MingXing. miR-221-3p Regulates Ovarian Granulosa Cells Apoptosis by Targeting BCL2L11 in Small-Tail Han Sheep [J]. Scientia Agricultura Sinica, 2022, 55(9): 1868-1876.
[2] WU Yan,ZHANG Hao,LIANG ZhenHua,PAN AiLuan,SHEN Jie,PU YueJin,HUANG Tao,PI JinSong,DU JinPing. circ-13267 Regulates Egg Duck Granulosa Cells Apoptosis Through Let-7-19/ERBB4 Pathway [J]. Scientia Agricultura Sinica, 2022, 55(8): 1657-1666.
[3] WANG JiaMin,SHI JiaChen,MA FangFang,CAI Yong,QIAO ZiLin. Effects of Soy Isoflavones on the Proliferation and Apoptosis of Yak Ovarian Granulosa Cells [J]. Scientia Agricultura Sinica, 2022, 55(8): 1667-1675.
[4] TAN XianMing,ZHANG JiaWei,WANG ZhongLin,CHEN JunXu,YANG Feng,YANG WenYu. Prediction of Maize Yield in Relay Strip Intercropping Under Different Water and Nitrogen Conditions Based on PLS [J]. Scientia Agricultura Sinica, 2022, 55(6): 1127-1138.
[5] CHEN XueSen, YIN HuaLin, WANG Nan, ZHANG Min, JIANG ShengHui, XU Juan, MAO ZhiQuan, ZHANG ZongYing, WANG ZhiGang, JIANG ZhaoTao, XU YueHua, LI JianMing. Interpretation of the Case of Bud Sports Selection to Promote the High-Quality and Efficient Development of the World’s Apple and Citrus Industry [J]. Scientia Agricultura Sinica, 2022, 55(4): 755-768.
[6] MingJie XING,XianHong GU,XiaoHong WANG,Yue HAO. Effects of IL-15 Overexpression on Myoblast Differentiation of Porcine Skeletal Muscle Cells [J]. Scientia Agricultura Sinica, 2022, 55(18): 3652-3663.
[7] YANG ChangPei,WANG NaiXiu,WANG Kai,HUANG ZiQing,LIN HaiLan,ZHANG Li,ZHANG Chen,FENG LuQiu,GAN Ling. Effects and Mechanisms of Exogenous GABA Against Oxidative Stress in Piglets [J]. Scientia Agricultura Sinica, 2022, 55(17): 3437-3449.
[8] DENG FuLi,SHEN Dan,ZHONG RuQing,ZHANG ShunFen,LI Tao,SUN ShuDong,CHEN Liang,ZHANG HongFu. Non-Starch Polysaccharide Enzymes Cocktail of Corn-Miscellaneous Meal-Based Diet Optimization by In Vitro Method and Its Effects on Intestinal Microbiome in Finishing Pigs [J]. Scientia Agricultura Sinica, 2022, 55(16): 3242-3255.
[9] LI LiYing,HE YingTing,ZHONG YuYi,ZHOU XiaoFeng,ZHANG Hao,YUAN XiaoLong,LI JiaQi,CHEN ZanMou. CTNNB1 Regulates the Function of Porcine Ovarian Granulosa Cells [J]. Scientia Agricultura Sinica, 2022, 55(15): 3050-3061.
[10] JIN MengJiao,LIU Bo,WANG KangKang,ZHANG GuangZhong,QIAN WanQiang,WAN FangHao. Light Energy Utilization and Response of Chlorophyll Synthesis Under Different Light Intensities in Mikania micrantha [J]. Scientia Agricultura Sinica, 2022, 55(12): 2347-2359.
[11] ZHANG Jing,ZHANG JiYue,YUE YongQi,ZHAO Dan,FAN YiLing,MA Yan,XIONG Yan,XIONG XianRong,ZI XiangDong,LI Jian,YANG LiXue. LKB1 Regulates Steroids Synthesis Related Genes Expression in Bovine Granulosa Cells [J]. Scientia Agricultura Sinica, 2022, 55(10): 2057-2066.
[12] HU RongRong,DING ShiJie,GUO Yun,ZHU HaoZhe,CHEN YiChun,LIU Zheng,DING Xi,TANG ChangBo,ZHOU GuangHong. Effects of Trolox on Proliferation and Differentiation of Pig Muscle Stem Cells [J]. Scientia Agricultura Sinica, 2021, 54(24): 5290-5301.
[13] TANG ZhenShuang,YIN Dong,YIN LiLin,MA YunLong,XIANG Tao,ZHU MengJin,YU Mei,LIU XiaoLei,LI XinYun,QIU XiaoTian,ZHAO ShuHong. To Evaluate the “Two-Step” Genomic Selection Strategy in Pig by Simulation [J]. Scientia Agricultura Sinica, 2021, 54(21): 4677-4684.
[14] ZHANG DanDan,XU TengTeng,GAO Di,QI Xin,NING Wei,RU ZhenYuan,ZHANG XiangDong,GUO TengLong,SHENTU LuYan,YU Tong,MA YangYang,LI YunSheng,ZHANG YunHai,CAO ZuBing. Transcription Factor TEAD4 Regulates Early Embryonic Development in Pigs [J]. Scientia Agricultura Sinica, 2021, 54(20): 4456-4465.
[15] SHI Jiang,WANG JiaTong,PENG QunHua,LÜ Haipeng,BALDERMANN Susanne,LIN Zhi. Changes in Lipid-Soluble Pigments in Fresh Tea Leaves Treated by Methyl Jasmonate and During Postharvest Oolong Tea Manufacturing [J]. Scientia Agricultura Sinica, 2021, 54(18): 3984-3997.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
京ICP备09089781号-30
Copyright 2018 © Editorial office of Scientia Agricultura Sinica
Tel: 86-010-82106279    E-mail: zgnykx@mail.caas.net.cn
Supported by Beijing Magtech Co.Ltd