Scientia Agricultura Sinica ›› 2025, Vol. 58 ›› Issue (22): 4771-4785.doi: 10.3864/j.issn.0578-1752.2025.22.016

• ANIMAL SCIENCE·VETERINARY SCIENCE • Previous Articles     Next Articles

Study on the Antioxidant Function and Mechanism of 18β-glycyrrhetinic Acid Using Porcine Intestinal Organoid Model

LI RuiTong(), CHEN QingMei, XU JianFang, ZHANG JunMin, SI Wei(), ZHANG TieYing()   

  1. State Key Laboratory of Animal Nutrition and Feeding/Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing 100193
  • Received:2025-03-28 Accepted:2025-06-27 Online:2025-11-16 Published:2025-11-21
  • Contact: SI Wei, ZHANG TieYing

Abstract:

【Background】Oxidative stress is a key factor compromising intestinal health and impeding the growth and development of pigs. Consequently, the identification and development of natural and effective antioxidant compounds are of great significance for enhancing animal health and production efficiency. 18β-Glycyrrhetinic acid (GA), a pentacyclic triterpenoid extracted from Glycyrrhiza spp., has been recognized for its antioxidant activity. 【Objective】This study aimed to establish an oxidative stress injury model based on porcine intestinal organoids to assess the antioxidant efficacy of GA and to explore its potential underlying mechanisms. The findings were intended to provide a theoretical foundation for the application of GA as a functional antioxidant additive in livestock and poultry nutrition. 【Method】Intestinal crypts were isolated and collected from the jejunal tissues of piglets and used to construct porcine intestinal organoids via a three-dimensional culture system. The structural and functional integrity of the organoids was confirmed by immunofluorescence staining for intestinal epithelial stem cell and differentiation markers, including LGR5, β-catenin, Ki67, PCNA, c-Myc, CDX2, and lysozyme, indicating the presence of typical intestinal epithelial lineages. After 48 hours of passaging, organoids were treated with hydrogen peroxide (H2O2) at concentrations of 0, 100, 250, 500, 750, 1 000, 1 500, and 2 000 μmol·L-1 for three days to induce oxidative stress, respectively. The optimal H2O2 concentration for model establishment was determined through comprehensive evaluation of morphological parameters (budding rate, branching coefficient, and bud condition), cellular proliferation activity (EdU incorporation and Ki67 expression), intracellular reactive oxygen species (ROS) levels (detected by fluorescent probes), and expression of key genes in the Wnt/β-catenin signaling pathway (Lgr5, C-myc, Cyclin D1, β-catenin, PCNA, and AXIN2). Subsequently, GA at concentrations of 10, 50, and 100 μmol·L-1 was applied to the oxidative stress model to assess its protective effect. The antioxidant capacity and underlying mechanism of GA were investigated by analyzing organoid morphology, proliferation activity, intracellular ROS accumulation, and expression of representative proteins associated with the Wnt/β-catenin signaling pathway (β-catenin, PCNA, LGR5, and CDX2). 【Result】After 48 hours of passaging, treatment of porcine intestinal organoids with 1 mmol·L-1 H2O2 for three days successfully established a stable oxidative stress injury model. This was demonstrated by a significant decrease in the organoid budding rate and branching coefficient, accompanied by a marked reduction in the proportion of EdU-positive cells and Ki67 expression. Moreover, oxidative stress induced activation of the Wnt/β-catenin signaling pathway, as evidenced by significant upregulation of C-myc expression. Under normal culture conditions, GA at concentrations of 10, 50, and 100 μmol·L-1 exerted no adverse effects on organoid growth. However, under oxidative stress conditions, 100 μmol·L-1 GA exhibited the most pronounced protective effect, significantly enhancing the budding rate and branching coefficient, and promoting cell proliferation as indicated by increased EdU-positive cell proportion and elevated Ki67 expression. Additionally, GA treatment effectively reduced ROS accumulation and inhibited the activation of the Wnt/β-catenin pathway, demonstrated by the downregulation of β-catenin, PCNA, and LGR5 protein expression levels. 【Conclusion】In this study, a porcine intestinal organoid model of oxidative stress was successfully established. Based on this model, the protective role of GA against oxidative damage in organoids was confirmed, and its underlying mechanism was preliminarily elucidated. GA exerted notable antioxidant activity by improving organoid morphological development, promoting cellular proliferation, reducing intracellular ROS levels, and downregulating the Wnt/β-catenin signaling pathway. These findings laid a theoretical foundation for the functional development and practical application of GA in the nutritional regulation and health management of livestock and poultry.

Key words: 18β-glycyrrhetinic acid, porcine intestinal organoid, oxidative stress

Table 1

Antibodies used in this study"

抗体 Antibody 货号 Art. No. 公司 Company
anti-β-catenin 8480S Cell Signaling Technology
anti-CDX2 12306S Cell Signaling Technology
anti-Ki67 9449S Cell Signaling Technology
anti-C-MyC 5605S Cell Signaling Technology
anti-PCNA 13110S Cell Signaling Technology
anti-LGR5 PA5-87974 Invitrogen
anti-Lysozyme MA5-32154 Invitrogen
anti-β-actin ab8226 Abcam
Goat Anti-Mouse IgG H&L (Alexa Fluor® 594) ab150116 Abcam
Multi-rAb CoraLite® Plus 594-Goat Anti-Rabbit RGAR004 Proteintech
HRP-Goat Anti-Rabbit IgG (H+L) HX2031 Huaxingbochuang
HRP-Goat Anti-Mouse IgG(H+L) HX2032 Huaxingbochuang

Table 2

Primer sequences for RT-qPCR analysis"

基因 Gene 序列号 Accession number 引物序列 Primer sequence (5' to 3')
β-actin XM_021086047.1 F: CAGGTCATCACCATCGGCAACG
R: GACAGCACCGTGTTGGCGTAGAGGT
Lgr5 NM_001315762.1 F: GCTGGCTGCCGTGGATGC
R: AGCAGGGCGCAGAGGACAAG
C-myc NM_001005154.1 F: CGGACACGGAGGAGAATGAC
R: GCTGCGTTTCAGCTCGTTTC
Cyclin D1 XM_021082686.1 F: GCAGAAGTGCGAGGAGGAGGTCTT
R: CGGATGGAGTTGTCGGTGTAGATGC
β-catenin NM_214367.1 F: AAGCCGAGTACTGAAGGTGC
R: AAAGCTTGCATTCCACCAGC
PCNA NM_001291925.1 F: GCAGAGCATGGACTCGTCTC
R: TTGGACATGCTGGTGAGGTT
AXIN2 XM_021066739.1 F: CTACTCCAAGTGCAAGAGCCA
R: GTGCTTTGGGCACCAAACTG

Fig. 1

The process of organoid formation from a single crypt unit (scale bar: 200 μm)"

Fig. 2

Immunofluorescence staining of various intestinal epithelial cell markers in porcine intestinal organoids A: Intestinal stem cell and Wnt/β-catenin pathway markers, including LGR5 (red), β-catenin (green), and DAPI (blue); B: Proliferation markers, including Ki67 (red), PCNA (red), C-Myc (red), and DAPI (blue); C: Differentiation and maturation markers, including CDX2 (red), Lysozyme (red), and DAPI (blue)"

Fig. 3

Effects of hydrogen peroxide on the growth status of porcine intestinal organoids A: Morphological changes of porcine intestinal organoids (scale bar: 400 μm); B: Budding efficiency of porcine intestinal organoids; C: Budding coefficient of porcine intestinal organoids; D: Bud distribution of porcine intestinal organoids. Data are presented as mean ± SD. Different lowercase letters indicate significant differences at P<0.05. No letter indicates no difference between groups. The same as below"

Fig. 4

Oxidative damage of porcine intestinal organoids induced by hydrogen peroxide A: Immunofluorescence staining of porcine intestinal organoids (EdU and Ki67 in red fluorescence, ROS in green fluorescence, DAPI in blue fluorescence; scale bar: 200 μm); B: Gene expression level of Lgr5; C: Gene expression level of C-myC; D: Gene expression level of Cyclin D1; E: Gene expression level of β-catenin; F: Gene expression level of PCNA; G: Gene expression level of AXIN2"

Fig. 5

Effects of 18β-glycyrrhetinic acid on the growth status of porcine intestinal organoids A: Morphological changes of porcine intestinal organoids; B: Budding efficiency of porcine intestinal organoids; C: Budding coefficient of porcine intestinal organoids; D: Bud condition of porcine intestinal organoids"

Fig. 6

Effect of 18β-glycyrrhetinic acid on the growth state of porcine intestinal organoids under oxidative stress A: Morphological changes of porcine intestinal organoids (scale bar: 400 μm); B: Budding efficiency of porcine intestinal organoids; C: Budding coefficient of porcine intestinal organoids; D: Budding condition of porcine intestinal organoids; E: Bud distribution of porcine intestinal organoids."

Fig. 7

Effects of 18β-glycyrrhetinic acid on alleviating oxidative stress injury in porcine intestinal organoids A: Immunofluorescence staining of porcine intestinal organoids (EdU and Ki67 in red fluorescence, ROS in green fluorescence, DAPI in blue fluorescence; scale bar: 200 μm); B: Western blot analysis of key proteins in the Wnt/β-catenin signaling pathway; C: Expression level of β-catenin protein; D: Expression level of PCNA protein; E: Expression level of LGR5 protein; F: Expression level of CDX2 protein"

[1]
LAURIDSEN C. From oxidative stress to inflammation: Redox balance and immune system. Poultry Science, 2019, 98(10): 4240-4246.

doi: 10.3382/ps/pey407 pmid: 30371893
[2]
JIN S S, WIJERATHNE C U B, AU-YEUNG K K W, LEI H G, YANG C B, O K. Effects of high- and low-fiber diets on intestinal oxidative stress in growing-finishing pigs. Journal of Animal Science, 2022, 100(11): skac306.
[3]
SILVA-GUILLEN Y V, ARELLANO C, BOYD R D, MARTINEZ G, VAN HEUGTEN E. Growth performance, oxidative stress and immune status of newly weaned pigs fed peroxidized lipids with or without supplemental vitamin E or polyphenols. Journal of Animal Science and Biotechnology, 2020, 11(1): 22.

doi: 10.1186/s40104-020-0431-9
[4]
HUANG C Y, FAN Z J, HAN D D, JOHNSTON L J, MA X, WANG F L. Pyrroloquinoline quinone regulates the redox status in vitro and in vivo of weaned pigs via the Nrf2/HO-1 pathway. Journal of Animal Science and Biotechnology, 2021, 12(1): 77.

doi: 10.1186/s40104-021-00595-x pmid: 34140030
[5]
ZHAO Y, HU N M, JIANG Q, ZHU L, ZHANG M, JIANG J, XIONG M Y, YANG M X, YANG J D, SHEN L Y, ZHANG S H, NIU L L, CHEN L, CHEN D W. Protective effects of sodium butyrate on rotavirus inducing endoplasmic reticulum stress-mediated apoptosis via PERK-eIF2α signaling pathway in IPEC-J2 cells. Journal of Animal Science and Biotechnology, 2021, 12(1): 69.

doi: 10.1186/s40104-021-00592-0 pmid: 34112268
[6]
LI Y P, JIANG X R, CAI L, ZHANG Y L, DING H B, YIN J D, LI X L. Effects of daidzein on antioxidant capacity in weaned pigs and IPEC-J2 cells. Animal Nutrition, 2022, 11: 48-59.
[7]
RAHMANI S, BREYNER N M, SU H M, VERDU E F, DIDAR T F. Intestinal organoids: a new paradigm for engineering intestinal epithelium in vitro. Biomaterials, 2019, 194: 195-214.

doi: S0142-9612(18)30828-7 pmid: 30612006
[8]
BARKER N. Adult intestinal stem cells: Critical drivers of epithelial homeostasis and regeneration. Nature Reviews Molecular Cell Biology, 2014, 15(1): 19-33.

doi: 10.1038/nrm3721 pmid: 24326621
[9]
SATO T, VRIES R G, SNIPPERT H J, VAN DE WETERING M, BARKER N, STANGE D E, VAN ES J H, ABO A, KUJALA P, PETERS P J, CLEVERS H. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature, 2009, 459(7244): 262-265.

doi: 10.1038/nature07935
[10]
BOZZETTI V, SENGER S. Organoid technologies for the study of intestinal microbiota-host interactions. Trends in Molecular Medicine, 2022, 28(4): 290-303.

doi: 10.1016/j.molmed.2022.02.001 pmid: 35232671
[11]
XIANG T, WANG J, LI H. Current applications of intestinal organoids: A review. Stem Cell Research & Therapy, 2024, 15(1): 155.
[12]
VERSTEGEN M M A, COPPES R P, BEGHIN A, DE COPPI P, GERLI M F M, DE GRAEFF N, PAN Q W, SAITO Y, SHI S J, ZADPOOR A A, VAN DER LAAN L J W. Clinical applications of human organoids. Nature Medicine, 2025, 31(2): 409-421.

doi: 10.1038/s41591-024-03489-3 pmid: 39901045
[13]
SEO W M, YOON J, LEE J H, LEE Y, LEE H, GEUM D, SUN W, SONG M R. Modeling axonal regeneration by changing cytoskeletal dynamics in stem cell-derived motor nerve organoids. Scientific Reports, 2022, 12: 2082.

doi: 10.1038/s41598-022-05645-6 pmid: 35136073
[14]
OYEFESO F A, MUOTRI A R, WILSON C G, PECAUT M J. Brain organoids: A promising model to assess oxidative stress-induced central nervous system damage. Developmental Neurobiology, 2021, 81(5): 653-670.

doi: 10.1002/dneu.22828 pmid: 33942547
[15]
SEBASTIAN R, SONG Y, PAK C. Probing the molecular and cellular pathological mechanisms of schizophrenia using human induced pluripotent stem cell models. Schizophrenia Research, 2024, 273: 4-23.

doi: 10.1016/j.schres.2022.06.028
[16]
HUANG J J, XU Z Y, JIAO J, LI Z A, LI S C, LIU Y, LI Z, QU G W, WU J, ZHAO Y, et al. Microfluidic intestinal organoid-on-a-chip uncovers therapeutic targets by recapitulating oxygen dynamics of intestinal IR injury. Bioactive Materials, 2023, 30: 1-14.

doi: 10.1016/j.bioactmat.2023.07.001 pmid: 37534235
[17]
CHEN J, MA H H, DENG Z Y, LUO Q M, GONG H, LONG B, LI X N. Cerebral organoid arrays for batch phenotypic analysis in sections and three dimensions. International Journal of Molecular Sciences, 2023, 24(18): 13903.

doi: 10.3390/ijms241813903
[18]
GAO Y N, MENG Q W, QIN J W, ZHAO Q Q, SHI B M. Resveratrol alleviates oxidative stress induced by oxidized soybean oil and improves gut function via changing gut microbiota in weaned piglets. Journal of Animal Science and Biotechnology, 2023, 14(1): 54.

doi: 10.1186/s40104-023-00851-2 pmid: 37029412
[19]
WANG D F, ZHOU L L, ZHOU H L, HU H C, HOU G Y. Chemical composition and protective effect of guava (Psidium guajava L.) leaf extract on piglet intestines. Journal of the Science of Food and Agriculture, 2021, 101(7): 2767-2778.

doi: 10.1002/jsfa.10904 pmid: 33140438
[20]
WANG Z T, MA J, HE Y S, MIU K K, YAO S, TANG C P, YE Y, LIN G. Nrf2-mediated liver protection by 18β-glycyrrhetinic acid against pyrrolizidine alkaloid-induced toxicity through PI3K/Akt/GSK3β pathway. Phytomedicine, 2022, 102: 154162.

doi: 10.1016/j.phymed.2022.154162
[21]
ZHOU J X, WINK M. Evidence for anti-inflammatory activity of isoliquiritigenin, 18β glycyrrhetinic acid, ursolic acid, and the traditional Chinese medicine plants Glycyrrhiza glabra and Eriobotrya japonica, at the molecular level. Medicines, 2019, 6(2): 55.

doi: 10.3390/medicines6020055
[22]
MA C, WANG F X, ZHU J W, WANG S Y, LIU Y Q, XU J F, ZHAO Q Y, QIN Y C, SI W, ZHANG J M. 18Beta-glycyrrhetinic acid attenuates H2O2-induced oxidative damage and apoptosis in intestinal epithelial cells via activating the PI3K/Akt signaling pathway. Antioxidants, 2024, 13(4): 468.

doi: 10.3390/antiox13040468
[23]
WANG J, TAO X Y, ZHU J L, DAI Z, DU Y Y, XIE Y Y, CHU X Y, FU G B, LEI Z J. Tumor organoid-immune co-culture models: Exploring a new perspective of tumor immunity. Cell Death Discovery, 2025, 11: 195.

doi: 10.1038/s41420-025-02407-x
[24]
ZHANG S N, PENG L H, GOSWAMI S, LI Y C, DANG H Y, XING S L, FENG P P, NIGRO G, LIU Y Y, MA Y F, et al. Intestinal crypt microbiota modulates intestinal stem cell turnover and tumorigenesis via indole acetic acid. Nature Microbiology, 2025, 10(3): 765-783.

doi: 10.1038/s41564-025-01937-5
[25]
ZHOU J Y, XIE W W, HU T C, WANG X F, YAN H C, WANG X Q. Mulberry leaf-derived morin activates β-catenin by binding to Frizzled7 to promote intestinal stem cell expansion upon heat-stable enterotoxin b injury. Journal of Agricultural and Food Chemistry, 2024, 72(18): 10366-10375.

doi: 10.1021/acs.jafc.3c09909
[26]
ZHU M, QIN Y C, GAO C Q, YAN H C, WANG X Q. L-Glutamate drives porcine intestinal epithelial renewal by increasing stem cell activity via upregulation of the EGFR-ERK-mTORC1 pathway. Food & Function, 2020, 11(3): 2714-2724.
[27]
CHEN G, BEI B, FENG Y, LI X Z, JIANG Z, SI J Y, QING D G, ZHANG J, LI N. Glycyrrhetinic acid maintains intestinal homeostasis via HuR. Frontiers in Pharmacology, 2019, 10: 535.

doi: 10.3389/fphar.2019.00535 pmid: 31156441
[28]
ZHENG M Q, ZHAI Y J, YU Y B, SHEN J, CHU S Z, FOCACCIA E, TIAN W Y, WANG S, LIU X S, YUAN X, et al. TNF compromises intestinal bile-acid tolerance dictating colitis progression and limited infliximab response. Cell Metabolism, 2024, 36(9): 2086-2103.e9.

doi: 10.1016/j.cmet.2024.06.008 pmid: 38971153
[29]
MCCOY R, OLDROYD S, YANG W, WANG K X, HOVEN D, BULMER D, ZILBAUER M, OWENS R M. In vitro models for investigating intestinal host-pathogen interactions. Advanced Science, 2024, 11(8): 2306727.

doi: 10.1002/advs.v11.8
[30]
BARKER N, VAN DE WETERING M, CLEVERS H. The intestinal stem cell. Genes & Development, 2008, 22(14): 1856-1864.

doi: 10.1101/gad.1674008
[31]
XING P Y, PETTERSSON S, KUNDU P. Microbial metabolites and intestinal stem cells tune intestinal homeostasis. PROTEOMICS, 2020, 20(5/6): 1800419.

doi: 10.1002/pmic.v20.5-6
[32]
KOLEV H M, KAESTNER K H. Mammalian intestinal development and differentiation: The state of the art. Cellular and Molecular Gastroenterology and Hepatology, 2023, 16(5): 809-821.

doi: 10.1016/j.jcmgh.2023.07.011
[33]
LI J Z, LI Q K, GAO N, WANG Z H, LI F, LI J P, SHAN A S. Exopolysaccharides produced by Lactobacillus rhamnosus GG alleviate hydrogen peroxide-induced intestinal oxidative damage and apoptosis through the Keap1/Nrf2 and Bax/Bcl-2 pathways in vitro. Food & Function, 2021, 12(20): 9632-9641.
[34]
WU C-H, CHEN A-Z, YEN G C. Protective effects of glycyrrhizic acid and 18β-glycyrrhetinic acid against cisplatin-induced nephrotoxicity in BALB/c mice. Journal of Agricultural and Food Chemistry, 2015, 63(4): 1200-1209.

doi: 10.1021/jf505471a
[35]
DEGIRMENCI B, HAUSMANN G, VALENTA T, BASLER K. Wnt ligands as a part of the stem cell niche in the intestine and the liver. WNT Signaling in Health and Disease. Amsterdam: Elsevier, 2018: 1-19.
[36]
BIKKAVILLI R K, MALBON C C. Mitogen-activated protein kinases and Wnt/β-catenin signaling: molecular conversations among signaling pathways. Communicative & Integrative Biology, 2009, 2(1): 46-49.
[37]
XIE S, LI Y C, ZHAO S Y, LV Y J, YU Q H. Salmonella infection induced intestinal crypt hyperplasia through Wnt/β-catenin pathway in chicken. Research in Veterinary Science, 2020, 130: 179-183.

doi: S0034-5288(20)30104-1 pmid: 32199176
[38]
LIU L, RAO J N, ZOU T T, XIAO L, SMITH A, ZHUANG R, TURNER D J, WANG J-Y. Activation of Wnt3a signaling stimulates intestinal epithelial repair by promoting c-Myc-regulated gene expression. American Journal of Physiology-Cell Physiology, 2012, 302(1): C277-C285.
[39]
FRICK A, KHARE V, JIMENEZ K, DAMMANN K, LANG M, KRNJIC A, GMAINER C, BAUMGARTNER M, MESTERI I, GASCHE C. A novel PAK1-Notch1 axis regulates crypt homeostasis in intestinal inflammation. Cellular and Molecular Gastroenterology and Hepatology, 2021, 11(3): 892-907.e1.

doi: 10.1016/j.jcmgh.2020.11.001 pmid: 33189893
[40]
ZAN G X, WANG X F, YAN S K, QIN Y C, YAO L Q, GAO C Q, YAN H C, ZHOU J Y, WANG X Q. Matrine reduced intestinal stem cell damage in Eimeria necatrix-infected chicks via blocking hyperactivation of Wnt signaling. Phytomedicine, 2024, 128: 155363.

doi: 10.1016/j.phymed.2024.155363
[41]
YIN X L, FARIN H F, VAN ES J H, CLEVERS H, LANGER R, KARP J M. Niche-independent high-purity cultures of Lgr5+ intestinal stem cells and their progeny. Nature Methods, 2014, 11(1): 106-112.

doi: 10.1038/nmeth.2737 pmid: 24292484
[42]
YANG S W, YU M. Role of goblet cells in intestinal barrier and mucosal immunity. Journal of Inflammation Research, 2021, 14: 3171-3183.

doi: 10.2147/JIR.S318327 pmid: 34285541
[43]
RA Y E, BANG Y-J. Balancing act of the intestinal antimicrobial proteins on gut microbiota and health. Journal of Microbiology, 2024, 62(3): 167-179.

doi: 10.1007/s12275-024-00122-3
[1] GERIQIMUGE, PUBUZHANDUI, XU Qing, HOU LingLing. Effects of Hypoxia on Proliferation of Bovine Renal Cells and Mitochondrial Autophagy [J]. Scientia Agricultura Sinica, 2026, 59(6): 1333-1347.
[2] WANG Wei, LUO ChunHai, JIA HongDou, LIU JiaJin, LI DanYang, FU ShiXin. Effect of Gln on Endoplasmic Reticulum Stress in Retained Fetal Membranes Cows Under Oxidative Stress via the PI3K/AKT Pathway [J]. Scientia Agricultura Sinica, 2025, 58(7): 1451-1462.
[3] LI XiangYu, LIU JianZhuo, HU DanDan, LIU GengYu, CHEN LiangYu, LI Bing, DU WanLi, SONG Bo. Characterization of Maize Germplasm Resistance to Common Smut and Analysis of Physiological Differences [J]. Scientia Agricultura Sinica, 2025, 58(13): 2504-2521.
[4] ZHANG Bing, YANG YanYan, FENG QianHui, SHI Wen, FANG YiZhen, HUANG JiaBao, SHI DeShun. Effects of Sodium Selenite on the in vitro Maturation of Porcine Oocytes and Their Embryonic Development Potentials [J]. Scientia Agricultura Sinica, 2024, 57(17): 3482-3493.
[5] CUI HongJie, LU ChunTing, PAN LiQin, HU Hui, ZHONG PeiYun, ZHU JieYing, ZHANG KaiZhao, HUANG XiaoHong. Curcumin Alleviates Zearalenone-Induced Oxidative Damage in Porcine Renal Epithelial Cells via SIRT1/FOXO1 Pathway [J]. Scientia Agricultura Sinica, 2023, 56(5): 1007-1018.
[6] XI MengXue, SHEN Dan, SHI YiFan, LI ChunMei. Effects of TBHQ on Pyroptosis, Necroptosis and Inflammatory Damage of Chicken Embryonic Lung Tissues Induced by PM2.5 from Chicken Houses [J]. Scientia Agricultura Sinica, 2023, 56(4): 779-787.
[7] TAO WenJing, ZHANG ZiTing, LIU Yuan, SONG Dan, LI XiangChen. Inhibitory Effect of N-acetylcysteine on Bisphenol A-Induced Apoptosis and Inflammatory Response in Porcine Kidney Cells [J]. Scientia Agricultura Sinica, 2023, 56(3): 549-558.
[8] ZHANG Nan, HAN GuangJie, LIU Qin, LI ChuanMing, QI JianHang, LU YuRong, XIA Yang, XU Jian. Response and Function of the Transcription Factor CncC in Cnaphalocrocis medinalis Infected with Baculovirus CnmeGV [J]. Scientia Agricultura Sinica, 2023, 56(13): 2491-2503.
[9] YANG ChangPei,WANG NaiXiu,WANG Kai,HUANG ZiQing,LIN HaiLan,ZHANG Li,ZHANG Chen,FENG LuQiu,GAN Ling. Effects and Mechanisms of Exogenous GABA Against Oxidative Stress in Piglets [J]. Scientia Agricultura Sinica, 2022, 55(17): 3437-3449.
[10] JIANG ChunHui,SUN XuDong,TANG Yan,LUO ShengBin,XU Chuang,CHEN YuanYuan. Curcumin Alleviates H2O2-Induced Oxidative Stress in Bovine Mammary Epithelial Cells Via the Nrf2 Signaling Pathway [J]. Scientia Agricultura Sinica, 2021, 54(8): 1787-1794.
[11] LÜ ChuYang,DENG PingChuan,ZHANG XiaoLi,SUN YuChao,LIANG WuSheng,HU DongWei. Transcriptomic Analysis of Sclerotia Formation Induced by Low Temperature in Villosiclava virens [J]. Scientia Agricultura Sinica, 2020, 53(22): 4571-4583.
[12] LI HanTong,JIA ChengLi,ZHANG ShuWen,LU Jing,PANG XiaoYang,LIU Lu,LÜ JiaPing. Chromium (III) Stress Alleviation by Sulfur Compounds During Chromium Bio-enrichment by Saccharomyces cerevisiae [J]. Scientia Agricultura Sinica, 2019, 52(6): 1078-1089.
[13] DU Jiao, WANG YaBo, LI XueHua, HUANG ZhiQiang, YANG YuHeng, BI ChaoWei, YU Yang. Function analysis ofγ-glutamyl phosphate reductase-encoded gene SsGPR1 in Sclerotinia sclerotiorum [J]. Scientia Agricultura Sinica, 2018, 51(19): 3694-3703.
[14] TANG Qin, DENG Yuan-yuan, ZHANG Rui-fen, ZHANG Yan, ZHANG Ming-wei, WEI Zhen-cheng, TANG Xiao-jun, LIU Lei, TI Hui-hui, MA Yong-xuan. Effect of Momordica charantia Fruit Aqueous Extract on Serum Lipids Metabolic Disorder in Restraint Mice [J]. Scientia Agricultura Sinica, 2014, 47(16): 3300-3307.
[15] ZHAO Jiao, ZHOU Zhao-Hong, LIANG Xiao-Fang, MAO Xiang-Bing, CHEN Dai-Wen, YU Bing. Effects of GSPs and VE on Growth Performance, Serum Redox Status and Hepatic Oxidative Damage in Piglets Under Oxidative Stress [J]. Scientia Agricultura Sinica, 2013, 46(19): 4157-4164.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!