Scientia Agricultura Sinica ›› 2019, Vol. 52 ›› Issue (15): 2706-2715.doi: 10.3864/j.issn.0578-1752.2019.15.014

• ANIMAL SCIENCE·VETERINARY SCIENCE·RESOURCE INSECT • Previous Articles     Next Articles

Lentivirus Mediated Interference Silencing MAT2A and MAT2B Inhibited Differentiation of Porcine Intramuscular Preadipocytes

ZHAO CunZhen,YI BenChi,CHEN PeiRong,LI JianZhu,ZHAO YunHuan,ZHU ZhongKe()   

  1. College of Animal Science and Veterinary Medicine, Xinyang College of Agriculture and Forestry, Xinyang 464000, Henan
  • Received:2018-06-14 Accepted:2019-07-03 Online:2019-08-01 Published:2019-08-06
  • Contact: ZhongKe ZHU E-mail:zhzhongke@163.com

RichHTML

21

PDF

262

Abstract:

【Objective】 Methionine adenosyltransferase (MAT), an essential cellular enzyme responsible for S-adenosylmethionine biosynthesis. The purpose of this study was to construct the lentivirus-mediated pLenti-H1 vector and investigated the effect of adenosine methionine transferase MAT2A and MAT2B on the differentiation of porcine intramuscular adipocytes.【Method】Porcine longissimus dorsi tissue was collected from 3 to 7 days piglets under sterile conditions and isolated the porcine intramuscular preadipocytes by differential adhesion method. According to MAT2A gene (Accession No.NM_001167650.1) and MAT2B gene sequence (Accession No.NM_001142832.1), Invitrogen online software BLOCK-iTTM RNAi Designer was used to respectively design MAT2A and MAT2B shRNA target sequence. The synthesized single-chain oligonucleotide was annealed to form double strands DNA, and was ligated with pLenti-Hl vector after BamH I and Xho I (TaKaRa) double digestion, then the plasmid DNA was extracted and further identified by restriction enzyme digestion and sequencing. X-tremeGENE-HP DNA transfection reagent was used to co-transfect 293T cells with the correct recombinant plasmid and packaging plasmid (CMV-Δ8.9 and CMV-VSVG). The expression of green fluorescent protein (GFP) was observed after 48 h and then the virus titer was tested. The primary porcine intramuscular preadipocytes were infected with viruses at 70% to 80% cell density and induced adipogenic differentiation when cells at full confluence. Total RNA was extracted from adipocytes and the mRNA reverse transcription was performed by using a Revert Aid First-strand cDNA Synthesis Kit. The gene primer sequences of MAT2A, MAT2B, PPARγ, aP2, CEBP/α and β-actin were designed by Primer primer 5.The interference efficiency of MAT2A and MAT2B gene on the porcine intramuscular preadipocytes was detected by Real-time quantitative PCR and Western blot. The effects of MAT2A and MAT2B on porcine intramuscular adipogenesis were detected by Oil O stating and RT-qPCR. 【Result】Recombinant lentivirus vector pLenti-Hl-MAT2A/MAT2B was successfully constructed. The virus titer of lentivirus sh-MAT2A and sh-MAT2B were respectively 6.7×10 7 pfu/mL and 7×10 7pfu/mL. After preadipocytes infected with adenovirus for 72 h, Microscopic fluorescence imaging showed 90% of green fluorescent protein (GFP) appeared, indicated that porcine intramuscular preadipocytes were successfully infected by lentivirus sh-MAT2A and sh-MAT2B. Real-time qPCR results showed that the expression of MAT2A and MAT2B was separately decreased 70% and 60% compared with sh-scramble. The Western blot experiment and protein analysis showed that interference with MAT2A, the expression of MAT2A had an approximately 40% decrease and the difference reached high significant level (P<0.01). The expression of MAT2B had a 25% drop when inhibited with MAT2B and the different tendency towards statistical significance (P<0.05). Oil O staining and quantitative analysis showed that, the lipid accumulation of porcine intramuscular adipocytes markedly reduced upon silencing of MAT2A and MAT2B. Real-time qPCR results showed that knockdown of MAT2A and MAT2B inhibited the mRNA levels of PPARγ,aP2 and CEBP/α.【Conclusion】 Lentivirus-mediate sh-MAT2A and sh-MAT2B interference system was successfully esablished. The recombinant lentivirus can effectively reduce the mRNA and protein expression of MAT2A and MAT2B in porcine intramuscular adipocytes. Further experiments showed that interfering with MAT2A and MAT2B genes, the lipid accumulation and adipogenic key genes expression in porcine intramuscular adipocytes were significantly inhibited.

Key words: adenosine methionine transferase MAT2A, MAT2B, lentivirus, intramuscular preadipocyte, pig

Table 1

Design of shRNA targeting on porcine MAT2A and MAT2B gene"

RNAi 序列 Primer sequence (5′ to 3′)
sh-MAT2A-1

sh-MAT2A-2

sh-MAT2A-3

sh-MAT2B-1

sh-MAT2B-2

sh-MAT2B-3

sh-scramble		 5′-GATCCGCAGCAGTCACCAGATATTGCctcgagGCAATATCTGGTGACTGCTGCTTTTTC-3′
5′-TCGAGAAAAAGCAGCAGTCACCAGATATTGCctcgagGCAATATCTGGTGACTGCTGCG-3′
5′-GATCCGCACACAAGCTCAATGCCAAActcgagTTTGGCATTGAGCTTGTGTGCTTTTTC-3′
5′-TCGAGAAAAAGCACACAAGCTCAATGCCAAActcgagTTTGGCATTGAGCTTGTGTGCG-3′
5′-TCGAGAAAAAGCCAAGTGGCAGATTTGTTATctcgagATAACAAATCTGCCACTTGGCG-3′
5′-GATCCGGAGAGTGCCGTGACTGTTATctcgagATAACAGTCACGGCACTCTCCTTTTTC-3′
5′-GATCCGCACAGCGACGAGTACAAGActcgagTCTTGTACTCGTCGCTGTGCTTTTTC-3′
5′-TCGAGAAAAAGCACAGCGACGAGTACAAGActcgagTCTTGTACTCGTCGCTGTGCG-3′
5′-GATCCGGAGAGTGCCGTGACTGTTATctcgagATAACAGTCACGGCACTCTCCTTTTTC-3′
5′-TCGAGAAAAAGGAGAGTGCCGTGACTGTTATctcgagATAACAGTCACGGCACTCTCCG -3′
5′-GATCCGCGAACACCATTTCGAATTGGctcgagCCAATTCGAAATGGTGTTCGCTTTTTC-3′
5′-TCGAGAAAAAGCGAACACCATTTCGAATTGGctcgagCCAATTCGAAATGGTGTTCGCG-3′
5′-GATCCGACACCTACGCAAAACCCTctcgagGACACCTACGCAAAACCCTTTTTTC-3′
5′-TCGAGAAAAAGACACCTACGCAAAACCCTctcgagGACACCTACGCAAAACCCTG-3′

Table 2

Specific primers for real-time quantitative PCR"

Gene 序列号Accession No. 序列Primer sequence (5′ to 3′)
MAT2A NM_001167650.1 S: GTGGTTCGTGAAACCATTAAG
A: ATCAGTGGCATAACCAAACAT
MAT2B NM_001142832.1 S: TAGGAGCTGCTGTTTTGAGA
A: CACACGCCATTTCATACTTG
PPARγ NM_214379.1 S:AGGACTACCAAAGTGCCATCAAA
A:GAGGCTTTATCCCCACAGACAC
aP2 HM_453202 S:GAGCACCATAACCTTAGATGGA
A:AAATTCTGGTAGCCGTGACA
CEBP/α AF_103944.1 S: GCACTTGCAGTTCCAGATCG
A:ACCCGGTACTCGTTGCTGTT
β-actin NM_007393 S: GGACTTCGAGCAGGAGATGG
A: AGGAAGGAGGGCTGGAAGAG

Fig. 1

Construction and identification of recombinant plasmid LentiH1-shRNA (A): Produce shRNA interference fragments sense and antisense oligo nucleotides were annealed to form complementary double strands DNA. M: DNA marker (DL 5000); 1-3: sh-MAT2A RNA; 4-6: sh-MAT2B RNA. (B): LentiH1 shuttle plasmid was double digested by Xho I and BamH I. 1-2: the product of LentiH1 shuttle plasmid was double digested; all released two fragments (7612 bp and 59 bp). M: DNA marker (DL 5000). (C): recombinant plasmids were identified by digesting. M: DNA marker (DL 5000). 1, 3, 5, 7, 9, 11: digested plasmid (as a control); 2, 4, 6, 8, 10, 12: undigested plasmid (2-6: sh-MAT2A; 8-12: sh-MAT2B)"

Fig. 2

The packaging of pLentiH1-MAT2A/2B shRNA vector A-C: The GFP expression of sh-scramble and sh-MAT2A and sh-MAT2B that separately infected for 48 h"

Fig. 3

The efficiency of cultured preadipocytes that were infected with recombinant lentivirus A-C Porcine preadipocytes were separately infected by sh-scaramble (as a control), sh-MAT2A and sh-MAT2B for 72 h. D-E: Real-time qPCR to analyze the relative expression of MAT2A and MAT2B (Data are presented as means ± SEM, n=3. *P<0.05, **P<0.01)"

Fig. 4

The detection of MAT2A and MAT2B interference efficiency A-B: The Interference efficiency of MAT2A and MAT2B was detected using Western blot. C-D: Quantification to analysis the protein level of MAT2A and MAT2B (Data are presented as means ± SEM, n=3. *P<0.05, **P<0.01)"

Fig. 5

Silencing MAT2A and MAT2B inhibited differentiation of porcine intramuscular adipocytes A-B: Cells were stained with Oil red O and quantification to assess lipid accumulation. C: The relative mRNA expression of MAT2A and MAT2B detected by RT-qPCR. (Data are presented as means ± SEM; n=3; *P<0.05, **P<0.01)"

[1] BERNS K, HIJMANS E M, MULLENDERS J, BRUMMELKAMP T R, VELDS A, HEIMERIKX M, KERKHOVEN R M, MADIREDJO M, NIJKAMP W, WEIGELT B, AGAMI R, GE W, CAVET G, LINSLEY P S, BEIJERSBERGEN R L, BERNARDS R . A large-scale RNAi screen in human cells identifies new components of the p53 pathway. Nature, Nature, 2004,428(6981):431-437.
[2] LO-BIANCO C, SCHNEIDER B L, BAUER M, SAJADI A, BRICE A, IWATSUBO T, AEBISCHER P . Lentiviral vector delivery of parkin prevents dopaminergic degeneration in an alpha-synuclein rat model of Parkinson's disease. Proceedings of the National Academy of Sciences of the United States of America, 2004,101(50):17510-17515.
[3] AMARZGUIOUI M, ROSSI J, KIM D . Approaches for chemically synthesized siRNA and vector-mediated RNAi. FEBS Lett, 2005,579(26):5974-5981.
[4] PADDISON P J, CAUDY A A, BERNSTEIN E, HANNON G J, CONKLIN D S . Short hairpin RNAs (shRNAs) induce sequence- specific silencing in mammalian cells. Genes Development, 2002, 16(8):948-958.
[5] GARCIA-TREVIJANO E R, LATASA M U, CARRETERO M V, BERASAIN C, MATO J M, AVILA M A . S-adenosylmethionine regulates MAT1A and MAT2A gene expression in cultured rathepatocytes: a new role for S-adenosylmethionine in the maintenance of the differentiated status of the liver. FASEB Journal, 2000,14(15):2511-2518.
[6] DE LA ROSA J, OSTROWSKI J, HRYNIEWICZ M . Chromosomal localization and catalytic properties of the recombinant alpha subunit of human lymphocyte methionine adenosyltransferase. Journal of Biological Chemistry, 1995,270(37):21860-21868.
[7] MATO J M, LU S C . Role of S-adenosyl-L-methionine in liver health and injury. Hepatology, 2007, 45(5):1306-1312.
[8] YANG H, HUANG Z Z, WANG J, LU S C . The role of c-Myb and Sp1 in the up-regulation of methionine adenosyltransferase 2A gene expression in human hepatocellular carcinoma. FASEB Journal, 2001,15(9):1507-1516.
[9] YANG H, SADDA M R, YU V, ZENG Y, LEE T D, OU X, CHEN L, LU S C . Induction of human methionine adenosyltransferase 2A expression by tumor necrosis factor alpha. Role of NF-kappa B and AP-1. Journal of Biological Chemistry, 2003,278(51):50887-50896.
[10] KATOH Y, IKURA T, HOSHIKAWA Y, TASHIRO S, ITO T, OHTA M, KERA Y, NODA T, IGARASHI K . Methionine adenosyltransferase II serves as a transcriptional corepressor of Maf oncoprotein. Molecular Cell, 2011,41(5):554-566.
[11] TOMASI M L, RYOO M, RAMANI K, TOMASI I, GIORDANO P, MATO J M, LU S C . Methionine adenosyltransferase α2 sumoylation positively regulate Bcl-2 expression in human colon and liver cancer cells. Oncotarget, 2015,6(35):37706-37723.
[12] RAMANI K, TOMASI M L . Transcriptional regulation of methionine adenosyltransferase 2A by peroxisome proliferator-activated receptors in rat hepatic stellate cells. Hepatology, 2012, 55(6):1942-1953.
[13] KERA Y, KATOH Y, OHTA M, MATSUMOTO M, TAKANO- YAMAMOTO T, IGARASHI K . Methionine adenosyltransferase II-dependent histone H3K9 methylation at the COX-2 gene locus. Journal of Biological Chemistry, 2013,288(19):13592-13601.
[14] LIU L, YIN J, LI W, LIU K, PENG Y, TAN P, MA R Z . Construction of a bacterial artificial chromosome library for the Rongchang pig breed and its use for the identification of genes involved in intramuscular fat deposition. Biochemical and Biophysical Research Communications, 2010,391(2):1280-1284.
[15] FANG Q, YIN J, LI F, ZHANG J, WATFORD M . Characterization of methionine adenosyltransferase 2β gene expression in skeletal muscle and subcutaneous adipose tissue from obese and lean pigs. Molecular Biology Reports, 2010,37(5):2517-2524.
[16] KRUEGER U, BERGAUER T, KAUFMANN B, WOLTER I, PILK S, HEIDER-FABIAN M, KIRCH S, ARTZ-OPPITZ C, ISSELHORST M, KONRAD J . Insights into effective RNAi gained from large-scale siRNA validation screening. Oligonucleotides, 2007, 17(2):237-250.
[17] PFEIFER A, HOFMANN A . Lentiviral transgenesis. Methods Molecular Biology, 2009,530(3):391-405.
[18] POESCHLA E, CORBEAU P, WONGSTAAL F . Development of HIV vectors for antiHIV gene therapy. Proceedings of the National Academy of Sciences of the United States of America, 1996,93(21):11395-11399.
[19] CHENG J, SONG Z Y, PU L, YANG H, ZHENG J M, ZHANG Z Y, SHI X E, YANG G S . Retinol binding protein 4 affects the adipogenesis of porcine preadipocytes through insulin signaling pathways. Biochemistry and Cell Biology, 2013, 91(4):236-243.
[20] YANG H, CHENG J, SONG Z, LI X, ZHANG Z, MAI Y, PANG W, SHI X, YANG G . The anti-adipogenic effect of PGRN on porcine preadipocytes involves ERK1, 2 mediated PPARγ phosphorylation. Molecular Biology Reports, 2013,40(12):6863-6872.
[21] FORTIN A, ROBERTSON W M, TONG K W . The eating quality of Canadian pork and its relationship with intramuscular fat. Meat Sciences, 2005, 69(2):297-305.
[22] 赵存真, 李黄琨, 马云, 杨公社 . 腺病毒介导的MAT2B过表达促进猪肌内脂肪细胞分化. 畜牧兽医学报, 2017,48(5):802-809.
ZHAO C Z, LI H K, MA Y, YANG G S . MAT2B overexpression mediated by adenovirus promoting porcine intramuscular preadipocyte differentiation. Acta Veterinaria et Zootechnica Sinica, 2017, 48(5):802-809. (in Chinese)
[23] ZHAO C Z, CHEN X C, WU W J, WANG W S, PANG W J, YANG G S . MAT2B promotes adipogenesis by modulating SAMe levels and activating AKT/ERK pathway during porcine intramuscular preadipocyte differentiation. Experimental Cell Research, 2016,344(1):11-21.
[24] DE LA ROSA J, OSTROWSKI J, HRYNIEWICZ M M, KREDICH N M, KOTB M, LEGROS H L J R, VALENTINE M, GELLER A M . Chromosomal localization and catalytic properties of the recombinant alpha subunit of human lymphocyte methionine adenosyltransferase. Journal of Biological Chemistry, 1995,270(37):21860-21868.
[25] YANG H, SADDA M R, YU V, ZENG Y, LEE T D, OU X, CHEN L, LU S C . Induction of human methionine adenosyltransferase 2A expression by tumor necrosis factor alpha. Role of NF-kappa B and AP-1. Journal of Biological Chemistry, 2003,278(51):50887-50896.
[26] TOMASI M L, RYOO M, RAMANI K, TOMASI I, GIORDANO P, MATO J M, LU S C . Methionine adenosyltransferase α2 sumoylation positively regulate Bcl-2 expression in human colon and liver cancer cells. Oncotarget, 2015,6(35):37706-37723.
[27] RAMANI K, LU S C . Methionine adenosyltransferases in liver health and diseases. Liver Research, 2017,1(2):103-111.
[28] BOTTIGLIERI T . S-Adenosyl-L-methionine (SAMe): from the bench to the bedside--molecular basis of a pleiotrophic molecule. American Journal of Clinical Nutrition, 2002,76(5):1151S-7S.
[29] MATO J M, LU S C . Role of S-adenosyl-L-methionine in liver health and injury. Hepatology, 2007,45(5):1306-1312.
[30] MARTA V R, MARTA I L, JUAN J L, ANA M A, MARC T, AGUSTÍN F F, JOSÉ L L, DAVID M A, MARÍA B, MARC T, ZIGMUND L, CONRAD W, SHELLY C L, MANEL E, RHONA M, KRISTJÁN R J, MARIO F F, JOSÉ M M, ASHWIN W . S-adenosylmethionine levels regulate the schwann cell DNA methylome. Neuron, 2014,81(5):1024-1039.
[1] TAN XianMing,ZHANG JiaWei,WANG ZhongLin,CHEN JunXu,YANG Feng,YANG WenYu. Prediction of Maize Yield in Relay Strip Intercropping Under Different Water and Nitrogen Conditions Based on PLS [J]. Scientia Agricultura Sinica, 2022, 55(6): 1127-1138.
[2] CHEN XueSen, YIN HuaLin, WANG Nan, ZHANG Min, JIANG ShengHui, XU Juan, MAO ZhiQuan, ZHANG ZongYing, WANG ZhiGang, JIANG ZhaoTao, XU YueHua, LI JianMing. Interpretation of the Case of Bud Sports Selection to Promote the High-Quality and Efficient Development of the World’s Apple and Citrus Industry [J]. Scientia Agricultura Sinica, 2022, 55(4): 755-768.
[3] MingJie XING,XianHong GU,XiaoHong WANG,Yue HAO. Effects of IL-15 Overexpression on Myoblast Differentiation of Porcine Skeletal Muscle Cells [J]. Scientia Agricultura Sinica, 2022, 55(18): 3652-3663.
[4] YANG ChangPei,WANG NaiXiu,WANG Kai,HUANG ZiQing,LIN HaiLan,ZHANG Li,ZHANG Chen,FENG LuQiu,GAN Ling. Effects and Mechanisms of Exogenous GABA Against Oxidative Stress in Piglets [J]. Scientia Agricultura Sinica, 2022, 55(17): 3437-3449.
[5] DENG FuLi,SHEN Dan,ZHONG RuQing,ZHANG ShunFen,LI Tao,SUN ShuDong,CHEN Liang,ZHANG HongFu. Non-Starch Polysaccharide Enzymes Cocktail of Corn-Miscellaneous Meal-Based Diet Optimization by In Vitro Method and Its Effects on Intestinal Microbiome in Finishing Pigs [J]. Scientia Agricultura Sinica, 2022, 55(16): 3242-3255.
[6] RAN HongBiao,ZHAO LiLing,WANG Hui,CHAI ZhiXin,WANG JiKun,WANG JiaBo,WU ZhiJuan,ZHONG JinCheng. Effects of lncFAM200B on the Lipid Deposition in Intramuscular Preadipocytes of Yak [J]. Scientia Agricultura Sinica, 2022, 55(13): 2654-2666.
[7] JIN MengJiao,LIU Bo,WANG KangKang,ZHANG GuangZhong,QIAN WanQiang,WAN FangHao. Light Energy Utilization and Response of Chlorophyll Synthesis Under Different Light Intensities in Mikania micrantha [J]. Scientia Agricultura Sinica, 2022, 55(12): 2347-2359.
[8] HU RongRong,DING ShiJie,GUO Yun,ZHU HaoZhe,CHEN YiChun,LIU Zheng,DING Xi,TANG ChangBo,ZHOU GuangHong. Effects of Trolox on Proliferation and Differentiation of Pig Muscle Stem Cells [J]. Scientia Agricultura Sinica, 2021, 54(24): 5290-5301.
[9] TANG ZhenShuang,YIN Dong,YIN LiLin,MA YunLong,XIANG Tao,ZHU MengJin,YU Mei,LIU XiaoLei,LI XinYun,QIU XiaoTian,ZHAO ShuHong. To Evaluate the “Two-Step” Genomic Selection Strategy in Pig by Simulation [J]. Scientia Agricultura Sinica, 2021, 54(21): 4677-4684.
[10] ZHANG DanDan,XU TengTeng,GAO Di,QI Xin,NING Wei,RU ZhenYuan,ZHANG XiangDong,GUO TengLong,SHENTU LuYan,YU Tong,MA YangYang,LI YunSheng,ZHANG YunHai,CAO ZuBing. Transcription Factor TEAD4 Regulates Early Embryonic Development in Pigs [J]. Scientia Agricultura Sinica, 2021, 54(20): 4456-4465.
[11] SHI Jiang,WANG JiaTong,PENG QunHua,LÜ Haipeng,BALDERMANN Susanne,LIN Zhi. Changes in Lipid-Soluble Pigments in Fresh Tea Leaves Treated by Methyl Jasmonate and During Postharvest Oolong Tea Manufacturing [J]. Scientia Agricultura Sinica, 2021, 54(18): 3984-3997.
[12] DU Xing,ZENG Qiang,LIU Lu,LI QiQi,YANG Liu,PAN ZengXiang,LI QiFa. Identification of the Core Promoter of Linc-NORFA and Its Transcriptional Regulation in Erhualian Pig [J]. Scientia Agricultura Sinica, 2021, 54(15): 3331-3342.
[13] YU ZhengWang,ZHOU ZhongXin. Functions of Antibacterial and Inducing Defense Peptide Expression of Medium-Chain Fatty Acid and Its Application in Piglet Feeds [J]. Scientia Agricultura Sinica, 2021, 54(13): 2895-2905.
[14] QIN BenYuan,YANG Yang,ZHANG YanWei,LIU Min,ZHANG WanFeng,WANG HaiZhen,WU YiQi,ZHANG XueLian,CAI ChunBo,GAO PengFei,GUO XiaoHong,LI BuGao,CAO GuoQing. Isolation, Culture, Identification and Biological Characteristics of Pig Skeletal Muscle Satellite Cells [J]. Scientia Agricultura Sinica, 2020, 53(8): 1664-1676.
[15] YaoQun WU,ShaoKang CHEN,XiHui SHENG,XiaoLong QI,XiangGuo WANG,HeMin NI,Yong GUO,ChuDuan WANG,Kai XING. Differential Expression of mRNA and lncRNA in Longissimus Dorsi Muscle of Songliao Black Pig and Landrace Pig Based on High-Throughput Sequencing Technique [J]. Scientia Agricultura Sinica, 2020, 53(4): 836-847.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
京ICP备09089781号-30
Copyright 2018 © Editorial office of Scientia Agricultura Sinica
Tel: 86-010-82106279    E-mail: zgnykx@mail.caas.net.cn
Supported by Beijing Magtech Co.Ltd