Scientia Agricultura Sinica ›› 2024, Vol. 57 ›› Issue (4): 711-720.doi: 10.3864/j.issn.0578-1752.2024.04.007

• PLANT PROTECTION • Previous Articles     Next Articles

Effects of Apolipophorin on Ovarian Development and Lipid Deposition in Locusta migratoria

ZHAO YiYan1,2(), GUO HongFang1,2, LIU WeiMin1, ZHAO XiaoMing1, ZHANG JianZhen1()   

  1. 1 Institute of Applied Biology/Shanxi Key Laboratory of Nucleic Acid Biopesticides, Shanxi University, Taiyuan 030006
    2 College of Life Science, Shanxi University, Taiyuan 030006
  • Received:2023-10-20 Accepted:2023-11-28 Online:2024-02-16 Published:2024-02-20
  • Contact: ZHANG JianZhen

Abstract:

【Background】Lipids are one of the important nutrients required by organisms, which play important physiological functions, including diapause, flight, embryonic development and energy regulation in insects. Apolipophorins (apoLps) are the main components of insect lipophorin particles, which are involved in the transport of lipids among different tissues.【Objective】The objective of this study is to investigate the function of apolipophorins (LmapoLp-II/I and LmapoLp-III) by RNA interference (RNAi) in ovarian lipid transport in Locusta migratoria, and to provide a new molecular target for pest control.【Method】RNAi was performed to silence two apolipophorin genes (LmapoLp-II/I and LmapoLp-III) at 1 day post adult eclosion (1 PAE), respectively. dsGFP was used as control, 15 μg dsRNA was injected into each insect. The ovaries at 4, 6 and 8 PAE were dissected and observed after dsRNA injection. The silencing efficiency of LmapoLps in the ovaries at 8 PAE was analyzed by reverse-transcription quantitative PCR (RT-qPCR), and EF1α was used as internal reference gene. Lipidomics technique was used to determine and analyze the differences of lipid metabolites in the ovaries between dsGFP- and dsLmapoLp-II/I-treated groups. The approach combining the fold change, the P value and the VIP value of the OPLS-DA model was adopted to screen for differential abundance of lipids. The contents of neutral lipids and total triglycerides were determined by Bodipy staining and triglyceride assay kit.【Result】After injection of dsLmapoLp-II/I and dsLmapoLp-III, the expression level of target genes could be significantly silenced by 80.84% and 92.89%, respectively. RNAi-mediated silencing of LmapoLp-II/I led to a retarded ovarian development, with significantly decreased neutral lipid content and triglyceride content, while the ovaries of L. migratoria injected with dsLmapoLp-III were the same as those in the control group, which could develop normally and gradually grow larger, with the color gradually changing from white to yellow. After LmapoLp-II/I silencing, a total of 1 166 up-regulated metabolites and 1 384 down-regulated metabolites were detected by lipidomics analysis, of which 20 triglycerides were significantly down-regulated.【Conclusion】LmapoLp-II/I is a major apolipophorin gene that affects ovarian development and is involved in the accumulation and transport of ovarian lipids. These research results not only enrich the research content of lipid metabolism in insects, but also help to find new targets for pest control.

Key words: Locusta migratoria, apolipophorin, RNA interference (RNAi), ovary, lipid transport

Table 1

The primers used in this study"

用途
Application
引物名称
Primer name
引物序列
Primer sequence (5′-3′)
产物长度
Product size (bp)
dsRNA合成
dsRNA synthesis
dsLmapoLp-II/I-F taatacgactcactatagggCTCCAAGCAGAAGGTCGTG 460
dsLmapoLp-II/I-R taatacgactcactatagggCAGGCTGAGATGAGAATGT
dsLmapoLp-III-F taatacgactcactatagggGCTGAATCACACCATCGTCA 420
dsLmapoLp-III-R taatacgactcactatagggTGGATGGAGTTCTGCAGGTT
dsGFP-F taatacgactcactatagggGTGGAGAGGGTGAAGG 571
dsGFP-R taatacgactcactatagggGGGCAGATTGTGTGGAC
RT-qPCR分析
RT-qPCR analysis
LmapoLp-II/I-F AGCGATTTCATCCGGTGGC 103
LmapoLp-II/I-R GGTGTATGTCTGTCCCTTTT
LmapoLp-III-F ACGCTGCTCGCAGTCCTC 83
LmapoLp-III-R ACCGCCTCCGCGATGTT
EF1α-F AGCCCAGGAGATGGGTAAAG 155
EF1α-R CTCTGTGGCCTGGAGCATC

Fig. 1

Effects of LmapoLps RNAi on ovary development in L. migratoria"

Fig. 2

Statistics on the number of annotated differential lipids in ovary (A) and cluster analysis of the down-regulated lipid species (B) after RNAi of LmapoLp-II/I"

Fig. 3

The content analysis of down-regulated triglyceride in the ovary after RNAi of LmapoLp-II/I The data are shown as means±SD. * indicates significant difference between dsGFP- and dsLmapoLp-II/I-injection groups (P<0.05, Student’s t-test, n=6, three locusts per group)"

Fig. 4

The effect of LmapoLp-II/I suppression on the content of neutral lipids in the ovary"

[1]
石旺鹏, 谭树乾. 蝗虫生物防治发展现状及趋势. 中国生物防治学报, 2019, 35(3): 307-324.

doi: 10.16409/j.cnki.2095-039x.2019.03.020
SHI W P, TAN S Q. Current status and trend on grasshopper and locust biological control. Chinese Journal of Biological Control, 2019, 35(3): 307-324. (in Chinese)

doi: 10.16409/j.cnki.2095-039x.2019.03.020
[2]
张建珍, 柴林, 史学凯, 高璐, 范云鹤. RNA干扰技术与害虫防治. 山西大学学报(自然科学版), 2021, 44(5): 980-987.
ZHANG J Z, CHAI L, SHI X K, GAO L, FAN Y H. RNA interference technology and pest control. Journal of Shanxi University (Natural Science Edition), 2021, 44(5): 980-987. (in Chinese)
[3]
魏琪, 苏建亚. 昆虫糖脂代谢研究进展. 昆虫学报, 2016, 59(8): 906-916.

doi: 10.16380/j.kcxb.2016.08.013
WEI Q, SU J Y. Research advances in carbohydrate and lipid metabolism in insects. Acta Entomologica Sinica, 2016, 59(8): 906-916. (in Chinese)

doi: 10.16380/j.kcxb.2016.08.013
[4]
PARVY J P, NAPAL L, RUBIN T, POIDEVIN M, PERRIN L, WICKER-THOMAS C, MONTAGNE J. Drosophila melanogaster acetyl-CoA-carboxylase sustains a fatty acid-dependent remote signal to waterproof the respiratory system. PLoS Genetics, 2012, 8(8): e1002925.

doi: 10.1371/journal.pgen.1002925
[5]
YU Z T, ZHANG X Y, WANG Y W, MOUSSIAN B, ZHU K Y, LI S, MA E B, ZHANG J Z. LmCYP4G102: An oenocyte-specific cytochrome P450 gene required for cuticular waterproofing in the migratory locust, Locusta migratoria. Scientific Reports, 2016, 6: 29980.
[6]
WU L X, ZHANG Z F, YU Z T, YU R R, MA E B, FAN Y L, LIU T X, FEYEREISEN R, ZHU K Y, ZHANG J Z. Both LmCYP4G genes function in decreasing cuticular penetration of insecticides in Locusta migratoria. Pest Management Science, 2020, 76(11): 3541-3550.

doi: 10.1002/ps.v76.11
[7]
ZHAO X M, YANG Y, NIU N, ZHAO Y Y, LIU W M, MA E B, MOUSSIAN B, ZHANG J Z. The fatty acid elongase gene LmELO7 is required for hydrocarbon biosynthesis and cuticle permeability in the migratory locust, Locusta migratoria. Journal of Insect Physiology, 2020, 123: 104052.
[8]
YANG Y, ZHAO X M, NIU N, ZHAO Y Y, LIU W M, MOUSSIAN B, ZHANG J Z. Two fatty acid synthase genes from the integument contribute to cuticular hydrocarbon biosynthesis and cuticle permeability in Locusta migratoria. Insect Molecular Biology, 2020, 29(6): 555-568.

doi: 10.1111/imb.v29.6
[9]
LI D T, DAI Y T, CHEN X, WANG X Q, LI Z D, MOUSSIAN B, ZHANG C X. Ten fatty acyl-CoA reductase family genes were essential for the survival of the destructive rice pest, Nilaparvata lugens. Pest Management Science, 2020, 76(7): 2304-2315.
[10]
BALABANIDOU V, KAMPOURAKI A, MACLEAN M, BLOMQUIST G J, TITTIGER C, JUAREZ M P, MIJAILOVSKY S J, CHALEPAKIS G, ANTHOUSI A, LYND A, ANTOINE S, HEMINGWAY J, RANSON H, LYCETT G J, VONTAS J. Cytochrome P 450 associated with insecticide resistance catalyzes cuticular hydrocarbon production in Anopheles gambiae. Proceedings of the National Academy of Sciences of the United States of America, 2016, 113(33): 9268-9273.
[11]
LIU J Q, LI W X, ZHENG J J, TIAN Q N, HUANG J F, DAI S X. Gain and loss events in the evolution of the apolipoprotein family in vertebrata. BMC Evolutionary Biology, 2019, 19(1): 209.

doi: 10.1186/s12862-019-1519-8
[12]
MAHLEY R W, INNERARITY T L, RALL S C, WEISGRABER K H. Plasma lipoproteins apolipoprotein structure and function. Journal of Lipid Research, 1984, 25(12): 1277-1294.

doi: 10.1016/S0022-2275(20)34443-6
[13]
SU X, PENG D Q. The exchangeable apolipoproteins in lipid metabolism and obesity. Clinica Chimica Acta, 2020, 503: 128-135.

doi: S0009-8981(20)30025-5 pmid: 31981585
[14]
RYAN R O, VAN DER HORST D J. Lipid transport biochemistry and its role in energy production. Annual Review of Entomology, 2000, 45: 233-260.

pmid: 10761577
[15]
WEERS P M, VAN MARREWIJK W J, BEENAKKERS A M, VAN DER HORST D J. Biosynthesis of locust lipophorin. Apolipophorins I and II originate from a common precursor. The Journal of Biological Chemistry, 1993, 268(6): 4300-4303.

doi: 10.1016/S0021-9258(18)53609-7
[16]
SMOLENAARS M M, KASPERAITIS M A, RICHARDSON P E, RODENBURG K W, VAN DER HORST D J. Biosynthesis and secretion of insect lipoprotein: Involvement of furin in cleavage of the apoB homolog, apolipophorin-II/I. Journal of Lipid Research, 2005, 46(3): 412-421.

doi: 10.1194/jlr.M400374-JLR200 pmid: 15604521
[17]
VAN DER HORST D J, RODENBURG K W. Lipoprotein assembly and function in an evolutionary perspective. Biomolecular Concepts, 2010, 1(2): 165-183.

doi: 10.1515/bmc.2010.012 pmid: 25961995
[18]
WEERS P M, RYAN R O. Apolipophorin III: Role model apolipoprotein. Insect Biochemistry and Molecular Biology, 2006, 36(4): 231-240.

pmid: 16551537
[19]
COLE K D, FERNANDO-WARNAKULASURIYA G P, BOGUSKI M S, FREEMAN M, GORDON J I, CLARK W A, LAW J H, WELLS M A. Primary structure and comparative sequence analysis of an insect apolipoprotein. Apolipophorin-III from Manduca sexta. The Journal of Biological Chemistry, 1987, 262(24): 11794-11800.

doi: 10.1016/S0021-9258(18)60882-8
[20]
WEN D H, LUO H, LI T N, WU C F, ZHANG J H, WANG X L, ZHANG R. Cloning and characterization of an insect apolipoprotein (apolipophorin-II/I) involved in the host immune response of Antheraea pernyi. Developmental & Comparative Immunology, 2017, 77: 221-228.
[21]
SUNDERMEYER K, HENDRICKS J K, PRASAD S V, WELLS M A. The precursor protein of the structural apolipoproteins of lipophorin: cDNA and deduced amino acid sequence. Insect Biochemistry and Molecular Biology, 1996, 26(8/9): 735-738.

doi: 10.1016/S0965-1748(96)00060-4
[22]
KANOST M R, BOGUSKI M S, FREEMAN M, GORDON J I, WYATT G R, WELLS M A. Primary structure of apolipophorin-III from the migratory locust, Locusta migratoria. Potential amphipathic structures and molecular evolution of an insect apolipoprotein. The Journal of Biological Chemistry, 1988, 263(22): 10568-10573.
[23]
VAN HEUSDEN M C, THOMPSON F, DENNIS J. Biosynthesis of Aedes aegypti lipophorin and gene expression of its apolipoproteins. Insect Biochemistry and Molecular Biology, 1998, 28(10): 733-738.

doi: 10.1016/S0965-1748(98)00068-X
[24]
PALM W, SAMPAIO J L, BRANKATSCHK M, CARVALHO M, MAHMOUD A, SHEVCHENKO A, EATON S. Lipoproteins in Drosophila melanogaster-Assembly, function, and influence on tissue lipid composition. PLoS Genetics, 2012, 8(7): e1002828.

doi: 10.1371/journal.pgen.1002828
[25]
TSUCHIDA K, WELLS M. Digestion, absorption, transport and storage of fat during the last larval stadium of Manduca sexta. Changes in the role of lipophorin in the delivery of dietary lipid to the fat body. Insect Biochemistry, 1988, 18(3): 263-268.

doi: 10.1016/0020-1790(88)90090-X
[26]
KONUMA T, TSUKAMOTO Y, NAGASAWA H, NAGATA S. Imbalanced hemolymph lipid levels affect feeding motivation in the two-spotted cricket, Gryllus bimaculatus. PLoS ONE, 2016, 11(5): e0154841.

doi: 10.1371/journal.pone.0154841
[27]
BOGERD J, BABIN P J, KOOIMAN F P, ANDRÉ M, BALLAGNY C, VAN MARREWIJK W J, VAN DER HORST D J. Molecular characterization and gene expression in the eye of the apolipophorin II/I precursor from Locusta migratoria. Journal of Comparative Neurology, 2000, 427(4): 546-558.
[28]
ZHAO Y, LIU W, ZHAO X, YU Z, GUO H, YANG Y, ZHANG J, MOUSSIAN B, ZHANG J. Apolipophorin-II/I contributes to cuticular hydrocarbon transport and cuticle barrier construction in Locusta migratoria. Frontiers in Physiology, 2020, 11: 790.

doi: 10.3389/fphys.2020.00790
[29]
BENOIT J B, YANG G, KRAUSE T B, PATRICK K R, AKSOY S, ATTARDO G M. Lipophorin acts as a shuttle of lipids to the milk gland during tsetse fly pregnancy. Journal of Insect Physiology, 2011, 57(11): 1553-1561.

doi: 10.1016/j.jinsphys.2011.08.009 pmid: 21875592
[30]
VAN DER HORST D J, RODENBURG K W. Locust flight activity as a model for hormonal regulation of lipid mobilization and transport. Journal of Insect Physiology, 2010, 56(8): 844-853.

doi: 10.1016/j.jinsphys.2010.02.015 pmid: 20206629
[31]
ZDYBICKA-BARABAS A, CYTRYŃSKA M. Apolipophorins and insects immune response. Invertebrate Survival Journal, 2013, 10(1): 58-68.
[32]
DHAWAN R, GUPTA K, KAJLA M, KAKANI P, CHOUDHURY T P, KUMAR S, KUMAR V, GUPTA L. Apolipophorin-III acts as a positive regulator of Plasmodium development in Anopheles stephensi. Frontiers in Physiology, 2017, 8: 185.
[33]
KIM B Y, JIN B R. Apolipophorin III from honeybees (Apis cerana) exhibits antibacterial activity. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 2015, 182: 6-13.

doi: 10.1016/j.cbpb.2014.11.010
[34]
NIERE M, MEISSLITZER C, DETTLOFF M, WEISE C, ZIEGLER M, WIESNER A. Insect immune activation by recombinant Galleria mellonella apolipophorin III. Biochimica et Biophysica Acta, 1999, 1433(1/2): 16-26.
[35]
NOH J Y, PATNAIK B B, TINDWA H, SEO G W, KIM D H, PATNAIK H H, JO Y H, LEE Y S, LEE B L, KIM N J, HAN Y S. Genomic organization, sequence characterization and expression analysis of Tenebrio molitor apolipophorin-III in response to an intracellular pathogen, Listeria monocytogenes. Gene, 2014, 534(2): 204-217.
[36]
PALUSINSKA-SZYSZ M, ZDYBICKA-BARABAS A, RESZCZYNSKA E, LUCHOWSKI R, KANIA M, GISCH N, WALDOW F, MAK P, DANIKIEWICZ W, GRUSZECKI W I, CYTRYNSKA M. The lipid composition of Legionella dumoffii membrane modulates the interaction with Galleria mellonella apolipophorin III. Biochimica et Biophysica Acta, 2016, 1861(7): 617-629.
[37]
WEN D H, WANG X L, SHANG L, HUANG Y, LI T N, WU C F, ZHANG R, ZHANG J H. Involvement of a versatile pattern recognition receptor, apolipophorin-III in prophenoloxidase activation and antibacterial defense of the Chinese oak silkworm, Antheraea pernyi. Developmental & Comparative Immunology, 2016, 65: 124-131.
[38]
WIJERATNE T U, WEERS P M M. Lipid-bound apoLp-III is less effective in binding to lipopolysaccharides and phosphatidylglycerol vesicles compared to the lipid-free protein. Molecular and Cellular Biochemistry, 2019, 458(1/2): 61-70.

doi: 10.1007/s11010-019-03530-x
[39]
YU H Z, WANG J, ZHANG S Z, TOUFEEQ S, LI B, LI Z, YANG L A, HU P, XU J P. Molecular characterisation of Apolipophorin-III gene in Samia cynthia ricini and its roles in response to bacterial infection. Journal of Invertebrate Pathology, 2018, 159: 61-70.

doi: 10.1016/j.jip.2018.10.009
[40]
LIVAK K J, SCHMITTGEN T D. Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCt method. Methods, 2001, 25(4): 402-408.

doi: 10.1006/meth.2001.1262
[41]
LEYRIA J, FRUTTERO L L, AGUIRRE S A, CANAVOSO L E. Ovarian nutritional resources during the reproductive cycle of the hematophagous Dipetalogaster maxima (Hemiptera: Reduviidae): Focus on lipid metabolism. Archives of Insect Biochemistry and Physiology, 2014, 87(3): 148-163.

doi: 10.1002/arch.v87.3
[42]
ATELLA G C, GONDIM K C, MACHADO E A, MEDEIROS M N, SILVA-NETO M A, MASUDA H. Oogenesis and egg development in triatomines: A biochemical approach. Anais da Academia Brasileira de Ciencias, 2005, 77(3): 405-430.

doi: 10.1590/S0001-37652005000300005
[43]
SANTOS R, ROSAS-OLIVEIRA R, SARAIVA F B, MAJEROWICZ D, GONDIM K C. Lipid accumulation and utilization by oocytes and eggs of Rhodnius prolixus. Archives of Insect Biochemistry and Physiology, 2011, 77(1): 1-16.

doi: 10.1002/arch.v77.1
[44]
RUBIN E M, KRAUSS R M, SPANGLER E A, VERSTUYFT J G, CLIFT S M. Inhibition of early atherogenesis in transgenic mice by human apolipoprotein AI. Nature, 1991, 353(6341): 265-267.
[45]
ROSES A D. Apolipoprotein E alleles as risk factors in Alzheimer’s disease. Annual Review of Medicine, 1996, 47: 387-400.

doi: 10.1146/med.1996.47.issue-1
[46]
MASUCCI-MAGOULAS L, GOLDBERG I J, BISGAIER C L, SERAJUDDIN H, FRANCONE O L, BRESLOW J L, TALL A R. A mouse model with features of familial combined hyperlipidemia. Science, 1997, 275(5298): 391-394.

doi: 10.1126/science.275.5298.391
[47]
SHACHTER N S. Apolipoproteins C-I and C-III as important modulators of lipoprotein metabolism. Current Opinion in Lipidology, 2001, 12(3): 297-304.

doi: 10.1097/00041433-200106000-00009
[48]
HANADA Y, SEKIMIZU K, KAITO C. Silkworm apolipophorin protein inhibits Staphylococcus aureus virulence. The Journal of Biological Chemistry, 2011, 286(45): 39360-39369.

doi: 10.1074/jbc.M111.278416
[49]
KAWOOYA J K, LAW J H. Role of lipophorin in lipid transport to the insect egg. The Journal of Biological Chemistry, 1988, 263(18): 8748-8753.
[50]
CANAVOSO L E, JOUNI Z E, KARNAS K J, PENNINGTON J E, WELLS M A. Fat metabolism in insects. Annual Review of Nutrition, 2001, 21: 23-46.

pmid: 11375428
[51]
COELHO H S, ATELLA G C, MOREIRA M F, GONDIM K C, MASUDA H. Lipophorin density variation during oogenesis on Rhodnius prolixus. Archives of Insect Biochemistry and Physiology, 1997, 35(3): 301-313.

doi: 10.1002/(ISSN)1520-6327
[52]
ATELLA G C, SILVA-NETO M A C, GOLODNE D M, AREFIN S, SHAHABUDDIN M. Anopheles gambiae lipophorin: Characterization and role in lipid transport to developing oocyte. Insect Biochemistry and Molecular Biology, 2006, 36(5): 375-386.
[1] ZHANG Qi, CHEN ErHu, SUN DeHong, TANG PeiAn. Relationship Between Glutathione S-Transferase Genes CfGSTe1 and CfGSTd1 and Ethyl Formate Tolerance in Cryptolestes ferrugineus [J]. Scientia Agricultura Sinica, 2026, 59(5): 1008-1019.
[2] SUN YaLing, WANG QingHua, SHU Rui, YUE LiXin, WANG ZhenBao, LI ZhaoXia, GAO LiMin, CHENG Hong, FU ZaiQiu, HUO YuMeng. Production and Characterization of Interspecific Hybrids Between Allium fistulosum and Allium przewalskianum Regel [J]. Scientia Agricultura Sinica, 2026, 59(3): 619-636.
[3] CHEN ErHu, TANG JingJie, HU ShunJie, TANG PeiAn. The Roles of Heat Shock Protein Genes CfHsp70-1 and CfHsp70-2 in Enhancing the High-Temperature Tolerance after Heat Acclimation in Cryptolestes ferrugineus [J]. Scientia Agricultura Sinica, 2025, 58(5): 918-928.
[4] XU YuanYuan, JIA DongSheng, BIN Yu, WEI TaiYun. PGRP6 Negatively Regulates Symbiotic Bacteria to Prevent the Transovarial Transmission of RDV in Nephotettix cincticeps [J]. Scientia Agricultura Sinica, 2025, 58(5): 907-917.
[5] XIAO ZhuoDan, QIAO JiaZheng, GAO YuLan, SHANG ZhangYin, LIU Huai, WANG Jia. Silencing of Cytochrome P450 Genes CYP6CY53 and CYP302A1 in Aphis craccivora Enhances the Sensitivity to Flonicamid [J]. Scientia Agricultura Sinica, 2025, 58(18): 3664-3675.
[6] CHEH ErHu, YUAN GuoQing, CHEN Yan, CHEN MengQiu, SUN ShengYuan, TANG PeiAn. Mitochondrial Protein-Coding Genes Nad5, Nad6 and Atp6 are Involved in Phosphine Resistance of Cryptolestes ferrugineus [J]. Scientia Agricultura Sinica, 2024, 57(9): 1722-1733.
[7] LUO LiDan, CHEN JiaMing, AN Qi, LIU Lei, SUN QinZhe, LIU Huan, WANG SenShan, SONG LiWen. Effects of Extreme High Temperature on Trehalose Content and Trehalose Transporter Gene in Tetranychus truncatus [J]. Scientia Agricultura Sinica, 2024, 57(6): 1091-1101.
[8] YUAN GuoQing, CHEN ErHu, TANG PeiAn. The Mechanisms of Mitochondrial Protein-Coding Genes ND6 and ATP6 in Regulating Cold Tolerance of Cryptolestes ferrugineus [J]. Scientia Agricultura Sinica, 2024, 57(22): 4483-4494.
[9] LI ChuXin, SONG ChenHu, ZHOU JinHuan, LI JiaXin, WANG XinLiang, TIAN XuBin, SONG Zhen. Research on Prevention and Control Technology of Citrus Yellow Vein Clearing Virus Based on VIGS [J]. Scientia Agricultura Sinica, 2024, 57(22): 4473-4482.
[10] WANG Ni, SHI ZheYi, YOU YuanZheng, ZHANG Chao, ZHOU WenWu, ZHOU Ying, ZHU ZengRong. Effects of miRNA on Gene Expression of Sphingolipids Metabolism and Small RNA Analysis of Silencing NlSPT1 and NlSMase4 in Nilaparvata lugens [J]. Scientia Agricultura Sinica, 2024, 57(20): 4022-4034.
[11] CHEH ErHu, SHEN DanRong, DU WenWei, MENG HongJie, TANG PeiAn. Cuticle Protein Genes are Involved in Phosphine Resistance of Cryptolestes ferrugineus [J]. Scientia Agricultura Sinica, 2023, 56(9): 1696-1707.
[12] SHAO HongYang, MENG Xiang, ZHANG Tao, CHEN Min. Analysis of Cytochrome P450 Genes in Response to Quercetin and Function of CYP6ZB2 in Hyphantria cunea [J]. Scientia Agricultura Sinica, 2023, 56(7): 1322-1332.
[13] ZHANG Rui,ZHANG XueYao,ZHAO XiaoMing,MA EnBo,ZHANG JianZhen. Antibody Preparation and Subcellular Localization of LmKnk3-5′ in Locusta migratoria [J]. Scientia Agricultura Sinica, 2022, 55(2): 329-338.
[14] LI LiYing,HE YingTing,ZHONG YuYi,ZHOU XiaoFeng,ZHANG Hao,YUAN XiaoLong,LI JiaQi,CHEN ZanMou. CTNNB1 Regulates the Function of Porcine Ovarian Granulosa Cells [J]. Scientia Agricultura Sinica, 2022, 55(15): 3050-3061.
[15] GUAN RuoBing,LI HaiChao,MIAO XueXia. Commercialization Status and Existing Problems of RNA Biopesticides [J]. Scientia Agricultura Sinica, 2022, 55(15): 2949-2960.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!