Scientia Agricultura Sinica ›› 2023, Vol. 56 ›› Issue (24): 4944-4955.doi: 10.3864/j.issn.0578-1752.2023.24.012

• ANIMAL SCIENCE・VETERINARY SCIENCE • Previous Articles     Next Articles

LNC721 Targeted Regulation MMP9 Affects Bovineskeletal Muscle Satellite Cell Proliferation and Differentiation

GUO YunPeng(), TAN HaoYun, GUO Hong, FU MengYun, LI Xin, HU DeBao, ZHANG LinLin, DING XiangBin, GUO YiWen()   

  1. School of Animal Science and Animal Medicine, Tianjin Agricultural College/Tianjin Key Laboratory of Agricultural Animal Breeding and Healthy Husbandry, Tianjin 300384
  • Received:2023-05-06 Accepted:2023-07-04 Online:2023-12-16 Published:2023-12-21
  • Contact: GUO YiWen

Abstract:

【Background】The muscular system is an important basis for maintaining the survival and growth of the animal body. In the mammalian muscle, nearly half of the muscle is skeletal muscle, skeletal muscle through cell multiplication to migration fusion, and gradually formed a mature muscle bundle attached to the bone with contractile ability. In the animal body, skeletal muscle is not only involved in animal growth, but also in physiological activities, such as respiration and metabolism. At present, many studies have shown that lncRNA had the effect of regulating muscle growth and development, and was a key factor affecting skeletal muscle function and diseases. However, due to the complex mechanism of action of lncRNA, the variety of methods, and the very low conservation type between species, the relationship between lncRNAs of different species is not large, and most of the studies exist in organisms such as humans and mice, and there are few studies on the effect on bovine muscle growth. In recent years, it has been discovered that lncRNAs interact with certain target genes to regulate the process of muscle cell genesis. In the early stage of this experiment, the high-throughput sequencing was performed by collecting bovine muscles of different tissues of different months, the lncRNA with high expression difference was obtained, and the mechanism of its regulation of the myogenic process was studied. 【Objective】This study aimed to explore the interaction between long non-coding RNA lnc721 and its target gene MMP9, and the effects of MMP9 on the growth and development of bovine skeletal muscle cells, in order to provide a reference for the study of the regulatory mechanism of bovine skeletal muscle development.【Method】 The previous experiments showed that interference with lnc721 had a positive regulatory effect on the proliferation of bovine skeletal muscle satellite cells and negatively regulated its differentiation. Three groups of interfering lnc721 bovine skeletal muscle satellite cells and three control groups were set up to sequence transcriptome using NGS technology in the differentiation stage of bovine skeletal muscle satellite cells, in order to obtain the lnc721 differential target gene and to further study the regulatory pathway of lnc721 on bovine skeletal muscle development. According to the screening results and the verification results of qRT-PCR, MMP9 was selected as the target gene of lnc721, and the binding ability of lnc721 and MMP9 was predicted through the CatRAPID website. The interference sequences of lnc721 and MMP9 were designed and synthesized, transfected into bovine skeletal muscle satellite cells, and the effect of lnc721 on MMP9 expression was down-regulated by qRT-PCR and Western blot technology at the mRNA level and protein level. After down-regulation of MMP9, qRT-PCR, Western blot and EdU were used to detect the expression of proliferation marker factors Ki67 and Pax7 and differentiation marker factors MyHC and MyOG, so as to reflect the effect of down-regulation of MMP9 on the growth and development of bovine skeletal muscle satellite cells. 【Result】 MMP9 was identified as a target gene for lnc721 to regulate the interaction of bovine skeletal muscle satellite cells. They were found to interact and bind to each other by RIP. After interfering with lnc721, qRT-PCR analysis showed that down-regulation of lnc721 significantly inhibited MMP9 expression (P<0.01) during the proliferative phase, while it significantly promoted MMP9 expression (P<0.01) during the differentiation phase. Downregulation of MMP9 resulted in a highly significant upregulation of Ki67 mRNA level expression in proliferating cells (P<0.01) and the Pax7 protein expression (P ˂0.05). As also, it could significant increase the positive cell rate of EdU labled cells. At the stage of cell differentiation, the downregulation of MMP9 could inhibit muscle myotube formation. On the other hand, the mRNA and protein expressions of MyHC were significantly decreased (P<0.01); MyoG protein expression was significantly down-regulated (P<0.05). 【Conclusion】 lnc721 could bind to MMP9. Interfering with lnc721 was significantly inhibited MMP9 expression during the proliferative phase of cells, while promoting MMP9 expression during the differentiation phase. MMP9 inhibition could promoted cell proliferation and inhibited differentiation. This study demonstrated that lnc721 targeting MMP9 regulated the development of bovine skeletal muscle satellite cells.

Key words: lnc721, MMP9, bovine skeletal muscle satellite cells, proliferation, differentiation

Table 1

Primers of qRT-PCR"

基因
Gene
引物序列
Primer sequences
(5′-3′)
片段大小
Product length (bp)
Lnc721 F GGGATCACAGCCTGCCAACAC 119
R AGACAGCGACATCCTCAGTGACTC
MyoG F GGCTGACAAATGCCAGACTATCC 140
R TGGTCCCTTGCTTTATCTCCCT
MyHC F CTGGAATCCGGAGGCAGAA 105
R TTTTCGAAGGTAGGGAGCGG
GAPDH F TGTTGTGGATCTGACCTGCC 135
R AAGTCGCAGGAGACAACCTG
Pax7 F AGCCAGAGTTTCAACGGGAG 93
R GTCGCCAACAGACAACACAC
Ki-67 F GAGGTGGCTCAGGTTCGTC 97
R AAAGGGTTGGTGGTAAGTGGC
MMP9 F TACCTCCACCCTGTCTACCAG 112
R CCTGAGGACCAATGAGAGTGG

Fig. 1

Analysis of lnc721 subcellular localization and coding potential A: Prediction of CPC website protein coding ability; B: Subcellular localization detection of lnc721"

Fig. 2

Tissue series expression profile of lnc721 A: 3-month-old fetus; B: 6-month-old fetus; C: 9-month-old fetus; D: Adult cattle"

Fig. 3

Volcano map of gene expression differential analysis"

Fig. 4

Real-time quantitative PCR results of differential gene A: qRT PCR detects the expression of the up-regulated gene; B: qRT-PCR fetects the expression of the down-regulated gene"

Fig. 5

catRAPID predicts the binding site of lnc721 and MMP9"

Fig. 6

Enrichment of lnc721 with MMP9 protein by RIP"

Fig. 7

Downregulation of lnc721 on MMP9 A: Changes in mRNA levels of MMP9 during proliferation and differentiation after down-regulation of lnc721; B: Detection of lnc721 and MMP9 protein expression in proliferation stage; C: Detection of lnc721 and MMP9 protein expression in differentiation stage"

Fig. 8

The effect of interfering MMP9 on proliferation of bovine skeletal muscle satellite cells A: Quantitative PCR screening of MMP9 interfering siRNA in bovine skeletal muscle satellite cells; B: qRT-PCR was used to detect the mRNA expression level of increment marker factors; C: EdU staining, nuclei were counterstained with Hoechst 33342 (400×; scale bars 50 μm), EdU labeling index, with EdU. The number of positive cells/total number of cells represents; D: Proliferation markers were detected by Western blotting"

Fig. 9

The effect of interfering MMP9 on differentiation of bovine skeletal muscle satellite cells A: After transfection of ASO-MMP9, the growth status of differentiated cells was observed by inverted microscope (200×); B: mRNA expression levels of cell differentiation markers; C: Proliferation markers were detected by Western blotting"

[1]
王灵站, 王立群, 王俊梅, 于广海, 毕伏龙. 二甲双胍经线粒体及内质网对骨骼肌减少症干预作用的研究进展. 解剖学杂志, 2018, 41(2): 220-224.
WANG L Z, WANG L Q, WANG J M, YU G H, BI F L. Advance in the research on the treatment of sarcopenia with metformin via mitochondria and endoplasmic reticulum. Chinese Journal of Anatomy, 2018, 41(2): 220-224. (in Chinese)
[2]
WANG G Q, WANG Y, XIONG Y, CHEN X C, MA M L, CAI R, GAO Y, SUN Y M, YANG G S, PANG W J. Sirt1 AS lncRNA interacts with its mRNA to inhibit muscle formation by attenuating function of miR-34a. Scientific Reports, 2016, 6: 21865.

doi: 10.1038/srep21865
[3]
LI R Y, LI B J, CAO Y, LI W J, DAI W L, ZHANG L L, ZHANG X, NING C B, LI H Q, YAO Y L, TAO J L, JIA C, WU W J, LIU H L. Long non-coding RNA Mir22hg-derived miR-22-3p promotes skeletal muscle differentiation and regeneration by inhibiting HDAC4. Molecular Therapy - Nucleic Acids, 2021, 24: 200-211.

doi: 10.1016/j.omtn.2021.02.025
[4]
PITTAYAPRUEK P, MEEPHANSAN J, PRAPAPAN O, KOMINE M, OHTSUKI M. Role of matrix metalloproteinases in photoaging and photocarcinogenesis. International Journal of Molecular Sciences, 2016, 17(6): 868.

doi: 10.3390/ijms17060868
[5]
CHENG Z Y, LIMBU M H, WANG Z, LIU J, LIU L, ZHANG X Y, CHEN P S, LIU B C. MMP-2 and 9 in chronic kidney disease. International Journal of Molecular Sciences, 2017, 18(4): 776.

doi: 10.3390/ijms18040776
[6]
NILAND S, RISCANEVO A X, EBLE J A. Matrix metalloproteinases shape the tumor microenvironment in cancer progression. International Journal of Molecular Sciences, 2021, 23(1): 146.

doi: 10.3390/ijms23010146
[7]
CAREY P, LOW E, HARPER E, STACK M S. Metalloproteinases in ovarian cancer. International Journal of Molecular Sciences, 2021, 22(7): 3403.

doi: 10.3390/ijms22073403
[8]
GROSS J, LAPIERE C M. Collagenolytic activity in amphibian tissues: a tissue culture assay. Proceedings of the National Academy of Sciences of the United States of America, 1962, 48(6): 1014-1022.
[9]
WANG X, KHALIL R A. Matrix metalloproteinases, vascular remodeling, and vascular disease. Advances in Pharmacology, 2018, 81: 241-330.
[10]
DAS A, MONTEIRO M, BARAI A, KUMAR S, SEN S. MMP proteolytic activity regulates cancer invasiveness by modulating integrins. Scientific Reports, 2017, 7(1): 14219.

doi: 10.1038/s41598-017-14340-w pmid: 29079818
[11]
LEI H Q, LEONG D, SMITH L R, BARTON E R. Matrix metalloproteinase 13 is a new contributor to skeletal muscle regeneration and critical for myoblast migration. American Journal of Physiology-Cell Physiology, 2013, 305(5): C529-C538.

doi: 10.1152/ajpcell.00051.2013
[12]
SNYMAN C, NIESLER C U. MMP-14 in skeletal muscle repair. Journal of Muscle Research and Cell Motility, 2015, 36(3): 215-225.

doi: 10.1007/s10974-015-9414-4 pmid: 26025393
[13]
MARINTCHEV A, WAGNER G. TRANSLATION INITIATION: Structures, Mechanisms and Evolution. Quarterly Reviews of Biophysics, 2004, 37(3/4): 197-284.

doi: 10.1017/S0033583505004026
[14]
KAPP L D, LORSCH J R. The Molecular Mechanics of Eukaryotic Translation. Annual Review of Biochemistry, 2004, 73: 657-704.

pmid: 15189156
[15]
HERNÁNDEZ G. On the Origin of the Cap-Dependent Initiation of Translation in Eukaryotes. Trends in Biochemical Sciences, 2009, 34(4): 166-175.

doi: 10.1016/j.tibs.2009.02.001 pmid: 19299142
[16]
GRABER T E, HOLCIK M. Cap-Independent Regulation of Gene Expression in Apoptosis. Molecular Biosystems, 2007, 3(12): 825-834.

pmid: 18000559
[17]
KOZAK M. The Scanning Model for Translation: An Update. Journal of Cell Biology, 1989, 108(2): 229-241.

pmid: 2645293
[18]
BROWNE G J, PROUD C G. Regulation of Peptide-Chain Elongation In Mammalian Cells. European Journal of Biochemistry, 2002, 269(22): 5360-5368.

doi: 10.1046/j.1432-1033.2002.03290.x pmid: 12423334
[19]
CIECHANOVER A. Intracellular protein degradation from a vague idea through the lysosome and the ubiquitin-proteasome system and on to human diseases and drug targeting: Nobel lecture, december 8, 2004. Annals of the new york academy of sciences, 2007, 1116(1): 1-28.

doi: 10.1196/annals.1402.078
[20]
WANG Y, ZHAO Z J, KANG X R, BIAN T, SHEN Z M, JIANG Y, SUN B, HU H B, CHEN Y S. lncRNA DLEU2 acts as a miR-181a sponge to regulate SEPP1 and inhibit skeletal muscle differentiation and regeneration. Aging, 2020, 12(23): 24033-24056.

doi: 10.18632/aging.v12i23
[21]
CAI R, ZHANG Q, WANG Y Q, YONG W L, ZHAO R, PANG W J. Lnc-ORA interacts with microRNA-532-3p and IGF2BP2 to inhibit skeletal muscle myogenesis. Journal of Biological Chemistry, 2021, 296: 100376.

doi: 10.1016/j.jbc.2021.100376
[22]
CHEN M M, LI X, ZHANG X J, LI Y, ZHANG J X, LIU M H, ZHANG L L, DING X B, LIU X F, GUO H. A novel long non-coding RNA, lncKBTBD10, involved in bovine skeletal muscle myogenesis. In Vitro Cellular & Developmental Biology - Animal, 2019, 55(1): 25-35.

doi: 10.1007/s11626-018-0306-y
[23]
LI Z H, CAI B L, ALI ABDALLA B, ZHU X N, ZHENG M, HAN P G, NIE Q H, ZHANG X Q. LncIRS1 controls muscle atrophy via sponging miR-15 family to activate IGF1-PI3K/AKT pathway. Journal of Cachexia, Sarcopenia and Muscle, 2019, 10(2): 391-410.

doi: 10.1002/jcsm.v10.2
[24]
MONDAL S, ADHIKARI N, BANERJEE S, AMIN S A, JHA T. Matrix metalloproteinase-9 (MMP-9) and its inhibitors in cancer: a minireview. European Journal of Medicinal Chemistry, 2020, 194: 112260.

doi: 10.1016/j.ejmech.2020.112260
[25]
NANDI S S, KATSURADA K, SHARMA N M, ANDERSON D R, MAHATA S K, PATEL K P. MMP9 inhibition increases autophagic flux in chronic heart failure. American Journal of Physiology Heart and Circulatory Physiology, 2020, 319(6): H1414-H1437.

doi: 10.1152/ajpheart.00032.2020
[26]
FU C K, CHANG W S, TSAI C W, WANG Y C, YANG M D, HSU H S, CHAO C Y, YU C C, CHEN J C, PEI J S, BAU D T. The association of MMP9 promoter Rs3918242 genotype with gastric cancer. Anticancer Research, 2021, 41(7): 3309-3315.

doi: 10.21873/anticanres.15118
[27]
XUE J C, ZHOU H Y, YU L S Y, WU Y Y. Effect of IL-8 on hepatocellular carcinoma-associated metastasis by targeting MMP9 in mice. Translational Cancer Research, 2022, 11(7): 2050-2060.

doi: 10.21037/tcr
[28]
KUMAR L, BISEN M, KHAN A, KUMAR P, PATEL S K S. Role of matrix metalloproteinases in musculoskeletal diseases. Biomedicines, 2022, 10(10): 2477.

doi: 10.3390/biomedicines10102477
[29]
LI H, MITTAL A, MAKONCHUK D Y, BHATNAGAR S, KUMAR A. Matrix metalloproteinase-9 inhibition ameliorates pathogenesis and improves skeletal muscle regeneration in muscular dystrophy. Human Molecular Genetics, 2009, 18(14): 2584-2598.

doi: 10.1093/hmg/ddp191 pmid: 19401296
[30]
KHERIF S, LAFUMA C, DEHAUPAS M, LACHKAR S, FOURNIER J G, VERDIÈRE-SAHUQUÉ M, FARDEAU M, ALAMEDDINE H S. Expression of matrix metalloproteinases 2 and 9 in regenerating skeletal muscle: a study in experimentally injured and mdxMuscles. Developmental Biology, 1999, 205(1): 158-170.

doi: 10.1006/dbio.1998.9107
[31]
YAMADA H, SAITO F, FUKUTA-OHI H, ZHONG D, HASE A, ARAI K, OKUYAMA A, MAEKAWA R, SHIMIZU T, MATSUMURA K. Processing of beta-dystroglycan by matrix metalloproteinase disrupts the link between the extracellular matrix and cell membrane via the dystroglycan complex. Human Molecular Genetics, 2001, 10(15): 1563-1569.

pmid: 11468274
[32]
MATSUMURA K, ZHONG D, SAITO F, ARAI K, ADACHI K, KAWAI H, HIGUCHI I, NISHINO I, SHIMIZU T. Proteolysis of β-dystroglycan in muscular diseases. Neuromuscular Disorders, 2005, 15(5): 336-341.

doi: 10.1016/j.nmd.2005.01.007
[33]
CHENETTE D M, CADWALLADER A B, ANTWINE T L, LARKIN L C, WANG J H, OLWIN B B, SCHNEIDER R J. Targeted mRNA decay by RNA binding protein AUF1 regulates adult muscle stem cell fate, promoting skeletal muscle integrity. Cell Reports, 2016, 16(5): 1379-1390.

doi: 10.1016/j.celrep.2016.06.095
[34]
ZIMOWSKA M, OLSZYNSKI K H, SWIERCZYNSKA M, STREMINSKA W, CIEMERYCH M A. Decrease of MMP-9 activity improves soleus muscle regeneration. Tissue Engineering Part A, 2012, 18(11/12): 1183-1192.

doi: 10.1089/ten.tea.2011.0459
[1] YUE XiaoYu, ZHAO ShiChen, WANG Qin. The miR-362-3p Regulates the Proliferation and Steroid Hormone Synthesis of Mare Follicular Granulosa Cells by Targeting BMPR2 [J]. Scientia Agricultura Sinica, 2026, 59(7): 1564-1575.
[2] GERIQIMUGE, PUBUZHANDUI, XU Qing, HOU LingLing. Effects of Hypoxia on Proliferation of Bovine Renal Cells and Mitochondrial Autophagy [J]. Scientia Agricultura Sinica, 2026, 59(6): 1333-1347.
[3] TANG XueShen, DANG ShiZhuo, ZHOU Juan, LI JiaHao, LI MeiHua, HU Hao, ZHANG YaHong. Analysis of VvBES1-1 Involvement in Flower Bud Differentiation of Red Globe Grape Based on Red and Blue Light Regulation [J]. Scientia Agricultura Sinica, 2025, 58(8): 1650-1662.
[4] ZHAO YuXuan, MIAO JiYuan, HU Wei, ZHOU ZhiGuo. Effects of Low Temperature at Seedling Stage on Cotton Floral Bud Differentiation and Cotton Plant Yield [J]. Scientia Agricultura Sinica, 2025, 58(7): 1311-1320.
[5] WANG Niu, SHI XinRan, ZHANG WeiDong, WANG Xin. Effect of FGF5 and FGF21 on Proliferation of Dermal Papilla Cells in Cashmere Goat [J]. Scientia Agricultura Sinica, 2025, 58(4): 819-830.
[6] LIU XiaoXu, ZHONG ZeXin, QIU JiaRen, YANG ChunXiao, ZHANG YongJun, XIE Wen, ZHANG YouJun, PAN HuiPeng. GENETIC DIVERSITY OF MTCO1 IN DIFFERENT GEOGRAPHICAL POPULATIONS OF MEGALUROTHRIPS USITATUS [J]. Scientia Agricultura Sinica, 2025, 58(21): 4361-4371.
[7] YUAN Miao, ZHOU Juan, DANG ShiZhuo, TANG XueShen, ZHANG YaHong. Functional Analysis of VvARF18 Gene in Red Globe Grape [J]. Scientia Agricultura Sinica, 2024, 57(7): 1363-1376.
[8] JIANG Chao, ZHANG JiuPan, SONG YaPing, SONG XiaoYu, WU Hao, WEI DaWei. Study on the Role of FoxO1 in Regulating the Proliferation, Apoptosis and Differentiation of Bovine Skeletal Muscle Cells [J]. Scientia Agricultura Sinica, 2024, 57(6): 1191-1203.
[9] LI KaiLi, WEI YunXiao, CHONG ZhiLi, MENG ZhiGang, WANG Yuan, LIANG ChengZhen, CHEN QuanJia, ZHANG Rui. Red and Blue Light Promotes Cotton Callus Induction and Proliferation [J]. Scientia Agricultura Sinica, 2024, 57(4): 638-649.
[10] TIAN QingLan, ZHOU JunNiu, WU YanYan, LIU JieYun, HUANG WeiHua, ZHANG YingJun, XIE WenLian, WEI GuangTan, MOU HaiFei. Observation of Flower Bud Differentiation Process and Fitting of Flower Growth Model of Passion Fruit [J]. Scientia Agricultura Sinica, 2024, 57(4): 765-778.
[11] ZHANG Peng, WANG MingXiu, JING KeMin, LI YuQian, TIAN Yuan, ZHONG JinCheng, CAI Xin. Cloning of PLZF Gene and Its Effects on the Proliferation of Undifferentiated Spermatogonia in Cattleyak [J]. Scientia Agricultura Sinica, 2024, 57(2): 390-402.
[12] WANG JinPeng, LUORENG ZhuoMa, LI YanXia, FENG Fen, WANG ZhengXing, PAN ChuanYing, LAN XianYong, WANG XingPing. The Function of lncRNA RRAS2-AS1 in LPS Induced Bovine Mammary Epithelial Cells Inflammation [J]. Scientia Agricultura Sinica, 2024, 57(14): 2874-2888.
[13] ZHU BingLin, YU JiaLi, CHEN JiaYue, TIAN Yuan, WAN Yuan, LIU ChenYang, WANG XiaoYu, WANG MiaoLi, CHENG Gong. Cloning, Expression Characterization, and Functional Analysis of the Snail1 in Qinchuan Cattle and Its Impact on Proliferation of Bovine Adipocytes [J]. Scientia Agricultura Sinica, 2024, 57(13): 2674-2686.
[14] SHU XiaoWei, WANG ShuShen, FU Tong, WANG ZiHan, DING ZhouYu, YANG Ying, ZHAO ShiRu, ZHOU Juan, HUANG JianYe, YAO YouLi, WANG YuLong, DONG GuiChun. Response Difference and Its Cause Reasons for Simplified Panicle Fertilization in Different Rice Varieties After Wheat Straw Return [J]. Scientia Agricultura Sinica, 2024, 57(10): 1961-1978.
[15] WANG Peng, LIU ZiYi, LIU YuFang, CHU MingXing. miR-535 Targets the GAB2 Gene to Promote Goat Granulosa Cell Proliferation Through Activation of the PI3K/AKT Signaling Pathway [J]. Scientia Agricultura Sinica, 2023, 56(23): 4757-4771.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!