Scientia Agricultura Sinica ›› 2019, Vol. 52 ›› Issue (15): 2706-2715.doi: 10.3864/j.issn.0578-1752.2019.15.014

• ANIMAL SCIENCE·VETERINARY SCIENCE·RESOURCE INSECT • Previous Articles     Next Articles

Lentivirus Mediated Interference Silencing MAT2A and MAT2B Inhibited Differentiation of Porcine Intramuscular Preadipocytes

ZHAO CunZhen,YI BenChi,CHEN PeiRong,LI JianZhu,ZHAO YunHuan,ZHU ZhongKe()   

  1. College of Animal Science and Veterinary Medicine, Xinyang College of Agriculture and Forestry, Xinyang 464000, Henan
  • Received:2018-06-14 Accepted:2019-07-03 Online:2019-08-01 Published:2019-08-06
  • Contact: ZhongKe ZHU E-mail:zhzhongke@163.com

Abstract:

【Objective】 Methionine adenosyltransferase (MAT), an essential cellular enzyme responsible for S-adenosylmethionine biosynthesis. The purpose of this study was to construct the lentivirus-mediated pLenti-H1 vector and investigated the effect of adenosine methionine transferase MAT2A and MAT2B on the differentiation of porcine intramuscular adipocytes.【Method】Porcine longissimus dorsi tissue was collected from 3 to 7 days piglets under sterile conditions and isolated the porcine intramuscular preadipocytes by differential adhesion method. According to MAT2A gene (Accession No.NM_001167650.1) and MAT2B gene sequence (Accession No.NM_001142832.1), Invitrogen online software BLOCK-iTTM RNAi Designer was used to respectively design MAT2A and MAT2B shRNA target sequence. The synthesized single-chain oligonucleotide was annealed to form double strands DNA, and was ligated with pLenti-Hl vector after BamH I and Xho I (TaKaRa) double digestion, then the plasmid DNA was extracted and further identified by restriction enzyme digestion and sequencing. X-tremeGENE-HP DNA transfection reagent was used to co-transfect 293T cells with the correct recombinant plasmid and packaging plasmid (CMV-Δ8.9 and CMV-VSVG). The expression of green fluorescent protein (GFP) was observed after 48 h and then the virus titer was tested. The primary porcine intramuscular preadipocytes were infected with viruses at 70% to 80% cell density and induced adipogenic differentiation when cells at full confluence. Total RNA was extracted from adipocytes and the mRNA reverse transcription was performed by using a Revert Aid First-strand cDNA Synthesis Kit. The gene primer sequences of MAT2A, MAT2B, PPARγ, aP2, CEBP/α and β-actin were designed by Primer primer 5.The interference efficiency of MAT2A and MAT2B gene on the porcine intramuscular preadipocytes was detected by Real-time quantitative PCR and Western blot. The effects of MAT2A and MAT2B on porcine intramuscular adipogenesis were detected by Oil O stating and RT-qPCR. 【Result】Recombinant lentivirus vector pLenti-Hl-MAT2A/MAT2B was successfully constructed. The virus titer of lentivirus sh-MAT2A and sh-MAT2B were respectively 6.7×10 7 pfu/mL and 7×10 7pfu/mL. After preadipocytes infected with adenovirus for 72 h, Microscopic fluorescence imaging showed 90% of green fluorescent protein (GFP) appeared, indicated that porcine intramuscular preadipocytes were successfully infected by lentivirus sh-MAT2A and sh-MAT2B. Real-time qPCR results showed that the expression of MAT2A and MAT2B was separately decreased 70% and 60% compared with sh-scramble. The Western blot experiment and protein analysis showed that interference with MAT2A, the expression of MAT2A had an approximately 40% decrease and the difference reached high significant level (P<0.01). The expression of MAT2B had a 25% drop when inhibited with MAT2B and the different tendency towards statistical significance (P<0.05). Oil O staining and quantitative analysis showed that, the lipid accumulation of porcine intramuscular adipocytes markedly reduced upon silencing of MAT2A and MAT2B. Real-time qPCR results showed that knockdown of MAT2A and MAT2B inhibited the mRNA levels of PPARγ,aP2 and CEBP/α.【Conclusion】 Lentivirus-mediate sh-MAT2A and sh-MAT2B interference system was successfully esablished. The recombinant lentivirus can effectively reduce the mRNA and protein expression of MAT2A and MAT2B in porcine intramuscular adipocytes. Further experiments showed that interfering with MAT2A and MAT2B genes, the lipid accumulation and adipogenic key genes expression in porcine intramuscular adipocytes were significantly inhibited.

Key words: adenosine methionine transferase MAT2A, MAT2B, lentivirus, intramuscular preadipocyte, pig

Table 1

Design of shRNA targeting on porcine MAT2A and MAT2B gene"

RNAi 序列 Primer sequence (5′ to 3′)
sh-MAT2A-1

sh-MAT2A-2

sh-MAT2A-3

sh-MAT2B-1

sh-MAT2B-2

sh-MAT2B-3

sh-scramble
5′-GATCCGCAGCAGTCACCAGATATTGCctcgagGCAATATCTGGTGACTGCTGCTTTTTC-3′
5′-TCGAGAAAAAGCAGCAGTCACCAGATATTGCctcgagGCAATATCTGGTGACTGCTGCG-3′
5′-GATCCGCACACAAGCTCAATGCCAAActcgagTTTGGCATTGAGCTTGTGTGCTTTTTC-3′
5′-TCGAGAAAAAGCACACAAGCTCAATGCCAAActcgagTTTGGCATTGAGCTTGTGTGCG-3′
5′-TCGAGAAAAAGCCAAGTGGCAGATTTGTTATctcgagATAACAAATCTGCCACTTGGCG-3′
5′-GATCCGGAGAGTGCCGTGACTGTTATctcgagATAACAGTCACGGCACTCTCCTTTTTC-3′
5′-GATCCGCACAGCGACGAGTACAAGActcgagTCTTGTACTCGTCGCTGTGCTTTTTC-3′
5′-TCGAGAAAAAGCACAGCGACGAGTACAAGActcgagTCTTGTACTCGTCGCTGTGCG-3′
5′-GATCCGGAGAGTGCCGTGACTGTTATctcgagATAACAGTCACGGCACTCTCCTTTTTC-3′
5′-TCGAGAAAAAGGAGAGTGCCGTGACTGTTATctcgagATAACAGTCACGGCACTCTCCG -3′
5′-GATCCGCGAACACCATTTCGAATTGGctcgagCCAATTCGAAATGGTGTTCGCTTTTTC-3′
5′-TCGAGAAAAAGCGAACACCATTTCGAATTGGctcgagCCAATTCGAAATGGTGTTCGCG-3′
5′-GATCCGACACCTACGCAAAACCCTctcgagGACACCTACGCAAAACCCTTTTTTC-3′
5′-TCGAGAAAAAGACACCTACGCAAAACCCTctcgagGACACCTACGCAAAACCCTG-3′

Table 2

Specific primers for real-time quantitative PCR"

Gene 序列号Accession No. 序列Primer sequence (5′ to 3′)
MAT2A NM_001167650.1 S: GTGGTTCGTGAAACCATTAAG
A: ATCAGTGGCATAACCAAACAT
MAT2B NM_001142832.1 S: TAGGAGCTGCTGTTTTGAGA
A: CACACGCCATTTCATACTTG
PPARγ NM_214379.1 S:AGGACTACCAAAGTGCCATCAAA
A:GAGGCTTTATCCCCACAGACAC
aP2 HM_453202 S:GAGCACCATAACCTTAGATGGA
A:AAATTCTGGTAGCCGTGACA
CEBP AF_103944.1 S: GCACTTGCAGTTCCAGATCG
A:ACCCGGTACTCGTTGCTGTT
β-actin NM_007393 S: GGACTTCGAGCAGGAGATGG
A: AGGAAGGAGGGCTGGAAGAG

Fig. 1

Construction and identification of recombinant plasmid LentiH1-shRNA (A): Produce shRNA interference fragments sense and antisense oligo nucleotides were annealed to form complementary double strands DNA. M: DNA marker (DL 5000); 1-3: sh-MAT2A RNA; 4-6: sh-MAT2B RNA. (B): LentiH1 shuttle plasmid was double digested by Xho I and BamH I. 1-2: the product of LentiH1 shuttle plasmid was double digested; all released two fragments (7612 bp and 59 bp). M: DNA marker (DL 5000). (C): recombinant plasmids were identified by digesting. M: DNA marker (DL 5000). 1, 3, 5, 7, 9, 11: digested plasmid (as a control); 2, 4, 6, 8, 10, 12: undigested plasmid (2-6: sh-MAT2A; 8-12: sh-MAT2B)"

Fig. 2

The packaging of pLentiH1-MAT2A/2B shRNA vector A-C: The GFP expression of sh-scramble and sh-MAT2A and sh-MAT2B that separately infected for 48 h"

Fig. 3

The efficiency of cultured preadipocytes that were infected with recombinant lentivirus A-C Porcine preadipocytes were separately infected by sh-scaramble (as a control), sh-MAT2A and sh-MAT2B for 72 h. D-E: Real-time qPCR to analyze the relative expression of MAT2A and MAT2B (Data are presented as means ± SEM, n=3. *P<0.05, **P<0.01)"

Fig. 4

The detection of MAT2A and MAT2B interference efficiency A-B: The Interference efficiency of MAT2A and MAT2B was detected using Western blot. C-D: Quantification to analysis the protein level of MAT2A and MAT2B (Data are presented as means ± SEM, n=3. *P<0.05, **P<0.01)"

Fig. 5

Silencing MAT2A and MAT2B inhibited differentiation of porcine intramuscular adipocytes A-B: Cells were stained with Oil red O and quantification to assess lipid accumulation. C: The relative mRNA expression of MAT2A and MAT2B detected by RT-qPCR. (Data are presented as means ± SEM; n=3; *P<0.05, **P<0.01)"

[1] BERNS K, HIJMANS E M, MULLENDERS J, BRUMMELKAMP T R, VELDS A, HEIMERIKX M, KERKHOVEN R M, MADIREDJO M, NIJKAMP W, WEIGELT B, AGAMI R, GE W, CAVET G, LINSLEY P S, BEIJERSBERGEN R L, BERNARDS R . A large-scale RNAi screen in human cells identifies new components of the p53 pathway. Nature, Nature, 2004,428(6981):431-437.
[2] LO-BIANCO C, SCHNEIDER B L, BAUER M, SAJADI A, BRICE A, IWATSUBO T, AEBISCHER P . Lentiviral vector delivery of parkin prevents dopaminergic degeneration in an alpha-synuclein rat model of Parkinson's disease. Proceedings of the National Academy of Sciences of the United States of America, 2004,101(50):17510-17515.
[3] AMARZGUIOUI M, ROSSI J, KIM D . Approaches for chemically synthesized siRNA and vector-mediated RNAi. FEBS Lett, 2005,579(26):5974-5981.
[4] PADDISON P J, CAUDY A A, BERNSTEIN E, HANNON G J, CONKLIN D S . Short hairpin RNAs (shRNAs) induce sequence- specific silencing in mammalian cells. Genes Development, 2002, 16(8):948-958.
[5] GARCIA-TREVIJANO E R, LATASA M U, CARRETERO M V, BERASAIN C, MATO J M, AVILA M A . S-adenosylmethionine regulates MAT1A and MAT2A gene expression in cultured rathepatocytes: a new role for S-adenosylmethionine in the maintenance of the differentiated status of the liver. FASEB Journal, 2000,14(15):2511-2518.
[6] DE LA ROSA J, OSTROWSKI J, HRYNIEWICZ M . Chromosomal localization and catalytic properties of the recombinant alpha subunit of human lymphocyte methionine adenosyltransferase. Journal of Biological Chemistry, 1995,270(37):21860-21868.
[7] MATO J M, LU S C . Role of S-adenosyl-L-methionine in liver health and injury. Hepatology, 2007, 45(5):1306-1312.
[8] YANG H, HUANG Z Z, WANG J, LU S C . The role of c-Myb and Sp1 in the up-regulation of methionine adenosyltransferase 2A gene expression in human hepatocellular carcinoma. FASEB Journal, 2001,15(9):1507-1516.
[9] YANG H, SADDA M R, YU V, ZENG Y, LEE T D, OU X, CHEN L, LU S C . Induction of human methionine adenosyltransferase 2A expression by tumor necrosis factor alpha. Role of NF-kappa B and AP-1. Journal of Biological Chemistry, 2003,278(51):50887-50896.
[10] KATOH Y, IKURA T, HOSHIKAWA Y, TASHIRO S, ITO T, OHTA M, KERA Y, NODA T, IGARASHI K . Methionine adenosyltransferase II serves as a transcriptional corepressor of Maf oncoprotein. Molecular Cell, 2011,41(5):554-566.
[11] TOMASI M L, RYOO M, RAMANI K, TOMASI I, GIORDANO P, MATO J M, LU S C . Methionine adenosyltransferase α2 sumoylation positively regulate Bcl-2 expression in human colon and liver cancer cells. Oncotarget, 2015,6(35):37706-37723.
[12] RAMANI K, TOMASI M L . Transcriptional regulation of methionine adenosyltransferase 2A by peroxisome proliferator-activated receptors in rat hepatic stellate cells. Hepatology, 2012, 55(6):1942-1953.
[13] KERA Y, KATOH Y, OHTA M, MATSUMOTO M, TAKANO- YAMAMOTO T, IGARASHI K . Methionine adenosyltransferase II-dependent histone H3K9 methylation at the COX-2 gene locus. Journal of Biological Chemistry, 2013,288(19):13592-13601.
[14] LIU L, YIN J, LI W, LIU K, PENG Y, TAN P, MA R Z . Construction of a bacterial artificial chromosome library for the Rongchang pig breed and its use for the identification of genes involved in intramuscular fat deposition. Biochemical and Biophysical Research Communications, 2010,391(2):1280-1284.
[15] FANG Q, YIN J, LI F, ZHANG J, WATFORD M . Characterization of methionine adenosyltransferase 2β gene expression in skeletal muscle and subcutaneous adipose tissue from obese and lean pigs. Molecular Biology Reports, 2010,37(5):2517-2524.
[16] KRUEGER U, BERGAUER T, KAUFMANN B, WOLTER I, PILK S, HEIDER-FABIAN M, KIRCH S, ARTZ-OPPITZ C, ISSELHORST M, KONRAD J . Insights into effective RNAi gained from large-scale siRNA validation screening. Oligonucleotides, 2007, 17(2):237-250.
[17] PFEIFER A, HOFMANN A . Lentiviral transgenesis. Methods Molecular Biology, 2009,530(3):391-405.
[18] POESCHLA E, CORBEAU P, WONGSTAAL F . Development of HIV vectors for antiHIV gene therapy. Proceedings of the National Academy of Sciences of the United States of America, 1996,93(21):11395-11399.
[19] CHENG J, SONG Z Y, PU L, YANG H, ZHENG J M, ZHANG Z Y, SHI X E, YANG G S . Retinol binding protein 4 affects the adipogenesis of porcine preadipocytes through insulin signaling pathways. Biochemistry and Cell Biology, 2013, 91(4):236-243.
[20] YANG H, CHENG J, SONG Z, LI X, ZHANG Z, MAI Y, PANG W, SHI X, YANG G . The anti-adipogenic effect of PGRN on porcine preadipocytes involves ERK1, 2 mediated PPARγ phosphorylation. Molecular Biology Reports, 2013,40(12):6863-6872.
[21] FORTIN A, ROBERTSON W M, TONG K W . The eating quality of Canadian pork and its relationship with intramuscular fat. Meat Sciences, 2005, 69(2):297-305.
[22] 赵存真, 李黄琨, 马云, 杨公社 . 腺病毒介导的MAT2B过表达促进猪肌内脂肪细胞分化. 畜牧兽医学报, 2017,48(5):802-809.
ZHAO C Z, LI H K, MA Y, YANG G S . MAT2B overexpression mediated by adenovirus promoting porcine intramuscular preadipocyte differentiation. Acta Veterinaria et Zootechnica Sinica, 2017, 48(5):802-809. (in Chinese)
[23] ZHAO C Z, CHEN X C, WU W J, WANG W S, PANG W J, YANG G S . MAT2B promotes adipogenesis by modulating SAMe levels and activating AKT/ERK pathway during porcine intramuscular preadipocyte differentiation. Experimental Cell Research, 2016,344(1):11-21.
[24] DE LA ROSA J, OSTROWSKI J, HRYNIEWICZ M M, KREDICH N M, KOTB M, LEGROS H L J R, VALENTINE M, GELLER A M . Chromosomal localization and catalytic properties of the recombinant alpha subunit of human lymphocyte methionine adenosyltransferase. Journal of Biological Chemistry, 1995,270(37):21860-21868.
[25] YANG H, SADDA M R, YU V, ZENG Y, LEE T D, OU X, CHEN L, LU S C . Induction of human methionine adenosyltransferase 2A expression by tumor necrosis factor alpha. Role of NF-kappa B and AP-1. Journal of Biological Chemistry, 2003,278(51):50887-50896.
[26] TOMASI M L, RYOO M, RAMANI K, TOMASI I, GIORDANO P, MATO J M, LU S C . Methionine adenosyltransferase α2 sumoylation positively regulate Bcl-2 expression in human colon and liver cancer cells. Oncotarget, 2015,6(35):37706-37723.
[27] RAMANI K, LU S C . Methionine adenosyltransferases in liver health and diseases. Liver Research, 2017,1(2):103-111.
[28] BOTTIGLIERI T . S-Adenosyl-L-methionine (SAMe): from the bench to the bedside--molecular basis of a pleiotrophic molecule. American Journal of Clinical Nutrition, 2002,76(5):1151S-7S.
[29] MATO J M, LU S C . Role of S-adenosyl-L-methionine in liver health and injury. Hepatology, 2007,45(5):1306-1312.
[30] MARTA V R, MARTA I L, JUAN J L, ANA M A, MARC T, AGUSTÍN F F, JOSÉ L L, DAVID M A, MARÍA B, MARC T, ZIGMUND L, CONRAD W, SHELLY C L, MANEL E, RHONA M, KRISTJÁN R J, MARIO F F, JOSÉ M M, ASHWIN W . S-adenosylmethionine levels regulate the schwann cell DNA methylome. Neuron, 2014,81(5):1024-1039.
[1] ZHOU Qi, ZHANG ShiHao, ZHANG Liang, PAN Yu, ZHANG LiJuan, TU Zhi, PAN HongMei, LONG Xi. Prediction of the Potential Habitat Suitability of Luopanshan Pigs in Chongqing Based on the Optimized MaxEnt Model [J]. Scientia Agricultura Sinica, 2026, 59(1): 205-219.
[2] WANG JiYing, LI JingXuan, WANG YanPing, GUO JianFeng, LIN HaiChao, ZHAO XueYan. Weighted Gene Co-Expression Network Analysis Reveals Potential Candidate Genes Affecting Fat Deposition in Pigs [J]. Scientia Agricultura Sinica, 2025, 58(9): 1845-1855.
[3] JIN YiDan, HE NiQing, CHENG ZhaoPing, LIN ShaoJun, HUANG FengHuang, BAI KangCheng, ZHANG Tao, WANG WenXiao, YU MinXiang, YANG DeWei. Screening and Identification of Pigm-1 Interaction Proteins for Disease Resistance of Rice Blast [J]. Scientia Agricultura Sinica, 2025, 58(6): 1043-1051.
[4] LIU Jing, ZHAO ShiLin, YANG XiaoTing, WEI YiXuan, LI JiaPeng, ZHAO Yan. Study on the Origin Traceability of Beijing Black Pig Based on Stable Isotope Technology [J]. Scientia Agricultura Sinica, 2025, 58(23): 5071-5080.
[5] GAO Rong, LI HengYu, CHEN LiJuan, MA HuiLing. Physiological Effects of 5-AzaC on Alleviating Salt‑Alkali Stress in Alfalfa and Its Impact on the Expression of DNA Methylation Enzyme Genes [J]. Scientia Agricultura Sinica, 2025, 58(21): 4482-4496.
[6] GAO XiaoPing, PAN HongMei, GUO ZongYi, ZHANG JunJie, LIN Yan, ZHANG Liang. Post-Freezing Quality and Targeted Lipidomics Analysis of Rongchang Pig Spermatozoa with Different Freezing Tolerance [J]. Scientia Agricultura Sinica, 2025, 58(2): 387-400.
[7] ZHANG HuaPeng, ZHANG QingZe, HE Fan, QI MengFan, FU BinBin, LI QingChun, LI MengXun, MA LiPeng, LIU Yi, HUANG Tao. Cloning and Identification of Differentially Expressed lncRNAs in Follicles of Meishan Pigs and Duroc Pigs with Their Correlation Analysis with miRNAs [J]. Scientia Agricultura Sinica, 2024, 57(9): 1807-1819.
[8] ZHAO ZhenJian, WANG Kai, CHEN Dong, SHEN Qi, YU Yang, CUI ShengDi, WANG JunGe, CHEN ZiYang, YU ShiXin, CHEN JiaMiao, WANG XiangFeng, TANG GuoQing. Integrated Aanalysis of Genome and DNA Methylation for Screening Key Genes Related to Pork Quality Traits [J]. Scientia Agricultura Sinica, 2024, 57(7): 1394-1406.
[9] LIU ZhuoLin, LIU HongYun. The Potential and Mechanisms of Apigenin to Relieve Heat Stress and Hypoxia in Dairy Cows Based on Network Pharmacology and Molecular Docking [J]. Scientia Agricultura Sinica, 2024, 57(5): 1010-1022.
[10] ZHOU YuanQing, DONG HongMin, ZHU ZhiPing, WANG Yue, LI NanXi. Review on Carbon Footprint Assessment of Pig Farming System [J]. Scientia Agricultura Sinica, 2024, 57(2): 379-389.
[11] CAI RuiJie, CHU YiXin, SHI XinE, JIN JianJun, YANG GongShe. Dietary Addition of Cordyceps Militaris Can Alleviate Lipopolysaccharide- Induced Liver Damage and Skeletal Muscle Protein Degradation in Early Weaning Piglets [J]. Scientia Agricultura Sinica, 2024, 57(12): 2467-2482.
[12] LIU YanLing, QIU Ao, ZHANG ZiPeng, WANG Xue, DU HeHe, LUO WenXue, WANG GuiJiang, WEI Xia, SHI WenYing, DING XiangDong. The Efficiency of Haplotype-Based Genomic Selection Using Genotyping by Target Sequencing in Pigs [J]. Scientia Agricultura Sinica, 2024, 57(11): 2243-2253.
[13] CUI DengShuai, XIONG SanYa, ZHENG Hao, LI LongYun, YU NaiBiao, HUANG ZhiYong, XIAO ShiJun, GUO YuanMei. Comparing Methods for Correcting Days to 100 kg of Sows in Licha Black Pig and Its Intercross with Berkshire [J]. Scientia Agricultura Sinica, 2023, 56(6): 1177-1188.
[14] AN Yong, QIN ShiZhen, SHI ZhaoGuo, GONG LiYuan, ZHANG Shuai, JI Feng. Influences of Phosphorus Level in Diet of Parent Pigeons on Biochemical Index, Untargeted Metabolomics Profile of Serum, and Gene Expression of Phosphate Transporters in Squabs [J]. Scientia Agricultura Sinica, 2023, 56(23): 4772-4788.
[15] LIU Chang, CUI ZiXu, ZUO Zhou, YUN HongMei, NIU Jin, YANG Yang, GUO XiaoHong, LI BuGao, GAO PengFei, ZHAO Yan, CAO GuoQing. Effects of Dietary Fiber Level on Intestinal Barrier Function, Colonic Microbiota and Metabolites in Pigs [J]. Scientia Agricultura Sinica, 2023, 56(22): 4532-4551.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!