松杨栅锈菌两菌群RAPD特异序列的标记转换

doi:10.3864/j.issn.0578-1752.2009.01.045

Abstract

Abstract:

【Objective】 This paper focused on achieving sequence characterized amplified region (SCARs) of geographic populations of Melampsora larici-populina, and transferring them to codominant markers. 【Method】 Based on the results of RAPD study of Melampsora larici-populina, DNA fragments of Western and Northern populations were recycled, purified, pGEM-T vector cloned and sequenced. About 400bp length DNA fragments were achieved after being integrated by software Seqman, and two pairs of primers were designed by software Primerselect (Western population primers: PNW0118-382-F: GAATCGGCCACAAAACTATC, PNW0118-382-R: GAATCGGCC ATGACTTGAGC, and Northern population primers: PNW0118-400-F: GAATCGGCCACAAAA CTATC, PNW0118-400-R: GAATCGGCCATGACTTGAGCTGC).【Result】 With these primers, SCARs of Western population (382 bp) and Northern population (400 bp) were amplified successfully by optimized conditions of polymerase chain reactions. 【Conclusion】The two pairs of primer can be used to monitor the geographic groups of Melampsora larici-populina

Key words: Melampsora larici-populina, DNA , SCAR markers

Specific RAPD-DNA Markers Transfer of Two Populations of Melampsora larici-populina

[J].Scientia Agricultura Sinica, 2009, 42(1): 349-354 .

0
/ / Recommend

Add to citation manager EndNote|Reference Manager|ProCite|BibTeX|RefWorks

URL: https://www.chinaagrisci.com/EN/10.3864/j.issn.0578-1752.2009.01.045

https://www.chinaagrisci.com/EN/Y2009/V42/I1/349

References

Related Articles 15

[1]	LIN Ping, WANG KaiLiang, YAO XiaoHua, REN HuaDong. Development of DNA Molecular ID in Camellia oleifera Germplasm Based on Transcriptome-Wide SNPs [J]. Scientia Agricultura Sinica, 2023, 56(2): 217-235.
[2]	ZHAO ChunFang,ZHAO QingYong,LÜ YuanDa,CHEN Tao,YAO Shu,ZHAO Ling,ZHOU LiHui,LIANG WenHua,ZHU Zhen,WANG CaiLin,ZHANG YaDong. Screening of Core Markers and Construction of DNA Fingerprints of Semi-Waxy Japonica Rice Varieties [J]. Scientia Agricultura Sinica, 2022, 55(23): 4567-4582.
[3]	HUANG XunHe,WENG ZhuoXian,LI WeiNa,WANG Qing,HE DanLin,LUO Wei,ZHANG XiQuan,DU BingWang. Genetic Diversity of Indigenous Yellow-Feathered Chickens in Southern China Inferred from Mitochondrial DNA D-Loop Region [J]. Scientia Agricultura Sinica, 2022, 55(22): 4526-4538.
[4]	MA XueMeng,YU ChengMin,SAI XiaoLing,LIU Zhen,SANG HaiYang,CUI BaiMing. PSORA: A Strategy Based on High-Throughput Sequence for Analysis of T-DNA Insertion Sites [J]. Scientia Agricultura Sinica, 2022, 55(15): 2875-2882.
[5]	LI ZhenXi,LI WenTing,HUANG JiaQuan,ZHENG Zheng,XU MeiRong,DENG XiaoLing. Detection of ‘Candidatus Liberibacter asiaticus’ by Membrane Adsorption Method Combined with Visual Loop-Mediated Isothermal Amplification [J]. Scientia Agricultura Sinica, 2022, 55(1): 74-84.
[6]	FAN XiaoJing, YU WenTao, CAI ChunPing, LIN Yi, WANG ZeHan, FANG WanPing, ZHANG JianMing, YE NaiXing. Construction of Molecular ID for Tea Cultivars by Using of Single- nucleotide Polymorphism (SNP) Markers [J]. Scientia Agricultura Sinica, 2021, 54(8): 1751-1760.
[7]	TANG XiuJun,FAN YanFeng,JIA XiaoXu,GE QingLian,LU JunXian,TANG MengJun,HAN Wei,GAO YuShi. Genetic Diversity and Origin Characteristics of Chicken Species Based on Mitochondrial DNA D-loop Region [J]. Scientia Agricultura Sinica, 2021, 54(24): 5302-5315.
[8]	ZHANG Wei,WANG ShiYin,GAO Li,YANG LiWei,DENG ShuangYi,LIU XiaoNa,SHI GuoQing,GAN ShangQuan. Investigation of miR-486 Target Genes in Skeletal Muscle of Bashbay Sheep in Different Development Periods [J]. Scientia Agricultura Sinica, 2021, 54(14): 3134-3148.
[9]	LI ZhengGang,NONG Yuan,TANG YaFei,SHE XiaoMan,YU Lin,LAN GuoBing,DENG MingGuang,HE ZiFu. Molecular Characteristic and Pathogenicity Analyses of Cucumber green mottle mosaic virus (CGMMV) Infecting Bottle Gourd in Lianzhou, Guangdong [J]. Scientia Agricultura Sinica, 2020, 53(5): 955-964.
[10]	GAO Yuan,WANG DaJiang,WANG Kun,CONG PeiHua,ZHANG CaiXia,LI LianWen,PIAO JiCheng. Genetic Diversity and Phylogenetics of Malus baccata (L.) Borkh Revealed by Chloroplast DNA Variation [J]. Scientia Agricultura Sinica, 2020, 53(3): 600-611.
[11]	JIA YunHui,XU ChengZhi,SUI JinYu,WU YunPu,XU BangFeng,CHEN Yan,YANG HuanLiang,QIAO ChuanLing,CHEN HuaLan. Immunogenicity Evaluation of Eukaryotic Expressing Plasmids Encoding HA Protein of Eurasian Avian-Like H1N1 Swine Influenza Virus [J]. Scientia Agricultura Sinica, 2019, 52(5): 930-938.
[12]	Tao ZHANG, FuHui SI, YuXi ZHANG, ShuPeng GAI. Effect of Exogenous Gibberellin on DNA Methylation Level and Expression of Related Enzyme Genes in Tree Peony Floral Buds [J]. Scientia Agricultura Sinica, 2018, 51(18): 3561-3569.
[13]	LIU HaiLu, WANG Xuan, LI HongMei, LI YanXia, XUE BoWen, MA JuKui. Molecular Identification of Pratylenchus Species in 10 Samples Collected from Wheat Field in Huanghuai Region of China [J]. Scientia Agricultura Sinica, 2018, 51(15): 2898-2912.
[14]	LI Yi, MA XianFeng, TANG Hao, LI Na, JIANG Dong, LONG GuiYou, LI DaZhi, NIU Ying, HAN RuiXi, DENG ZiNiu. SSR Markers Screening for Identification of Citrus Cultivar and Construction of DNA Fingerprinting Library [J]. Scientia Agricultura Sinica, 2018, 51(15): 2969-2979.
[15]	ZHANG NanNan, NIU Liang, CUI GuoChao, PAN Lei, ZENG WenFang, WANG ZhiQiang, LU ZhenHua. Establishment and application of a high-throughout protocol for Peach (Prunus persica) DNA extraction [J]. Scientia Agricultura Sinica, 2018, 51(13): 2614-2621.

Metrics

Viewed

Full text

Abstract

Cited

Shared

Discussed

Comments

Recommended 0

No Suggested Reading articles found!