Loading...

Table of Content

    10 January 2009, Volume 42 Issue 1
    CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS
    Analysis on Blast Resistance Phenotypes and Resistance Gene Analog Polymorphism of Rice Varieties
    Scientia Agricultura Sinica. 2009, 42(1):  1-9 .  doi:10.3864/j.issn.0578-1752.2009.01.001
    Abstract ( 1204 )   PDF (749KB) ( 2085 )   Save
    Related Articles | Metrics

    【Objective】 In this paper,the study was conducted to investigate the relationship between phenotype of blast resistance and resistance gene analog polymorphism of rice, and search molecule hereditary basis of broad spectrum and durable resistance. 【Method】 Comparison of clustering analysis was investigated using spectrum of resistance to blast and polymorphism of resistance gene analog (RGA) in 25 varieties for blast resistance identification and 20 varieties (lines). 【Result】 The resistance spectrum clustering analysis showed that the 45 varieties (lines) could be divided into group A and group B with the genetic similarity coefficient of 0.450. Group A and group B could be divided into subclassⅰ, subclass ⅱ, subclass ⅲ, subclass ⅳ, respectively, with 0.618 genetic similarity coefficient. The RGA-PCR clustering analysis showed that proposed the 45 varieties (lines) could be divided into group Ⅰ and group Ⅱ which clearly inclined the Indica-japonica differentiation with 0.620 genetic similarity coefficient. GroupⅠcould be divided into six subclasses and group Ⅱ could be divided into seven subclasses with 0.783 genetic similarity coefficient. The resistance spectrum clustering analysis showed that some varieties with similar resistance spectrum could finely fall into the same group, while the RGA-PCR clustering analysis showed that some varieties with the similar genetic background could fall into the same group. For some varieties with low resistance frequency or high resistance frequency, there was a better corresponding relationship between the resistance spectrum clustering and the RGA-PCR clustering. General comparison of clustering analysis showed that there was no parallelism relationship between group and group in two different types of the clustering 【Conclusion】 It could more accurately reflect their genetic background to test resistance to single strain and analysis on RGA polymorphism for resistance parents, and avoid applying the same source of resistance again and again, and enrich rice resistance germplasm, and breed durable resistance varieties.

    Improvement of Low-Temperature Stress Tolerant Capacities in Transgenic Tobacco Plants from Overexpression of Wheat TaSOD1.1 and TaSOD1.2 Genes

    Scientia Agricultura Sinica. 2009, 42(1):  10-16 .  doi:10.3864/j.issn.0578-1752.2009.01.002
    Abstract ( 1415 )   PDF (454KB) ( 892 )   Save
    Related Articles | Metrics

    【Objective】 To elucidate the effects of overexpression of wheat TaSOD1.1 and TaSOD1.2 genes on low-temperature stress tolerant capacities in tobacco. 【Method】 The transgenic tobacco plants fused the target genes were generated based on Agrobacterium tumerficiens- mediated transformation approach. The regulation effects of target genes on low-temperature stress tolerant capacities were evaluated by the comparisons of plant morphology and physiological parameters among the transgenic lines and control (CK) after low-temperature treatment. 【Result】 The transgenic lines with one copy of inserted genes were used as the experimental materials. After low-temperature stress treatment, compared to control and the silenced target gene line TaSOD1.1-a, the transgenic plants with high expression levels of the target genes had obvious higher superoxide dismutase (SOD) activities, so had the higher contents of chlorophyll a, b, and caroteroid, and the contents of soluble sugar and soluble protein. In the meantime, the malondialdehyde (MDA) content was much lower. 【Conclusion】 Overexpression of wheat TaSOD1.1 and TaSOD1.2 genes increased SOD activities and decreased MDA content, resulting in the lessening degree of over-oxidation of the cellular membrane system and the enhancement of physiological functions, and finally improved the low-temperature stress tolerant capacities in transgenic tobacco plants.

    Characterization of Lr34/Yr18, Rht-B1b, Rht-D1b Genes in CIMMYT Wheat Cultivars and Advanced Lines Using STS Markers
    Scientia Agricultura Sinica. 2009, 42(1):  17-27 .  doi:10.3864/j.issn.0578-1752.2009.01.003
    Abstract ( 1770 )   PDF (420KB) ( 783 )   Save
    Related Articles | Metrics

    【Objective】 Characterization of genes Lr34/Yr18, Rht-B1b (Rht1) and Rht-D1b (Rht2) in 263 CIMMYT wheat cultivars and advanced lines will benefit the improvement of rust resistance and plant height in Chinese wheat breeding program. 【Method】 A total of 263 CIMMYT wheat cultivars and advanced lines were tested by STS markers to understand the distribution of resistance genes Lr34/Yr18 and dwarfing genes Rht-B1b and Rht-D1b. 【Result】 The marker csLV34 could amplify a 150 bp fragment in the lines with Lr34/Yr18, and a 229 bp fragment in those lines without Lr34/Yr18. Two complementary markers, NH-BF.2/WR1.2 and NH-BF.2/MR1, were used to investigate the alleles Rht-B1a and Rht-B1b, respectively. They could amplify a 400 bp fragment in the genotypes with Rht-B1a and Rht-B1b, respectively. The marker DF/MR2 could generate a 280 bp fragment in the genotype with Rht-D1b. Of the 263 lines, 57 generated a 150 bp fragment with the marker csLV34, indicating the presence of Lr34/Yr18 in these lines, with a frequency of 21.7%. Two hundred and sixteen lines (82.1%) were detected to have the allele Rht-B1b, and 38 lines (14.4%) contained the allele Rht-D1b. Twenty-one lines were detected to possess both the wild-type alleles Rht-B1a and Rht-D1a, while 12 had two dwarfing genes Rht-B1b and Rht-D1b. 【Conclusion】 These STS markers could be useful to detect the genes Lr34/Yr18, Rht-B1b and Rht-D1b. The frequency of Rht-B1b was much higher than that of Rht-D1b in CIMMYT lines.

    Allelic Variation of PPO Genes in Chinese Wheat Micro-Core Collections
    Scientia Agricultura Sinica. 2009, 42(1):  28-35 .  doi:10.3864/j.issn.0578-1752.2009.01.004
    Abstract ( 1319 )   PDF (392KB) ( 909 )   Save
    Related Articles | Metrics

    【Objective】 Grain polyphenol oxidase (PPO) activity is highly related to the brown discoloration of wheat based end-products. Studying on the variation of PPO activity and the distribution of allelic genes in Chinese wheat micro-core collections could take good advantage of germplasm and improve the appearance quality of wheat flour food. 【Method】 In this study the variation of PPO activity and the distribution of PPO allelic genes were detected by the method of biochemistry and gene-based markers in 251 Chinese wheat micro-core collections growning in Hefei and Fengyang in 2004-2005 crop season. 【Result】 The results showed that most cultivars were with low PPO activity and the rate of varieties with PPO activity below 200 was 47.01% and the variation of PPO activity was affected by genotype and locations and interaction between them. Four genotypes, PPO-2Aa1/PPO-2Da2 (a1a2), PPO-2Aa1/PPO-2Db1 (a1b1), PPO-2Aa1/PPO-2Db2 (a1b2), and PPO-2Ab1/PPO-2Db2 (b1b2), were detected in Chinese wheat micro-core collections. Cultivars with the genotype a1a2 have the lowest PPO activity while the cultirars with the genotype b1b2 have the highest, with genotype a1b2 and genotype b1a2 have the intermediate. The effect of interaction between marker genotypes and locations on PPO activity was not significant (P<0.05). The frequency of PPO allelic genes on two wheat chromosomes 2A and 2D was different. The frequency of allelic genes 2Aa1 and 2Ab1 on chromosome 2A was most alike, while the frequency of 2Da2 was almost four times than that of 2Db2 on chromosome 2D. The effect of haplotype of PPO genes on the same chromosome on PPO activity was PPO-2Aa1<PPO-2Ab1 and PPO-2Da2<PPO-2Db2. The mean value of PPO activity of cultivars from South China Winter Wheat Region was significantly (P<0.01) lower than that of cultivars from the three spring wheat regions and cultivars imported from aboard. Cultivars from the five winter wheat regions gave significantly (P<0.01) lower PPO activity than cultivars from the three spring wheat regions of China. PPO activity of landrace was significantly (P<0.01) lower than that of bred varieties and cultivars imported from aboard. The PPO activity and genotypes of primal parents in Chinese wheat cultivars was also analysized in this study. 【Conclusion】Variation of PPO activity in Chinese wheat micro-core collections is obvious, and the allelic variation of PPO genes induced a significant effect on grain PPO activity. The distribution of wheat grain PPO activity and genotypes have a close relationship with wheat regions and wheat primary parents.

    Identification and Analysis of Genetic Diversity Structure Within Pisum Genus Based on Microsatellite Markers
    Scientia Agricultura Sinica. 2009, 42(1):  36-46 .  doi:10.3864/j.issn.0578-1752.2009.01.005
    Abstract ( 1750 )   PDF (427KB) ( 933 )   Save
    Related Articles | Metrics

    【Objective】 Assessing the genetic diversity between wild and cultivated accessions of eight taxonomic groups in two species, five subspecies under Pisum genus, and analyzing the population structure and their genetic relationships among various groups of taxonomy, the study try to verify the fitness of traditionally botanical taxonomic system under Pisum genus and to provide essential information for the exploration and utilization of wild relatives of pea genetic resources. 【Method】 One hundred and ninety-seven Pisum accessions from 62 counties of five continents were employed for SSR analysis using 21 polymorphic primer pairs in this study. Except for cultivated field pea Pisum sativum subsp. sativum var. sativum (94 genotypes), also included were wild relative genotypes that were classified as P. fulvum, P. sativum subsp. abyssinicum, P. sativum subsp. asiaticum, P. sativum subsp. transcaucasicum, P. sativum subsp. elatius var. elatius, P. sativum subsp. elatius var. pumilio and P. sativum subsp. sativum var. arvense (103 genotypes). The PCA analyses and three-dimensional PCA graphs were conducted and drawn by NTSYSpc 2.2d statistical package. Nei78 genetic distances among groups of genetic resources were calculated, and cluster analysis using UPGMA method was carried out by using Popgene V1.32 statistical package, the dendrogram were drawn by MEGA3.1 statistical package. Allelic statistics were carried out by Popgene V1.32. The significance test between groups of genotypes was carried out by Fstat V2.9.3.2 statistical package.【Result】One hundred and four polymorphic bands were amplified using 21 SSR primer pairs with unambiguous unique polymorphic bands. 4.95 alleles were detected by each SSR primer pair in average, of which 65.56% were effective alleles for diversity. PSAD270, PSAC58, PSAA18, PSAC75, PSAA175 and PSAB72 were the most effective SSR pairs. SSR alleles were uniformly distributed among botanical taxon units under pisum genus, but significant difference appeared in most pairwise comparisons for genetic diversity between taxon unit based groups of genetic resources. Genetic diversity level of wild species P. fulvum was much lower than the cultivated species P. sativum. Under species P. sativum, P. sativum ssp. sativum var. sativum and P. sativum ssp. asiaticum were the highest in gentic diversity, followed by P. sativum ssp. elatius var. elatius and P. sativum ssp. transcaucasicum, P. sativum ssp. elatius var. pumilio, P. sativum ssp. sativum var. arvense and P. sativum ssp. abyssinicum were the lowest. Four gene pool clusters were detected under Pisum genus by using PCA analysis. Gene pool “fulvum” mainly consisted of wild species Pisum fulvum, gene pool “abyssinicum” mainly consisted of P. sativum ssp. abyssinicum, and gene pool “arvense” mainly consisted of P. sativum ssp. sativum var. arvense. While gene pool “sativum” were composed by five botanical taxon units, they are P. sativum ssp. asiaticum, P. sativum ssp. elatius var. elatius, P. sativum ssp. transcaucasicum, P. sativum ssp. elatius var. pumilio and P. sativum ssp. sativum var. sativum. “sativum” gene pool constructed the primary gene pool of cultivated genetic resources;“fulvum” gene pool, “abyssinicum” gene pool and “arvense” gene pool together constructed the secondary gene pool of cultivated genetic resources. Pairwise Nei78 genetic distance among botanical taxon based groups of pea genetic resources ranged from 7.531 to 35.956, three large cluster groups were identified based on the UPGMA dendrogram. Group I equals to “sativum” and “arvense” gene pools, Group II equals to “abyssinicum” gene pool, and Group III equals to “fulvum” gene pool. The UPGMA clustering results generally support the PCA clustering results.【Conclusion】 There were significant differences among most botanical groups under Pisum genus, with clear separation of four gene pools for genetic diversity structure. The research results partially support the traditional botanical taxonomy under Pisum genus, and point out its advantage and shortcoming. In order to broaden the genetic bases of pea varieties, the genetic potentials in the four gene pools should be thoroughly exploited.

    Analysis on Genetic Diversity of Wild Populations of Licorice (Glycyrrhiza uralensis Fisch.) with AFLP Markers

    Scientia Agricultura Sinica. 2009, 42(1):  47-54 .  doi:10.3864/j.issn.0578-1752.2009.01.006
    Abstract ( 1113 )   PDF (366KB) ( 1057 )   Save
    Related Articles | Metrics

    【Objective】 Licorice (Glycyrrhiza uralensis Fisch.) is an important Chinese medicinal plant with industrial and ecological values but at the risk of extinction. Genetic diversity analysis will be helpful to the protection of the wild germplasm resources of G. uralensis F. 【Method】 The genetic diversity of 320 single individual plants representing 16 wild populations, which were derived from main production regions of licorice in China, was assessed with AFLP markers. 【Result】 A total of 759 fragments were generated from fifteen pairs of selective AFLP primer combinations, 527 of which were polymorphic. The level of polymorphism was 69.43%. Nei’s gene diversity index ranged from 0.13 to 0.19 for different populations, with the total value of 0.25. Shannon information index ranged from 0.19 to 0.28, with the total value of 0.39. The licorice populations from Ningxia district had the highest genetic diversity, however, those from Jiuquan district were the lowest. The result of AMOVA analysis showed that the genetic variation within populations was 67.16% and the variation between populations was 18.64%. Sixteen populations were clustered into three groups by UPGMA dendrogram, which was significantly correlated with the geographic distribution of the materials.【Conclusion】 The results of present study indicate that the wild licorice populations in China have the medium level of genetic diversity. The broad genetic variation within populations could be the theoretical base for the protection of wild germplasm resources and breeding of elite varieties.

    Cloning and Sequence Analysis of a DFR Gene from Fagopyrum dibotrys (D.Don) Hara

    Scientia Agricultura Sinica. 2009, 42(1):  55-63 .  doi:10.3864/j.issn.0578-1752.2009.01.007
    Abstract ( 1527 )   PDF (527KB) ( 1523 )   Save
    Related Articles | Metrics

    【Objective】 This work was aimed to investigate the sequence characteristics of a DFR gene from Fagopyrum dibotrys (D.Don) Hara. 【Method】According to the obtained homologous probe from other plant’s DFRs, DFR gene was isolated from the F. dibotrys using the RACE (rapid amplification of cDNA ends) methods to scanning cDNA library; and bio-informatical analysis, and Southern blot were also made. 【Result】One DFR cDNA clones (FdDFR1) was cloned (GenBank accession No. EF522145/ EF522146). The comparison between cDNA and genomic DNA sequences revealed that FdDFR1 is composed of two exons and one intron. Southern blot analysis indicated that DFR belongs to a small gene family, and only one FdDFR1 copy in F. dibotrys genomes. A NADP binding site (VTGASGFVGSWLVMRLLEHGY) and a substrate specificity motif (TVNVEEKQKPVYDETCW SDVDFCR RV) were observed in the deduced amino acid sequence of FdDFR1 contained N-terminal region. 【Conclusion】It is concluded that FdDFR1 has the typical characteristics with other homologous genes.

    TILLAGE & CULTIVATION·PHYSIOLOGY & BIOCHEMISTRY
    Effects of Elevated CO2 and O3 Concentration on Active Oxygen Metabolism and Anti-Oxidative Enzymes Activities in Spring Wheat
    Scientia Agricultura Sinica. 2009, 42(1):  64-71 .  doi:10.3864/j.issn.0578-1752.2009.01.008
    Abstract ( 1320 )   PDF (467KB) ( 885 )   Save
    Related Articles | Metrics

    【Objective】 The objective of this experiment is to reveal the effect mechanism of elevated carbon dioxide (CO2 ) and ozone (O3) concentration singly or in combination on plants reactive oxygen species (ROS) metabolism and anti-oxidative enzymes activities. 【Method】 Open-top chambers (OTCs) were utilized to investigate the change of lipid peroxidation extent, ROS production rate, content and anti-oxidative enzymes activities in spring wheat (Triticum aestivum L.) leaves under elevated CO2 and O3 concentration singly or in combination treatments. 【Result】 The results indicated that the elevated CO2 concentration at (550±20) μmol?mol-1 induced a decrease on relative electrical conductivity, content of malondialdehyde (MDA), superoxide anion ( ) production rate, hydrogen peroxide (H2O2) content and a increase on the activities of superoxide dismutase (SOD), catalase (CAT), peroxidase (POD), ascorbate peroxidase (APX) in spring wheat leaves during the whole growth stage. While the elevated O3 concentration at (80±10) nmol?mol-1 showed the opposite effects, which resulted in higher relative electrical conductivity, MDA content, production rate, H2O2 content and lower activities of SOD, CAT, POD, APX in spring wheat leaves compared with the control. But under the combined treatment of CO2 and O3 at concentration of (550±20) μmol?mol-1+(80±10) nmol?mol-1, MDA content, production rate, SOD activity were higher in general compared with the control. While relative electrical conductivity, H2O2 content and the activities of CAT, POD, APX increased in the leaves of spring wheat.【Conclusion】ROS metabolism rates are restrained and anti-oxidative enzymes are enhanced by elevated CO2 concentration, which presents protective efficacy on spring wheat. While elevated O3 concentration accelerates ROS metabolism rates and reduces anti-oxidative enzymes activities, which represents injured effects on spring wheat. In combination of elevated CO2 and O3 concentration, the beneficial effects of CO2 on spring wheat are more than compensating the negative effects imposed by O3 and the latter in its turn partly counteracted the positive effects on spring wheat of the former.

    Drought-Resistance Evaluation System of Maize Inbred

    Scientia Agricultura Sinica. 2009, 42(1):  72-84 .  doi:10.3864/j.issn.0578-1752.2009.01.009
    Abstract ( 1281 )   PDF (370KB) ( 1248 )   Save
    Related Articles | Metrics

    【Objective】 The present study was to choose drought-resistance indexes of maize in different growing period and establish a resistance evaluation system. 【Method】 Seven indexes were tested at seeding stage treated with different concentrations of solution PEG-6000, and twenty-four indexes were tested at growth stage treated with drought-stress and non-stress treatments in the PVC shed and drought shed.【Result】According to the results of simple relative analyses, nine indexes selected including germination drought resistance index of seed and relative germination energy under the condition of 20% PEG-6000 drought stress, GDRI and relative germination energy under the condition of 15% PEG-6000 drought stress, relative value of leaf water potential at seeding stage, leaf water conservation, kernel per row, axis weight per plant and 100-grain weight, they were correlated with drought resistance coefficient or drought resistance index at P≤0.05 and P≤0.01 level. Stepwise regression analysis was conducted between the relative value of nine indexes and drought resistance coefficient and drought resistance index. The result showed that relative germination energy under the condition of 20% PEG-6000 drought stress, relative value of leaf water potential at seeding stage, leaf water conservation, kernel per row and 100-grain weight significantly influenced the drought resistance. According to these indexes and partial relative coefficient, drought-resistance evaluation equation (D value) and evaluation system was established. 【Conclusion】 The five indexes could be selected as identification indexes for drought resistance in maize. Using D value equation to evaluate the drought resistance of maize is considered scientifically reliable.

    Correlation Analysis of Sugar Accumulation and SPS Expression in Sweet Sorghum (Sorghum bicolor L. Moench) Stems

    Scientia Agricultura Sinica. 2009, 42(1):  85-92 .  doi:10.3864/j.issn.0578-1752.2009.01.010
    Abstract ( 1512 )   PDF (685KB) ( 977 )   Save
    Related Articles | Metrics
    【Objective】Alcohol production by using sweet sorghum (Sorghum bicolor L. Moench) might be an alternative way to provide energy for the world. To better understand the mechanism of sucrose accumulation, the correlation between sucrose content and sucrose phosphate synthetase (SPS) expression was analyzed by monitoring the expression of SPS in leaves (source) and stems (sink). 【Method】 The expression of SPS, the key enzyme of sucrose synthesis in sorghum, was investigated by using Western blot. 【Result】 The results indicated that the sucrose content, the expression of SPS in leaves and stems increased along with the growth of sorghum, reached the highest level at grain filling stage, and decreased at dough stage. The correlation coefficient between sugar content in stems of sweet sorghum and SPS protein expression in leaves was 0.895, and the correlation coefficient was 0.781 as compared with SPS protein expression in stems. In comparison of sweet and normal sorghums, there was no visible difference of SPS expression in leaves, while the SPS expression level in stems of sweet sorghum was much higher than that in normal sorghum. 【Conclusion】Sucrose is the major component of sugar in sorghum, sucrose accumulation was correlated with the expression of SPS in leaves and stems. In sweet sorghum, sucrose accumulation is correlated with the expression of SPS in stems.
    Responses of Carbohydrate Metabolism to Nitrogen in Cotton Fiber Development and Its Relationships with Fiber Strength Formation
    Scientia Agricultura Sinica. 2009, 42(1):  93-102 .  doi:10.3864/j.issn.0578-1752.2009.01.011
    Abstract ( 1088 )   PDF (390KB) ( 1111 )   Save
    Related Articles | Metrics

    【Objective】 The aim of the experiment is to study the responses of carbohydrate metabolism to nitrogen application levels in cotton fiber development and its relationships with fiber strength formation. 【Method】 A field experiment was carried out in three nitrogen application levels: N0 (0 kg N?hm-2) as deficient application nitrogen level, N1(240 kgN?hm-2)as optimal nitrogen application level and N2 (480 kgN?hm-2) as high nitrogen application level, and cotton cultivar NuCOTN 33B (AC-33B) and Kemian 1 (KC-1) were used as materials. The study focused on the time course changes of the important matters (sucrose and β-1, 3-glucan) contents and the enzymes (sucrase, sucrose synthetase, sucrose phosphate synthetase and β-1, 3-glucanase, which were key enzymes in carbohydrate metabolism) activities in different nitrogen application levels. 【Result】 The 2-year experiment showed that under the optimal nitrogen application level, the sucrase activity was the highest, which bring abundant energy for carbohydrate metabolism in a long time. Sucrose synthetase and sucrose phosphate synthetase presented the highest activities, which lead to the greater decrease of sucrose content during the 5-24 DPA (Day Post Anthesis) and the greater increment of sucrose content during the 24-31DPA than in the two other nitrogen application levels. The total transformation rate of sucrose in cotton fibers during whole boll age was the highest. The β-1, 3-glucanase activity was the highest that made β-1, 3-glucan transformation rate high. The changes of which mentined above could result in a longer period and more tempered cellulose accumulation process, which was benefit to higher strength fiber formation. While under the deficient nitrogen application level, the carbohydrate metabolism process presented the opposition changes as in the preceding nitrogen application level, and this deteriorated cellulose accumulation led to low strength fiber formation. Lastly, things operated in the high application nitrogen level were between those in the optimal nitrogen application level and in the deficient nitrogen application level. 【Conclusion】 There were notable differences in carbohydrate metabolism among the three nitrogen application levels in cotton fiber development, and these differences were important factors causing the variety in fiber strength development. Under the optimal nitrogen application level, the enzymes activities and the chief matters were preferably accommodated in the fiber development and these could beneficial to high strength fiber formation.

    PLANT PROTECTION
    Mechanism and Inheritance of Resistance to Rice Stripe Disease in the japonica Rice Cultivar Zhendao 88

    Scientia Agricultura Sinica. 2009, 42(1):  103-109 .  doi:10.3864/j.issn.0578-1752.2009.01.012
    Abstract ( 1236 )   PDF (444KB) ( 706 )   Save
    Related Articles | Metrics

    【Objective】 The objective of this experiment was to analyze the resistance mechanism and resistance genetic model to rice stripe disease in Zhendao 88, and to screen the SSR marker related to the gene of rice stripe disease resistance in Zhendao 88. 【Method】The resistance to rice stripe virus (RSV) and the vector, small brown planthopper (SBPH) (Laodelphax striatellus Fallèn) was analyzed in Zhendao 88 by using the method of tiller inoculation, inoculation at the seeding stage, non-preference test and antibiosis test. The inheritance of rice stripe disease resistance in F2 lines and F2:3 lines from the cross Zhendao 88/ Wuyujing No. 3 was studied by using tiller inoculation and inoculation at the seeding stage, respectively. The resistance gene was mapped based on SSR analysis.【Result】 Zhendao 88 was highly resistant to rice stripe virus and weakly resistant to vector. Genetic analysis indicated that the resistance to rice stripe disease in Zhendao 88 was inherited as a single dominant trait. The rice stripe disease resistance gene in Zhendao 88 was located on the chromosome 11, with the distance of 4.7cM from a SSR marker RM229. 【Conclusion】 The rice stripe disease resistance in Zhendao 88 was mainly derived from the resistance to virus and controlled by a single major gene. The breeding process for rice stripe disease resistance should be accelerated by using Zhendao 88 as a resistance parent.

    Cloning and Characterization of a Pathogenesis Related Protein Gene TaPR10 from Wheat Induced by Stripe Rust Pathogen
    Scientia Agricultura Sinica. 2009, 42(1):  110-116 .  doi:10.3864/j.issn.0578-1752.2009.01.013
    Abstract ( 1595 )   PDF (558KB) ( 912 )   Save
    Related Articles | Metrics

    【Objective】 A stripe rust pathogen induced PR10 gene from wheat was isolated to better understand adult wheat resistance response. 【Method】In silico cloning and RT-PCR techniques were performed to isolate a PR10 gene in wheat induced by stripe rust pathogen. Its DNA sequence structure and conserved domain of encoding protein with basic properties were determined using bioinformatics analysis. The expression patterns of the gene during adult and seedling stage of wheat infected by stripe rust pathogen were investigated using real time quantitative RT-PCR. 【Result】 The PR10 gene designated as TaPR10 was obtained from wheat inoculated with stripe rust pathogen. Open reading frame (ORF) of TaPR10 was 483bp in length, encoding 160 amino acids containing one typical conserved domain of pathogenesis related protein Bet_v_I family, and other four kinds of conserved motifs. TaPR10, without trans-membrane domain or signal peptide sequences, was predicted to locate in cytosol. Multiple alignment analysis based on the amino acids encoded by different PR10 genes from Maize (Zea mays), rice (Oryza sativa), broomcorn (Sorghum bicolor) and wheat (Triticum aestivum) indicated that PR10 was conserved among the four species of plants with about 80% of sequence similarity. DNA sequence of TaPR10 showed that it contained one 84 bp intron with the splicing sites of GT-AT bi-nucleotide sequence between 188 bp and 271 bp. Expression pattern results revealed that TaPR10 was up regulated in both of adult and seedling stages. However, expression in adult stage was higher than that of seedling stage. 【Conclusion】 Gene TaPR10 was firstly isolated and characterized from wheat infected by stripe rust pathogen, which may participate in defense response of adult wheat resistance to stripe rust pathogen.

    Involvement of the Heterotrimeric G Protein in the Defense Responses of Wheat to Puccinia triticina

    Scientia Agricultura Sinica. 2009, 42(1):  117-123 .  doi:10.3864/j.issn.0578-1752.2009.01.014
    Abstract ( 1115 )   PDF (427KB) ( 883 )   Save
    Related Articles | Metrics
    【Objective】 The objective of the paper is to investigate if the heterotrimeric G protein is involved in the defense responses of wheat to Puccinia triticina. 【Method】 After 24h of treating the detached-leaf with the regulators of heterotrimeric G protein (activator and inhibitor), the infection types at the 9th day were evaluated by inoculating Puccinia triticina. The activities of defensive enzymes POD (peroxidase), PAL (phenylalanine ammonia lyase), and PPO (polyphenoloxidase) were tested after the leaves induced by the regulators of heterotrimeric G protein. In addition, the expression of the heterotrimeric G protein α subunit gene was evaluated by semi-quantitative RT-PCR after inoculating the virulent race and avirulent race, respectively. 【Result】 The activators delayed the disease occurrence, however the inhibtor had no effect on the development of wheat leaf rust. The activity of defensive enzymes was enhanced after treating with activators GTPγS and Mastoparan-7. Inhibitor PTX (pertussis toxin) inhibited the enhancement of defensive enzymes induced by the avirulent race. The avirulent race enhanced the expresstion of the heterotrimeric G protein α subunit gene, but virulent race inhibited its expression. 【Conclusion】 The results suggest that G protein may play a role in the resistance to Puccinia triticina.
    A SCAR Marker for Leaf Rust Resistance Gene Lr45
    Scientia Agricultura Sinica. 2009, 42(1):  124-129 .  doi:10.3864/j.issn.0578-1752.2009.01.015
    Abstract ( 1155 )   PDF (375KB) ( 862 )   Save
    Related Articles | Metrics

    【Objective】 The objective was to develop a SCAR(sequenced characterized amplified region) marker for wheat leaf rust resistance gene Lr45. 【Method】 Wheat leaf rust resistance near isogenic lines of TcLr45 and its susceptible control Thatcher were employed. PCR was carried out with the OPH20, which is a specific RAPD primer of rye. The amplified 1.5kb fragment from TcLr45 was cloned and sequenced. Subsequently a pair of specific primers (LRYR, LRYF) were designed for the amplifying F2 population derived from TcLr45×Thatcher, and then linkage was analyzed between the marker and Lr45. 【Result】 A unique band was obtained only in TcLr45 with a length of 1 272 bp. And the marker was named as Ypsc20H1272. The linkage distance of the SCAR marker with Lr45 was 8.2 cM.【Conclusion】 The RAPD marker was successfully converted into a SCAR marker for Lr45.

    Parasitism and Pathogenicity of Radopholus similis to Nicotiana tabacum and Mangifera indica
    Scientia Agricultura Sinica. 2009, 42(1):  130-135 .  doi:10.3864/j.issn.0578-1752.2009.01.016
    Abstract ( 1241 )   PDF (268KB) ( 1201 )   Save
    Related Articles | Metrics

    【Objective】 Study on the parasitism and pathogenicity of ten populations of Radopholus similis intercepted from different imported host plants and reproduced on carrot callus to Nicotiana tabacum and Mangifera indica. 【Method】 Research on the parasitism and pathogenicity of the R.similis populations was proformed by a pot trial in greenhouse. 【Result】 A lot of R. similis were recovered from the roots and media of Nicotiana tabacum and Mangifera indica, indicating that the reproductive factor of R. similis were over one on these plants. The Nicotiana tabacum and Mangifera indica inoculated with R. similis grew slowly and smaller than the plant without inoculation of R. similis. Obvious symptoms were observed on the roots that became faint, chlorotic and rot. 【Conclusion】 The Nicotiana tabacum and Mangifera indica are new good hosts for R. similis. The R. similis have obvious pathogenicity to the two plants, and there are differences in pathogenicity among populations.

    Optimization of Enzyme Protectant of Chlorpyifos-Biodegradation Fungi and Its Stability

    Scientia Agricultura Sinica. 2009, 42(1):  136-144 .  doi:10.3864/j.issn.0578-1752.2009.01.017
    Abstract ( 1226 )   PDF (346KB) ( 950 )   Save
    Related Articles | Metrics

    【Objective】The objective of this study was to optimize the composition of enzyme protectant of chlorpyifos- biodegradation fungi and determine its stability.【Method】Based on the screening of chlorpyrifos biodegrading fungal strain, Cladosporium cladosporioides (the ID of fungi preservation CCTCCM207111. Accession number of ITS sequence analysis Genebank EF405864), extracellular enzymes were extracted. Applying the composite rotatable design, a model of the optimal mixture protect agents was established. After the optimal composition was validated, the enzyme preparation storage experiment was tested to determine the stability of biodegradation by high performance liquid chromatography analysis. 【Result】 The results showed that the optimal composition was 0.70% NaCl, 0.35% glycine, 0.03% sodium benzoate, 0.17% Cosmetic, and 8.38% glycerol. When 9.90 mg?L-1 of final concentration of emzyme protein was added into the 50 mg?L-1 of chlorpyrifos, results of HPLC analysis after biodegradation 10 min indicated that the degradation rate of the enzyme preparations was more than 80% after storage 5 months under the temperature from 20℃ to 50℃and the light almost has no effect on the degradation rate. 【Conclusion】 It is concluded that an economical and stable enzymic protectant of chlorpyifos-biodegradation fungi is got, which has provided a foundation for commercial production of enzymic preparation in dealing with pesticide residues of agricultural products.

    An Experimental Case of Safety Assessment of Weediness of Transgenic Glyphosate-Resistant Soybean (Glycine mac (L.) Merri)

    Scientia Agricultura Sinica. 2009, 42(1):  145-153 .  doi:10.3864/j.issn.0578-1752.2009.01.018
    Abstract ( 1186 )   PDF (332KB) ( 963 )   Save
    Related Articles | Metrics

    【Objective】 To assess the potential ecological risk for weediness of transgenic soybean 40-3-2, which was introduced as production raw material for edible oil, and to verify the operation of clauses for weediness assessment of transgenic soybean in China. 【Method】 In the field, the surviving competition ability (including germination rate, plant height, leaf number), reproducing ability (the number of flowers, legumes, and seeds per plant), volunteer possibility, seed shattering and persisting possibility of transgenic glyphosate-resistant soybean 40-3-2, recipient variety and conventional soybean varieties were comparatively evaluated. 【Result】 The surviving competition ability of transgenic glyphosate-resistant soybean was less than that of conventional soybean variety which was similar with that of recipient soybean in appropriate season. However, the surviving competition ability of three soybean varieties was similar in appropriate season. The number of flowers was also similar among the three varieties in appropiate season, but the number of legumes and seeds per plant of transgenic glyphosate-resistant soybean and recipient soybean were less than that of conventional soybean variety in appropriate season. The number of flowers, legumes and seeds per plant of conventional soybean variety were a little bit less than that of transgenic glyphosate-resistant soybean and recipient soybean in unfavorable one. The seed shattering and persisting ability of all experimental soybean varieties were weak. And no volunteer plant was observed in experimental period. 【Conclusion】 It is concluded that the transgenic glyphosate-resistant soybean from Monsanto Company had lowest potential weediness when it was planted or was imported as production raw materials for edible oil in Nanjing, China. It was verified that the items on weediness in the evaluation standard of environmental safety are practical through the field trial.

    SOIL & FERTILIZER·WATER-SAVING IRRIGATION·AGROECOLOGY & ENVIRONMENT
    Modeling the Impacts of Soil Organic Carbon Content of Croplands on Crop Yields in China

    Scientia Agricultura Sinica. 2009, 42(1):  154-161 .  doi:10.3864/j.issn.0578-1752.2009.01.019
    Abstract ( 1557 )   PDF (276KB) ( 2199 )   Save
    Related Articles | Metrics

    【Objective】 The objective of this study was to quantify the impacts of soil organic carbon (SOC) content on grain yield of crops. 【Method】 A biogeochemical model (DNDC) was used in the study. Data on climate, soil properties, and farming management regimes of cropping systems were collected from six typical agricultural zones (Northeast, North, Northwest, Mid-South, East and Southwest regions of China, respectively) and integrated into a GIS database to support the model runs. 【Result】 According to the model, if the initial SOC content in the cropland was increased by 1 g C?kg-1, the crop yield may be increased by 176 kg?hm-2 for maize in the Northeast region, 454 kg?hm-2 for a maize and wheat rotation in the North region, 328 kg?hm-2 for maize in the Northwest region, 185 kg?hm-2 for single-rice in the Midsouth region, 266 kg?hm-2 for double- rice in East region, and 229 kg?hm-2 for rice and wheat rotation in Southwest region. 【Conclusion】There is a great potential for enhancing the crop yield by improving the SOC content in cropland in each region of China.

    Advances in Study on Mechanism of Foliar Nutrition and Development of Foliar Fertilizer Application

    Scientia Agricultura Sinica. 2009, 42(1):  162-172 .  doi:10.3864/j.issn.0578-1752.2009.01.020
    Abstract ( 1974 )   PDF (344KB) ( 3096 )   Save
    Related Articles | Metrics

    Advances in study of mechanisms of foliar nutrition and foliar fertilizer application were reviewed. Plant leaves can absorb nutrients as roots do. There are two basic pathways for nutrients entering into the plant tissue: one is through the stomata and the other is via cuticle hydrophilic pores. Some plant leaves also can absorb nutrients actively through plasmodesmata. So the foliar uptake of nutrients depends upon plant types and the state of plants growth, composition of foliar fertilizer, characters of nutrients and environmental factors such as temperature, illumination and so on. Foliar application to dicotyledon is better than to monocotyledon because of different leaf types and structures of surface wax, and of different varietals plants of homogeneity. It is necessary to spray right fertilizers at right stage of plant growth. Some assistants, such as surfactants are required to enhance nutrients absorption in foliar fertilizers, however, most of the surfactants have a poor solubility among compositions of foliar fertilizers as they are pesticides surfactants. The development of foliar application was promoted by the research on mechanism of foliar nutrition, and now foliar application is becoming an important fertilization method. But soil application can not be replaced by foliar application of fertilizers. Foliar spray can be only as an efficiency assistant method to soil application because the quantity of nutrients supplied is limited. In recent years, foliar fertilizers developed promptly both in quantity and variety, but the quality is poor in China. So the techniques of foliar application need to be improved. Scientists should intensify their research on the mechanism of foliar nutrition and the utilization of assistants in foliar fertilizers. In future, it is necessary to enhance the quality of foliar fertilizers and foliar fertilization, study on optimization of specialized foliar fertilizers and the techniques of foliar application.

    Effect of Irrigation Method on Yield and Quality of Flue-cured Tobacco Under Different Fertilization Levels
    Scientia Agricultura Sinica. 2009, 42(1):  173-179 .  doi:10.3864/j.issn.0578-1752.2009.01.021
    Abstract ( 1146 )   PDF (254KB) ( 865 )   Save
    Related Articles | Metrics

    【Objective】 A field experiment was conducted to investigate the effect of irrigation method on yield and quality of flue-cured tobacco under different fertilization levels. 【Method】 Two fertilization levels were designed in field experiment, i.e. lower fertilization and higher fertilization, and three irrigation methods, i.e., conventional furrow irrigation (CF), fixed furrow irrigation (FFI) and alternate furrow irrigation (AFI). Yield and chemical component contents of flue-cured tobacco were measured. 【Result】 Results show that compared to CF treatment, FFI and AFI treatment reduced irrigation water by 40%. Under lower and higher fertilization levels, AFI treatment increased yield and yield per unit fertilizer of flue-cured tobacco by 7.8% and 8.5%, 7.9% and 8.6%; but FFI treatment reduced by 0.4% and 1.7%, 0.5% and 1.8 %, respectively, when compared to the CF treatment. At the same time, AFI treatment enhanced total sugar, reducing sugar, N, K and protein contents by 4.0% and 4.0%, 1.9% and 6.6%, 3.8% and 5.0%, 23.8% and 40.1%, 2.2% and 9.7%, but reduced nicotine and chlorine contents by 7.4% and 22.8%, 4.8% and 7.1%, respectively under lower and higher fertilization levels. 【Conclusion】 The above-mentioned results indicate that AFI not only saved irrigation water, but also enhanced the yield and improved leaf quality of flue-cured tobacco. And the effect of AFI should be better materialized under appropriate fertilization.

    Research on Chinese Future Grain Security Based on the Method of EMD
    Scientia Agricultura Sinica. 2009, 42(1):  180-188 .  doi:10.3864/j.issn.0578-1752.2009.01.022
    Abstract ( 1340 )   PDF (481KB) ( 887 )   Save
    Related Articles | Metrics

    【Objective】 Grain security problem is the first importance for our government to solve. The rapid increase of future population and food consumption coupled with a decrease of total cultivated land at a rather greater speed in recent years will badly affect the safety of grain security in our country. 【Method】 In this paper, Empirical Mode Decomposition (EMD) method was introduced to study the fluctuation of grain output and cultivated land and their causes at multi-time scale from 1949 to 2006, then a dynamical model is established to predict the grain tendency production and cultivated land change in the next 30 years, through which the future grain security based on population development and cultivated land change was analyzed. 【Result】 The results of study are as follows: (1) The fluctuations of grain output have 3.6-year, 9.6-year and 14.5-year time scales and fluctuation of the 9.6-year time scale is more prominent. Cultivated land mainly has a 14.5-year time scale. (2) Shown from the residual trend term of grain output, till the people-estimated peak of population of 2030, the grain output can satisfy the requirement of 1.49 billion people at a per capita consumption of 400-470 kg grain. However, grain output of 1010 kg every ten years should be increased and a great effort should be made and to expand the potentials of grain production, which will be disadvantageous to the sustainable development of future agriculture. (3) Shown from the residual trend term of cultivated land, when the productivity per hectare increased to 5008-5133, 5598-5798 and 6439-6725 kg in 2010, 2020 and 2030, and the same proportion of grain planting is always kept, the grain production based on cultivated land can absolutely ensure 95% self-sufficiency goal brought forward by the white book 《Food Issue in China》. However, further increase in per capita grain occupancy is not optimistic, due to the restriction of limited arable cultivated land resources. 【Conclusion】 The foreground of future grain security in our country is not optimistic. From the correlation between population, farmland and grain output, we must strictly control the population growth, increase the quality and utilization rate of total farmland and encourage scientific technology to improve the cultivated land productivity.

    HORTICULTURE

    Relationship Between the Ploidy Level of Microspore-Derived Plants and the Number of Chloroplast in Stomatal Guard Cells in Brassica oleracea

    Scientia Agricultura Sinica. 2009, 42(1):  189-197 .  doi:10.3864/j.issn.0578-1752.2009.01.023
    Abstract ( 1354 )   PDF (408KB) ( 1147 )   Save
    Related Articles | Metrics

    【Objective】 The relationship between the ploidy level of microspore-derived plants and chloroplast number in stomatal guard cells was studied in cabbage, broccoli and Chinese kale. 【Method】 Distribution statistics analysis and t-test were used to perform statistical analysis on chloroplast number of different ploidy levels in those stomatal guard cells mentioned above, and morphology identifying and chromosome counting were used to test accuracy of counting chloroplast number in stomatal guard cells. 【Result】 The chloroplast average number in stomatal guard cells was very similar among the different leaf positions on the same plant and among the different locations in the same leaf, while the chloroplast number varied significantly among the different ploidy stoma in the same variety. All the distributions of the chloroplast number in different ploidy stoma were normal distribution fitted. A correlation has been established between ploidy and chloroplast number in the stomatal guard cells. In every single stoma of microspore-derived plants, the chloroplast number for a haploid should not be more than 10, that for diploids should be 11 to 15, and polyploids should be more than 15. The accuracy of this method for identification of different ploidy plants was 93.93%. Further more, the accuracy of this method was reliable and did not vary with the plants growth conditions. 【Conclusion】 Therefore, the chromosome ploidy of plants derived from microspore culture in cabbage, broccoli and Chinese kale can be identified by simply counting the chloroplast number in stomatal guard cells.

    Comprehensive Evaluation of Potato Bruises in Different Genotypes
    Li ping Jin
    Scientia Agricultura Sinica. 2009, 42(1):  198-203 .  doi:10.3864/j.issn.0578-1752.2009.01.024
    Abstract ( 1088 )   PDF (278KB) ( 1267 )   Save
    Related Articles | Metrics

    【Objective】 The objective of the experiment was to obtain some bruise-tolerant potato genotypes for the bruising-related research. 【Method】 One hundred and four potato genotypes were used to assess their bruises by analyzing skinning, internal bruise and browning by Principle Component Analysis (PCA), Multivariate Analysis of Variance (MAOVA) and cluster analysis. 【Result】 The vector of principle component was skinning>internal bruise>browning in PCA of three bruises while 104 potato genotypes can be clustered into six clusters with prominent difference. 【Conclusion】 The importance of three bruises for tuber was skinning (SK)>internal bruise (IB)>browning (BR). Some genotypes with good integrative bruise tolerance were obtained. The result can simplify bruising problem and provide basic materials for further research.

    Effect of Rotation and Interplanting on Cucumber Yield and Soil Microbial Diversity
    Scientia Agricultura Sinica. 2009, 42(1):  209-209 . 
    Abstract ( 1103 )   PDF (477KB) ( 1248 )   Save
    Related Articles | Metrics

    【Objective】 The objective of the experiment is to study the effect of rotation and interplanting on microbial community diversity in different growth periods and cucumber yield. 【Method】 RAPD techniques were adopted as research methods. 【Result】 Wheat-soybean rotation significantly improved the cucumber microbial DNA sequence diversity index (P<0.05), and significantly increased yield of cucumber (P<0.01).Compared to control, onion interplanting treatment also significantly increased cucumber microbial DNA sequence diversity index and yield of cucumber (P<0.01).【Conclusion】 Wheat-soybean rotation and garlic interplanting could facilitate improving soil micro-ecological environment and increase the yield of cucumber.

    Effect of Photoperiod Treatments on Dormancy Induction and Changes of Correlated Respiratory Rate of Nectarine Peach Bud
    Jin LI,Dong-sheng GAO,Qin YU,Chen-shan XU,Kai ZHAO
    Scientia Agricultura Sinica. 2009, 42(1):  210-215 .  doi:10.3864/j.issn.0578-1752.2009.01.026
    Abstract ( 1577 )   PDF (225KB) ( 975 )   Save
    Related Articles | Metrics

    【Objective】 The responses of dormancy induction to illumination and the character of respiratory rate were studied with the nectarine peach bud in this paper. 【Method】 The trial was conducted with nectarine peach (Prunus persica var. nectariana cv. Shuguang ) and involved three treatments: a short day treatment (8 h), a long day treatment (16 h) and normal condition as control. The dormancy status were determined with the growth of shoot and the sprouting ability, and respiratory rate was mensurated with oxygen electrode. 【Result】 Short day treatment induced the growth stopping of peach shoots ahead of time, promoted the development of dormancy, and induced buds into dormancy 21 days earlier compared with the control. Long day treatment postponed the growth stopping and the induction and development of dormancy. The respiratory rate decreased according to the development of dormancy induction. The minimum respiratory rate appeared about 7 d after the start of of dormancy induction. Bud respriatiory rate increased during this period and then declined and remained at low level at dormancy period. Long day treatment reduced buds respiratory slightly.【Conclusion】 Short day could induce dormancy obviously, and long day postponed dormancy induction. The changes of respiratory rate were correlated with the development of dormancy induction, and the rate of bud respiratory was also affected by photoperiod.

    Contents and Changes of Organic Acid in Sand Pears from Different Germplasm Resources
    Scientia Agricultura Sinica. 2009, 42(1):  216-223 .  doi:10.3864/j.issn.0578-1752.2009.01.027
    Abstract ( 1271 )   PDF (304KB) ( 1184 )   Save
    Related Articles | Metrics

    【Objective】 The characteristics of soluble sugar content of 70 varieties of sand pear mature fruit (including 47 local species and 23 cultivars) and the dynamic changes during the fruit development period (4 varieties) were studied and the differences and characteristics among sand pear varieties were compared. 【Method】Capillary GC-FID was used to detect the constitution of soluble sugar in sand pears. 【Result】 The major parts of organic acids in sand pears are malic acid and citric acid, which induce two types, malic acid dominant and citric acid dominant. The content of malic acid ranges from 1.30 mg?ml-1 to 4.16 mg?ml-1, with a mean value of 2.32 mg?ml-1. Compared with the local cultivars, the extent of variation is narrower and the quantity is bigger in cultivars. Citric acid ranges from 0.43 mg?ml-1 to 6.20 mg?ml-1, with a mean of 2.03 mg?ml-1; on the contrary, the concentration in cultivars is lower than that in local cultivars. Quinic acid in mature sand pears is as low as 0.74 mg?ml-1 (mean), with no difference between cultivars and local ones. The total content of organic acids in sand pear fruits is coming down with the development of fruit. Especially, the quinic acid drops significantly in any breed. The accumulation process of malic acid shows a parabola-like rise-and-fall motif. In the two kinds of acid dominant breeds being investigated, the content of citric acid remains low in early development. In citric acid dominant breeds, the content of citric deposits rapidly in 8 weeks after blossom fall, while in malic acid dominant breeds, it keeps in a low concentration, both of the two kinds of breeds have a great content diversity during fruit maturation.【Conclusion】There are two types of sand pears, malic acid dominant and citric acid dominant. Almost exclusively, cultivars are malic acid dominant, while local cultivars are citric acid dominant. The concentration of citric acid rises when that of malic acid drops.

    STORAGE·FRESH-KEEPING·PROCESSING
    Effect of Microwave on Paddy Quality
    Scientia Agricultura Sinica. 2009, 42(1):  224-229 .  doi:10.3864/j.issn.0578-1752.2009.01.028
    Abstract ( 1117 )   PDF (261KB) ( 1382 )   Save
    Related Articles | Metrics

    【Objective】 The effects of microwave radiation on paddy milling quality, storage quality and edible quality were investigated. The objective was to provide optimal process conditions for the industrial application of microwaves to improve the quality of paddy. 【Method】A microwave oven with 2 450 MHz was used to irradiate the paddy, the paddy milling quality, storage quality and edible quality were tested at different microwave doses and times. 【Result】 Paddy temperature increased as energy consumption rose, the velocity constant of temperature rising decreased as the microwave dose decreased. At the suitable microwave energy conditions, brown rice recovery, head yield increased and kernel cracking, broken yield were slightly influenced, the water content and free fatty acid content reduced, and water-soluble protein content and starch were changed. 【Conclusion】 The microwave conditions can influence the paddy quality actively, the suitable microwave conditions could improve the milled quality, raise the edible quality and enhance the stability of rice storage.

    A Solution on Pork Quality Safety Production Traceability from Farm to Dining Table——Taking Tianjin City as an Example
    Scientia Agricultura Sinica. 2009, 42(1):  230-237 .  doi:10.3864/j.issn.0578-1752.2009.01.029
    Abstract ( 1544 )   PDF (526KB) ( 1497 )   Save
    Related Articles | Metrics

    【Objective】 The study was made to meet government supervision of safe pork production as well as consumer's right to know what they will buy and to protect the public safety of pork food.【Method】This study adopted animal identification, intelligent PDA reading and writing, GPRS, intranet and internet and other information technologies, and proposed a pork tracking and traceability infarstructure based on pork production substrance flow and data flow, and designed the metadata and related databases for farming and slaughtering as well as retailing sector based on pigs intensive farming and backyard farming,and developed three different data-recording systems for different production processes, and finally formed a public network platform for inquiring in light of China's "Animal Identification and Animal Feeding File Management Approach". 【Result】 The farming process information system supplies early warning for the usage of drugs and feed additives on the basis of data of pigs individual and timely uploading all events data to remote central tracing database when pigs are sold. The PDA data acquisition system can collect farming events data for those pigs owned by farmers by mobile and submitted them to the oriented database through GPRS. The web-based Tianjin’s pork traceability platform can integrate the whole labeling and related pork quality data from farming, slaughtering to marketing by online, and set up these data inner relationships, and reached pork tracking from its origin to consumption and its tracing through turn-over direction. 【Conclusion】The developed and/or integrated various identification technologies, designed metadata specifications, three data-recording systems and the formed web-inquiring platform are feasible in pork quality traceability. Some individual technical bottlenecks will be resolved with the development of communication technology. The full implementation of this solution will supply technical support in guarantee of the quality and safety of pork production supervision and meet consumers’ demand.

    Antioxidant Activity and the Possible Mode of Action of Bone Protein Hydrolysates
    Scientia Agricultura Sinica. 2009, 42(1):  238-244 .  doi:10.3864/j.issn.0578-1752.2009.01.030
    Abstract ( 1071 )   PDF (323KB) ( 1362 )   Save
    Related Articles | Metrics

    【Objective】 Antioxidant activity of bone protein hydrolysates and mode of antioxidative action were studied in this paper. 【Method】Bone protein was hydrolyzed for 0.5-6 h by alcalase. The mode of antioxidative action was evaluated by reducing power, metal-chelation ability and radical-scavenging. 【Result】 Bone protein hydrolysates possessed strong Cu2+- and Fe2+-chelation ability and marked reducing power, both of which were increased with hydrolysis time. The protein hydrolysates also showed strong radical-scavenging ability, and the antioxidant activity increased with substrate concentration. The antioxidant activity of 7% alcalase-hydrolyzed bone protein was comparable to those of butylated hydroxyanisole and proply gallate, and its antioxidant activity was close to proply gallate. Although intact bone protein displayed an antioxidative effect, it was far less potent than hydrolyzed bone protein. 【Conclusion】 The results demonstrated that enzyme-hydrolyzed bone protein can act as a metal ion chelator, a hydrogen donor, as well as a radical stabilizer to inhibit lipid oxidation.

    Effects of Acetaldehyde Treatment at Different Concentrations on Softening of Post-Harvest Peach and Some Related Physiological Metabolism

    Scientia Agricultura Sinica. 2009, 42(1):  245-250 .  doi:10.3864/j.issn.0578-1752.2009.01.031
    Abstract ( 1011 )   PDF (448KB) ( 748 )   Save
    Related Articles | Metrics

    【Objective】 The effect of acetaldehyde treatment on softening of postharvest ‘Okubo’ peach (Prunus persica L.) was investigated.【Method】 The peaches were fumigated with 0, 0.5, 1 and 2 ml?kg-1 acetaldehyde for 12 hours, then stored at room temperature (20±2)℃or (0±2)℃. The changes of firmness and related enzymes in fruits were detected.【Result】 At 20℃, the activities of PG (polygalacturonase) in 0.5 ml?kg-1 and 2 ml?kg-1 treatments were lower than those in control and 1 ml?kg-1 treatment, and all of the treatments trended to increase PE (pectin esterase) and decrease β-galactosidase activities. At 0℃, the activities of PG and PE in acetaldehyde treatments showed no obvious differences with control, and the β-galactosidase activities in 1 ml?kg-1 and 2 ml?kg-1 treatments were higher than control and 0.5 ml?kg-1 treatment with no significant differences.【Conclusion】The result showed that acetaldehyde treatments at suitable concentration maintained the higher firmnesses, lower respiration rates and decreased the contents of water-soluble pectin both at room temperature (20±2)℃ and (0±2)℃, respectively.

    Relationship Between Starch Pasting, Amylose Content and Starch Granule Size in Different Chinese Chestnut Variety Groups

    Scientia Agricultura Sinica. 2009, 42(1):  251-260 .  doi:10.3864/j.issn.0578-1752.2009.01.032
    Abstract ( 1264 )   PDF (341KB) ( 2189 )   Save
    Related Articles | Metrics

    【Objective】 Thirty-three Chinese chestnut varieties collected from three variety groups were used to test starch pasting properties, starch granule size and starch content to analyze the relationship between them and make cluster analysis according to amylose content and peak viscosity among these varieties. 【Method】 Pasting characteristics of defatted chestnut starches were determined using Rapid Viscosity Analyzer (RVA); Starch granule size was determined using S3500 Laser Granularity Analyzer; All statistical procedures were performed according to SPSS. 【Result】 Differences were found among RVA eigenvalues in different starch of chestnut. The average of peak viscosity, through viscosity, final viscosity and breakdown in north variety group (NVG) were higher than that of others; the setback, the peak time and the pasting temperature were significantly lower than that of mid-type variety group (MVG) and south variety group (SVG). There were differences between starch and amylose content among different chestnut varieties. The starch content of NVG was significantly lower than that of MVG and SVG while the amylose content of SVG was the highest. Significant differences were found in starch granule size among different chestnut varieties’ starch. The granule size has very close relationship with variety and with obvious character of location distributing. The average granule size has a significant correlation with peak viscosity, while other eigenvalues were based on the varieties to appear correlations with granule size. 【Conclusion】 The cluster analysis divided the 33 varieties to 4 parts: NVG were featured with low amylose content and high peak viscosity; SVG were featured with high amylose and low peak viscosity; some of MVG were similar with NVG and some similar with SVG. So, the amylose content and peak viscosity can be used as the index to measure the waxy quality of chestnut.

    ANIMAL SCIENCE·RESOURCE INSECT
    Effects of Flaxseed Lignans on the Growth of Skeletal Muscle of Male Rats and Its Possible Mechanism

    Scientia Agricultura Sinica. 2009, 42(1):  261-266 .  doi:10.3864/j.issn.0578-1752.2009.01.033
    Abstract ( 1372 )   PDF (404KB) ( 1229 )   Save
    Related Articles | Metrics

    【Objective】 To determine whether flaxseed lignans could affect the growth of skeletal muscle in male animals and its possible mechanisms. 【Method】 The effect of the flaxseed lignans on skeletal muscle in male rats were determined in vivo. Daidzein (5 mg?kg-1) and flaxseed lignans (50 mg?kg-1) were added into the basal diets, respectively, and the concentrations of the serum lignans and daidzein were measured by HPLC, serum growth hormone and testosterone (T) levels were analyzed by RIA, and the expression of estrogen receptor β (ERβ) in the soleus muscle and hypothalamus were determined by RT-PCR. 【Result】 Flaxseed lignans and daidzein significantly improved the feed efficiency and increased the total weight gain of the femoral muscle in male rats. The rate of RNA to DNA in muscles and serum T levels were remarkably increased, while the urea nitrogen concentrations were significantly decreased by daidzein and flaxseed lignan and/or its metabolites. Meanwhile the expression of estrogen receptorβ (ERβ) in soleus muscle and hypothalamus were both upgraded by the two phytoestrogens. 【Conclusion】 Flaxseed lignan promoted the growth of male rats, and it may regulate serum T levels through binding to ER β in hypothalamus. In turn, it depressed the catabolism of protein and promoted the hypertrophy of skeletal muscle cells.

    Cloning, Mapping and Tissue Expression Profile of Porcine TAF7 Gene
    Scientia Agricultura Sinica. 2009, 42(1):  267-273 .  doi:10.3864/j.issn.0578-1752.2009.01.034
    Abstract ( 1175 )   PDF (587KB) ( 719 )   Save
    Related Articles | Metrics

    【Objective】 The objective is to illuminate the molecular features and the expression profile of the porcine TAF7 (TBP-associated factor; TBP is a TATA-binding protein) gene. As one component of the transcriptional pre-initiation complex, the protein TAF7 plays an important role during regulation of the gene expression. 【Method】The porcine TAF7 gene from the Wuzhishan pig sample was cloned and sequenced, and then its molecular features were analyzed. Mapping of the porcine TAF7 gene to porcine chromosome was made with the IMpRH panel. The mRNA distribution profile of the porcine TAF7 gene in sixteen adult Wuzhishan pig tissues (heart, dorsal muscles, lymph nodes, spleen, liver, kidney, lung, uterus, testicle, stomach, small and large intestine, ovaries, thymus gland, brain and fat) were examined by semi-quantitative RT-PCR. 【Result】 A sequence with a length of 1 701 bp was cloned, it contained the CDS (coding sequence) region of 1 050 bp of the porcine TAF7 gene. Analysis of the network software GENSCAN showed that the porcine TAF7 gene encoded a protein composed of 349 AAs. By the IMpRH (the INRA-University of Minnesota porcine radiation hybrid) panel, porcine TAF7 gene was assigned to porcine chromosome 2, associated with SW1879 and IL4 (interleukin-4) closely, the LODs (Limit of Detection) were 6.69 and 6.15, respectively. The mRNA distribution of the porcine TAF7 gene was that it was expressed almost in all tissues, especially highly expressed in testicle and could hardly be examined in heart and dorsal muscles. 【Conclusion】 The porcine TAF7 gene has an small intron in the 5’UTR, but the CDS is intronless. The sequence of the porcine protein TAF7 shares high similarity with its homolog from human, and they both are closed in the Phylogenetic tree. The porcine TAF7 gene can be detected almost in all tissues, which shows us its extensive functions for transcription. Furthermore, the phenomenon of highly expressed in testicle needs further research.

    Analysis of the Association Between Polymorphisms of HB-EGF Gene and Litter Size in Pigs
    Scientia Agricultura Sinica. 2009, 42(1):  274-282 .  doi:10.3864/j.issn.0578-1752.2009.01.035
    Abstract ( 1494 )   PDF (572KB) ( 897 )   Save
    Related Articles | Metrics

    【Objective】 The pig HB-EGF gene was used to study the polymorphism, and the association between the polymorphism and litter size was analyzed in order to find the molecular marker being used in marker-assisted selection(MAS) to accelerate the swine breeding progress. 【Method】 The polymorphism of HB-EGF gene was studied by PCR-SSCP, which the association between and litter size was studied by the least square mean, and the variance components at the two polymorphisms were also analyzed. 【Result】 There were two polymorphisms occurring in exon5 (primer E5) and exon6 (primer E7) respectively, each one with three genotypes (AA, BB and AB). At E5, in Large White, BB genotype had significantly higher (P<0.05) TNB and NBA than AA genotype in third to eighth parity, and in all parities, BB genotype had significantly higher (P<0.05) NBA than AA genotype, while had greatly significantly higher TNB than AA (P<0.01), the heredity of TNB and NBA was mostly influenced by the genetic additive effect; In Landrace, there was no significant difference on TNB and NBA in the four phases. At E7, in Large White, AA genotype had significantly higher (P<0.05) TNB than BB genotype in third to eighth parity and all parities, the heredity of TNB was mostly influenced by the genetic additive effect; in Landrace, AB genotype had significantly higher (P<0.05) NBA than BB genotype in third to eighth parity and all parities. 【Conclusion】 In Large White, the BB genotype at E5 was favorable marker genotype for TNB and NBA, and the BB genotype at E7 was favorable marker genotype for TNB.

    Relationship of Single Nucleotide Polymorphism of Intron 1 in Procine POU1F1 and the Growth Trait

    Scientia Agricultura Sinica. 2009, 42(1):  283-289 .  doi:10.3864/j.issn.0578-1752.2009.01.036
    Abstract ( 1104 )   PDF (350KB) ( 639 )   Save
    Related Articles | Metrics

    【Objective】 The relationship between porcine DNA polymorphisms of POU1F1 and mRNA expression was studied. 【Method】 The intron 1, a partial regional polymorphisms of porcine POU1F1 of two breeds of Yorkshare and Zhongxu black, were investigated by PCR-SSCP. Based on the total RNA contracted from animals pituitary, the mRNA quantities of POU1F1, GH, PRL, and TSH-? were masured by RQ-PCR. 【Result】 It was found that a SNP of T→C in intron 1 (site 1515bp), markedly correlated with the daily weight gain (R=-0.6, P<0.05) and the expression of GH (P<0.05) before slaughtering. 【Conclusion】The SNP of T→C led to the increase of the GH expression; But the daily weight gain decreasd in the growth trait before slaughtering.

    Analysis of Gene Expression in Skin from White Young Alpaca (Lama Pacos)

    Scientia Agricultura Sinica. 2009, 42(1):  290-298 .  doi:10.3864/j.issn.0578-1752.2009.01.037
    Abstract ( 1130 )   PDF (568KB) ( 841 )   Save
    Related Articles | Metrics

    【Objective】 The aim of this experiment is to study the mechanism of functions generation and to find the novel functional genes in the alpaca skin. 【Method】 The skin tissue was got from a white young alpaca. The cDNA library was constructed with SMART, from which 13 800 clones were selected at random to be sequenced. All sequences were treated to be high quality ones, which were assembled to be consensus sequences with CAP3, further aligned with BLAST to be annotated and clustered with CLUSTER. According to the Gene Ontology (GO) and classification standard of gene expression profile of human tissue, genes were classified to construct the gene expression profile. 【Result】 7 286 high quality sequences were generated from the alpaca skin cDNA library with 106 PFU, which were deposited by dbEST in GenBank (GenBank name:ASCD). With CAP3, 5 837 consensus sequences were assembled, including 446 contigs and 5 391 singleton. BLAST searches produced 1 732 novel genes representing new transcripts. Clustering analysis of the annotated sequences allowed 4 968 unigenes. The results showed that the significant characteristics were the highest level of the transcripts of transcription and translation system and higher level of some single genes such as Procollagen typeI. Additionally, some putative genes related to alpaca fleece quality, growth and color were found. 【Conclusion】 This is the first time to construct the alpaca skin cDNA library and its gene expression profile, from which much gene information reflecting the physiologic characters and functions of the white young alpaca skin were obtained. The construction of the cDNA library is a useful resource for finding new genes.

    VETERINARY SCIENCE
    Construction of Naive Mouse Phage Antibody Library and Screening of Monoclonal Antibodies Specific for Sheep Inhibin

    Scientia Agricultura Sinica. 2009, 42(1):  299-303 .  doi:10.3864/j.issn.0578-1752.2009.01.038
    Abstract ( 1044 )   PDF (276KB) ( 989 )   Save
    Related Articles | Metrics

    【Objective】 The purpose of this study is to construct the naive murine phage antibody library and acquire monoclonal antibodies against sheep inhibin by screening. 【Method】 The naive murine phage antibody library was constructed using phage display technology. The library was selected by using sheep inhibin as panning antigen by 3 rounds of binding-elution-enrichment procedure. The binding ability of expressed ScFv was detected by ELISA. 【Result】 The naive murine phage antibody library was established. Monoclonal antibodies against sheep inhibin were acquired by screening. Fifty-five out of 96 randomized clones were demonstrated to have binding capacities to sheep inhibin, with the positive ratio as much as 57%.【Conclusion】 The expressed ScFv had the ability to bind sheep inhibin. The production of genetic engineering antibody against sheep inhibin has provided a basis for further study. This strategy may provide an alternative newer approach to antibodies.

    Study on the Potential of Duck Hepatitis Virus (DHV-Ⅰ) to Stimulate the Body Weight Gain and Body Length Gain and the Effects of Silymarin on Them in Younger Duck

    Scientia Agricultura Sinica. 2009, 42(1):  304-311 .  doi:10.3864/j.issn.0578-1752.2009.01.039
    Abstract ( 1277 )   PDF (396KB) ( 841 )   Save
    Related Articles | Metrics

    【Objective】 To evaluate the effects of duck hepatitis virus-Ⅰ(DHV-Ⅰ) on the body weight gain and the body length gain in duck and the effects of Silymarin on them in vivo. 【Method】 One hundred 11days old ducks, both male and female, were collected to be subjected to the test. The experiments were conducted in 5 groups: In geoup 1-3, the animals were inoculated with 1:5×104 diluted duck hepatitis virus infected allantoic fluids and given 0, 30 and 10 mg?kg-1bw?d-1 Silymarin orally respectively. In group 4, the animals were only given 10 mg?kg-1bw?d-1 Silymarin. The group 5 was the control one. During the treatment period, the food and water were given ad libitum except that the food was deprived for about 36 h once every four days in order to body-weighting. At the middle (15 d) and end of the treatment period (30 d), their body-length were measured. At the end of treatment, all the birds were slaughtered and the main visceral organs, pectoral muscles, thymus, lateral head of gastrocnemius were weighted for gaining the organ indexes (organ weight/corpse weight). 【Result】 In group 1, most (75%) birds died in 96h after inoculation of the virus and in group 2 some birds (20%) died in 120 h. All of other three groups survived during the treatment period (30 days). The survivals of group1 and 2 showed significant highly body weight gain and body length gain than that of other three groups. The eventual body weights were higher about 19.11% and 20.38% than that of group 5 respectively (P<0.01) and the body lengths were also higher than that of group 5 (P<0.05). The gastric indexes, intestinal indexes and pancreas indexes of the group 1 and 2 were significantly lower than that of group 5, but the pectoral muscle index was significantly higher than that of group 5. 【Conclution】 The silymarin had significantly protective effects for younger ducks from duck virus (DHV-Ⅰ) hepatitis.Inoculation of the virus could stimulated the body weight gain and body development in duckling. Silymarin had dual efficacy on the effects of the virus to stimulate the body weight gains. In lower dose, it can inhibit the virus’ effect, but in higher dose, it can’t.

    Depletion of Enrofloxacin and Its Metabolite in the Milk of Lactating Cows
    Scientia Agricultura Sinica. 2009, 42(1):  312-317 .  doi:10.3864/j.issn.0578-1752.2009.01.040
    Abstract ( 1338 )   PDF (310KB) ( 711 )   Save
    Related Articles | Metrics

    【Objective】 Depletion of enrofloxacin and its metabolite in the milk were studied in mastitis cows after a single intramammary dose of 500 mg per quarter. 【Method】 Concentration of enrofloxacin and its metabolite ciprofloxacin were determined by high-performance liquid chromatography with fluorescence detector and the concentration-time data were analyzed by statistical moment principle. 【Result】 Enrofloxacin and its metabolite ciprofloxacin were all at the peak after 2 hours in the administered quarter. The concentrations were (13.16±3.10) μg?ml-1 and (2.79±0.94) μg?ml-1, respectively. Enrofloxacin and its metabolite ciprofloxacin can not be detected after 12 hours and 24 hours. In the healthy quarter enrofloxacin was at the peak after 1 hour and the concentration was (0.19±0.02) μg?ml-1. Enrofloxacin can not be detected after 6 hours. Ciprofloxacin was at the peak after 4 hours and the concentration was (0.51±0.07) μg?ml-1. Ciprofloxacin can not be detected after 24 hours. In the administered quarter, ciprofloxacin showed longer t1/2β which is (1.67±0.20) h in milk and maintained longer period than enrofloxacin. Under the experiment condition, it is suggested that the clinical withdrawal time should not be less than three days. 【Conclusion】 The results showed that enrofloxacin in mastitis cows is of rapid absorption, metabolism and elimination . Enrofloxacin and its metabolite ciprofloxacin are not residuary in milk.

    Development of an ELISA Method for Multi-Residue Detecting of Tetracyclines
    Scientia Agricultura Sinica. 2009, 42(1):  318-323 .  doi:10.3864/j.issn.0578-1752.2009.01.041
    Abstract ( 1152 )   PDF (292KB) ( 1287 )   Save
    Related Articles | Metrics

    【Objective】 Immunoassay kit for detecting of tetracyclines multi-residues was developed. 【Method】 Anti-tetracyclines antibody was gotten by immunizing animals with tetracycline-protein combination. An ELISA method for detecting tetracyclines residues in animal tissues was developed. This method was compared with R-biopharm Company Immunoassay Kit and LC-MS/MS method. 【Result】 The conjugate rate was 15 tetracycline mole to one protein mole in artificial antigen. Antiserum valence was more than 1﹕2 000 and the IC50 was about 3 μg?L-1. The cross-reactive rate range for 7 kinds of tetracyclines was from 58% to 100%. The limit of detection were 6.6 μg?L-1and 6.5 μg?kg-1 in milk and chicken muscle, respectively. The recovery rate range was from 40% to 120% in chicken muscle. 【Conclusion】 The lowest detection limit of this test kit was 0.3 μg?L-1 and the measuring range was from 0.3 to 30 μg?L-1. It can determine tetracycline, chlortetracycline, oxytetracycline and deoxycycline usually used in veterinary clinic at the same time. The sensibility, precision and accuracy of the method can satisfy the need of detecting veterinary residue.

    Expression of β-hemolysin Gene of Staphylococcus aureus Strains Shandong (zfb) and Its Hemolytic Activity
    Scientia Agricultura Sinica. 2009, 42(1):  324-330 .  doi:10.3864/j.issn.0578-1752.2009.01.042
    Abstract ( 1660 )   PDF (436KB) ( 1193 )   Save
    Related Articles | Metrics

    【Objective】 The gene coding the beta-hemolysin was cloned from Staphylococcus aureus Shandong strain Zfb, expressed in Escherichia coli, and the hemolytic activity of the recombinant protein was analyzed. 【Method】 hlb gene was cloned from genomic DNA of Staphylococcus aureus by PCR, and the PCR product was inserted into vector pET32a+ to construct plasmid pET32a+/hlb, the plasmid was then expressed in Escherichia coli BL21 (DE3) cells that induced by IPTG.. The hemolytic activity was evaluated by 96 well microtiter V-plates using purified the recombination protein against sheep and bovine erythrocytes and CAMP reaction with Streptococcus agalactiae. 【Result】 Sequence analysis showed that the Staphylococcus aureus β-hemolysin gene (hlb) was composed of 993 nucleotides encoding a mature polypeptide 330 amino acids; SDS-PAGE results showed that the recombinant proteins were expressed in inclusion bodies in Escherichia coli with molecular weight of 57 kD and the recombinant proteins accounted for 23.9% of the whole proteins. The purified protein hlb has 278 HU?mg-1 to sheep erythrocytes and 9×103 HU?mg-1 to bovine erythrocytes. The purified protein hlb can make obviously CAMP reaction with Streptococcus agalactiae. 【Conclusion】 The results showed that hlb protein was well expressed in Escherichia coli, and the hemolytic activity to bovine erythrocytes is bigger than sheep erythrocytes, suggesting that β- hemolysin pathogenic,immune mechanism and mastitis vaccine design might be further researched. Also, a new method of specific diagnosis and discriminating Streptococcus agalactiae from mastitis cases pathogen using the recombinant proteins by CAMP reaction is established.

    Construction of cDNA Expression Library of Theileria luwenshuni and Immunoscreening of Antigenic Genes
    Scientia Agricultura Sinica. 2009, 42(1):  331-339 .  doi:10.3864/j.issn.0578-1752.2009.01.043
    Abstract ( 1410 )   PDF (472KB) ( 798 )   Save
    Related Articles | Metrics

    【objective】 A cDNA expression library of the merozoites of Theileria luwenshuni was successfully constructed and antigenic genes were obtained by immunoscreening from it. 【Method】 Purified mRNA was isolated from the merozoites of Theileria luwenshuni. A library of oligo (dT) -primed cDNA with added directional EcoRⅠ/HindⅢ linkers was constructed and ligated to the EcoR I/Hind III arms of the screen vector. The recombinant phage DNA was packaged by using PhageMaker packaging extracts, resulting in a primary cDNA library. The positive clones were immunoscreened with the positive sera against Theileria luwenshuni and the rabbit anti-sheep IgG-AP from the library. The new genes were obtained by Blast anlysis and sequencing. 【Result】 A cDNA expression library of the merozoites of Theileria luwenshuni was successfully constructed, with a size of 1.0×106 PFU, amplified cDNA library with a phage titer of 8.2×108 PFU?ml-1 , and a recombinant rate of 100%. Thirty new genes were obtained by analysis of immunoscreening, sequencing and Blast, and 15 of them have been submitted in GenBank/NCBI. 【Conclusion】The experiment has established an important material bases for the development of Theileria vaccine, new pattern medicine, diagnostic antigen and so on.

    RESEARCH NOTES
    Effects of Drying Maize Seeds with Different Intermittent Microwave on Germination Percentage and Drying Characteristics

    Scientia Agricultura Sinica. 2009, 42(1):  340-348 .  doi:10.3864/j.issn.0578-1752.2009.01.044
    Abstract ( 1299 )   PDF (281KB) ( 939 )   Save
    Related Articles | Metrics


    【Objective】 The experiment was carried out to study the factors affecting intermittent microwave drying on maize seeds, to research the optimal conditions for drying maize seed. 【Method】 Many factors affecting seed moisture content and seed germination in the processing of microwave drying were studied, which included time ratio of intermittent microwave, primary moisture of seed, loading weight in drying and microwave drying power. 【Result】 Microwave drying power and time ratio of intermittent microwave were the key factors affecting intermittent microwave drying on maize seeds. The preferable time ratio of intermittent microwave was 10% on the condition of 700W or 800W of microwave output power. But in continuous drying, the seed moisture shouldn’t be more than 16.38% at 800W output power and not more than 17.29% at 700W output power. On the condition of discontinuous microwave drying, maize seeds of primary moisture content 18% can be dried with output power 800W and 10% or 20% time ratio of intermittent microwave. In different processing times of discontinuous microwave drying, drying times could be calculated with formulation y1=23.9160e-0.1426x1+ 3.4943e-0.0114x1 (10% of time ratio of intermittent microwave) and formulation y2=2.0466+11.1693e-0.2457x2 + 9.306e-0.2457x2 (20% of time ratio of intermittent microwave) respectively, for maize seed moisture reduced from 18% to 13.5%. The biggest drying rate was observed when loading weight was 300 g, but the damage of seed was the most serious at this very moment. 【Conclusion】 There were many factors affecting drying seed efficiency, such as microwave drying power, time ratio of intermittent microwave, primary seed moisture, loading weight in processing, and pattern. Selecting proper conditions and mode of microwave processing according to the above results, the purpose of ensuring seed drying efficiency and planting value could be achieved.

    Specific RAPD-DNA Markers Transfer of Two Populations of Melampsora larici-populina

    Scientia Agricultura Sinica. 2009, 42(1):  349-354 .  doi:10.3864/j.issn.0578-1752.2009.01.045
    Abstract ( 1093 )   PDF (426KB) ( 737 )   Save
    Related Articles | Metrics

    【Objective】 This paper focused on achieving sequence characterized amplified region (SCARs) of geographic populations of Melampsora larici-populina, and transferring them to codominant markers. 【Method】 Based on the results of RAPD study of Melampsora larici-populina, DNA fragments of Western and Northern populations were recycled, purified, pGEM-T vector cloned and sequenced. About 400bp length DNA fragments were achieved after being integrated by software Seqman, and two pairs of primers were designed by software Primerselect (Western population primers: PNW0118-382-F: GAATCGGCCACAAAACTATC, PNW0118-382-R: GAATCGGCC ATGACTTGAGC, and Northern population primers: PNW0118-400-F: GAATCGGCCACAAAA CTATC, PNW0118-400-R: GAATCGGCCATGACTTGAGCTGC).【Result】 With these primers, SCARs of Western population (382 bp) and Northern population (400 bp) were amplified successfully by optimized conditions of polymerase chain reactions. 【Conclusion】The two pairs of primer can be used to monitor the geographic groups of Melampsora larici-populina

    Effects of Organic Nutrient Recycling on Phosphorus Adsorption- Desorption Characteristics in a Reddish Paddy Rice System
    Scientia Agricultura Sinica. 2009, 42(1):  355-362 .  doi:10.3864/j.issn.0578-1752.2009.01.046
    Abstract ( 1235 )   PDF (339KB) ( 1377 )   Save
    Related Articles | Metrics
    【Objective】 For revealing the mechanism of soil P fertility changes, the influences of different patterns of long-term fertilizer application for 16 years on phosphorus adsorption-desorption characteristics at the layers of 0-20 cm and 20-40 cm were studied in a reddish paddy rice field. 【Method】 Soil samples collected from the long-term experimental field were incubated in a constant temperature cabinet and parameters of soil P adsorption, rate of soil P desorption and amount of accumulative P desorption were then determined. 【Result】 The characteristics of soil P adsorption-desorption were changed remarkably under different patterns of long term fertilizer application, especially at 0-20 cm of soil layer. The affinity constant (k) of soil P adsorption, the maximal P adsorption (Q) and the buffering capacity of P adsorption (MBC) were declined significantly at the layer of 0-20 cm by the employment of long term organic nutrient recycling, and meanwhile, the amount and rate of accumulative soil P desorption were increased significantly in this soil layer. Organic nutrient recycling combined with chemical fertilizer application was more effect in declining soil P adsorption parameters and increasing the amount and rate of accumulative P desorption at 0-20 cm compared with that of organic nutrient recycling alone. There was no significant difference between treatments of NPK fertilizer application and the control without tertilize application on soil phosphorus adsorption-desorption characteristics. 【Conclusion】 Combination of NPK fertilizer and organic nutrient recycling could significantly decrease soil phosphorus adsorption and enhance P desorption of the plough layer, and hence increase soil P fertility in the reddish paddy rice field. The effects of organic nutrient recycling on soil P adsorption-desorption would not increase the risk of P pollution of water environment.
    Simulating the Effects of Nitrogen on External Quality Indices of Standard Cutting Chrysanthemum ‘Shenma’ in Solar Greenhouse
    Scientia Agricultura Sinica. 2009, 42(1):  363-369 .  doi:10.3864/j.issn.0578-1752.2009.01.047
    Abstract ( 1247 )   PDF (274KB) ( 824 )   Save
    Related Articles | Metrics

    【Objective】 The aim of this study was to quantitatively investigate the effects of nitrogen on external quality of solar greenhouse standard cutting chrysanthemum, and to optimise the nitrogen management for standard cutting chrysanthemum production in solar greenhouse. 【Method】 Experiments with different planting date and nitrogen treatment were conducted in a solar greenhouse in Beijing during 2005 and 2006. The cultivar used in the experiments was Dendranthema morifolium ‘Shenma’. The integrated photo-thermal index, the product of thermal effectiveness, PAR and day length (PTEP), was used to describe the changes of the external quality indices (plant height, stem diameter, leaf number, diameter of flower head, length of flower neck). Effects of the accumulated leaf nitrogen content at flower bud showing stage on the dynamics of the quality indices were quantified based on the experimental data. Based on these quantitative relationships, a model for predicting the effects of nitrogen on external quality of standard cutting chrysanthemum in solar greenhouse was developed. Independent experimental data were used to validate the model. 【Result】 In the range of nitrogen available in the soil during the experimental seasons, the effect of nitrogen on plant height and leaf number were not significant. The coefficient of determination (R2) between the simulated and measured value of plant height, stem diameter, leaf number, diameter of flower head and length of flower neck of the standard cutting chrysanthemum plants were 0.99, 0.96, 0.96, 0.97, 0.98, respectively; and the relative prediction error (RSE) were 5.25%, 3.04%, 8.9%, 10.92%, 9.22%, respectively based on the 1﹕1 line. 【Conclusion】 The model developed in this study can be used for the optimization of nitrogen management for solar greenhouse standard cutting chrysanthemum ‘Shenma’ production.

    Polymorphism of ExonⅠ of Hormone- Sensitive Lipase (HSL) Gene in Three Chinese Yak Populations

    Scientia Agricultura Sinica. 2009, 42(1):  370-376 .  doi:10.3864/j.issn.0578-1752.2009.01.048
    Abstract ( 1139 )   PDF (357KB) ( 955 )   Save
    Related Articles | Metrics

    【Objective】 Genetic polymorphisms of HSL gene in yak were detected in order to provide a theoretical foundation for further studying on revealing the genetic differentiation among yak populations, association analysis on yak meat quality traits and polymorphism, location and expression regulation of yak HSL gene, and so on. 【Method】 Polymorphisms of the partial exon I of HSL gene in 92 heads of yaks from 3 populations (Jiulong yak, Maiwa yak, and Bazhou yak) were analyzed by SmaⅠ-RFLP. The sizes of allele frequencies and genotype frequencies were calculated and the Chi-square test was analyzed by SPSS soft, and the genetic polymorphism parameters (including homozygosity, heterozygosity, the effective number of alleles and polymorphism information content) were analyzed on this loci. 【Result】 SmaⅠpolymorphism was observed in the partial exon I of yak HSL gene, and 3 genotypes (AA, BB, AB) were detected. AA and BB were observed in all the 3 populations, but BB genotype was only detected in Bazhou yak. AA was the genotype with highest frequency in Jiulong and Maiwa yak populations but it was AB genotype in Bazhou yak. The predominant allele was allele A, whose frequency was higher than B in all the 3 populations. Sequencing analysis showed that a mutation (G→A) occoured at the 70th site (numbering from the 5′ end of the PCR fragment) of exonⅠof HSL gene, which resulted in an amino acid change from Gly to Arg. Compatibility test indicated that Jiulong yak, Maiwa yak and Bazhou yak were all in the Hardy-Weinberg equilibrium at the SmaⅠsite. Independence test indicated that the genotype distribution was obviously different between Jiulong yak and Maiwa yak, and it was extremely obviously different between Jiulong yak and Bazhou yak, while it was not obvious between Maiwa yak and Bazhou yak. 【Conclusion】 SmaⅠpolymorphism was observed in the partial exon I of yak HSL gene, which resulted from a single base mutation (G→A), and the mutation resulted in an amino acid change from Gly to Arg. At the SmaⅠ site, Jiulong yak, Maiwa yak and Bazhou yak were all in the Hardy-Weinberg equilibrium, but the genotype distribution was obviously different between Jiulong yak and Maiwa yak, and it was extremely obviously different between Jiulong yak and Bazhou yak, while it was not obvious between Maiwa yak and Bazhou yak.