松杨栅锈菌两菌群RAPD特异序列的标记转换

doi:10.3864/j.issn.0578-1752.2009.01.045

Abstract

Abstract:

【Objective】 This paper focused on achieving sequence characterized amplified region (SCARs) of geographic populations of Melampsora larici-populina, and transferring them to codominant markers. 【Method】 Based on the results of RAPD study of Melampsora larici-populina, DNA fragments of Western and Northern populations were recycled, purified, pGEM-T vector cloned and sequenced. About 400bp length DNA fragments were achieved after being integrated by software Seqman, and two pairs of primers were designed by software Primerselect (Western population primers: PNW0118-382-F: GAATCGGCCACAAAACTATC, PNW0118-382-R: GAATCGGCC ATGACTTGAGC, and Northern population primers: PNW0118-400-F: GAATCGGCCACAAAA CTATC, PNW0118-400-R: GAATCGGCCATGACTTGAGCTGC).【Result】 With these primers, SCARs of Western population (382 bp) and Northern population (400 bp) were amplified successfully by optimized conditions of polymerase chain reactions. 【Conclusion】The two pairs of primer can be used to monitor the geographic groups of Melampsora larici-populina

Key words: Melampsora larici-populina, DNA , SCAR markers

Specific RAPD-DNA Markers Transfer of Two Populations of Melampsora larici-populina

[J].Scientia Agricultura Sinica, 2009, 42(1): 349-354 .

References

Related Articles 15

[1]	ZHAO ZiJie, SONG Hao, DONG XiaoOu, WAN JianMin. Progress in Transposable Element-Assisted Targeted Insertion of Large DNA Fragments [J]. Scientia Agricultura Sinica, 2026, 59(6): 1141-1156.
[2]	LI YaYu, WANG XinLiang, ZHOU JinHuan, LI ChuXin, LI JiaXin, TIAN XuBin, SONG Zhen. Construction and Infectivity Identification of Genome-Length cDNA of Citrus Psorosis Virus [J]. Scientia Agricultura Sinica, 2025, 58(17): 3451-3460.
[3]	WU YuZhen, HUANG LongYu, ZHOU DaYun, HUANG YiWen, FU ShouYang, PENG Jun, KUANG Meng. Construction of SSR Fingerprint Library and Comprehensive Evaluation for Approved Cotton Varieties in China [J]. Scientia Agricultura Sinica, 2024, 57(8): 1430-1443.
[4]	ZHAO ZhenJian, WANG Kai, CHEN Dong, SHEN Qi, YU Yang, CUI ShengDi, WANG JunGe, CHEN ZiYang, YU ShiXin, CHEN JiaMiao, WANG XiangFeng, TANG GuoQing. Integrated Aanalysis of Genome and DNA Methylation for Screening Key Genes Related to Pork Quality Traits [J]. Scientia Agricultura Sinica, 2024, 57(7): 1394-1406.
[5]	GAO ChenXi, HAO LuYang, HU Yue, LI YongXiang, ZHANG DengFeng, LI ChunHui, SONG YanChun, SHI YunSu, WANG TianYu, LI Yu, LIU XuYang. Analysis of Transposable Element Associated Epigenetic Regulation under Drought in Maize [J]. Scientia Agricultura Sinica, 2024, 57(6): 1034-1048.
[6]	SU XiaoYu, TAN ZhengWei, LI ChunMing, LI Lei, LU DanDan, YU YongLiang, DONG Wei, AN SuFang, YANG Qing, SUN Yao, XU LanJie, YANG HongQi, LIANG HuiZhen. Analysis of Genome-Wide Methylation Differences and Associated Gene Expression of Sesame Varieties Under High Temperature Stress [J]. Scientia Agricultura Sinica, 2024, 57(24): 4825-4838.
[7]	SU GuoZhao, LI AiAi, LIU ZhongHua, CHEN YuHua, ZHANG XiuJie, MA YingXue, YANG XuHong, DENG Chao, XU ZhenJiang. Construction and Application of SSR Marker Identification System for Bitter Gourd Varieties [J]. Scientia Agricultura Sinica, 2024, 57(11): 2227-2242.
[8]	LI Hui, ZHANG YuFeng, LI XiaoGang, WANG ZhongHua, LIN Jing, CHANG YouHong. Identification of Salt-Tolerant Transcription Factors in the Roots of Pyrus betulaefolia by the Association Analysis of Genome-Wide DNA Methylation and Transcriptome [J]. Scientia Agricultura Sinica, 2023, 56(7): 1377-1390.
[9]	LIN Ping, WANG KaiLiang, YAO XiaoHua, REN HuaDong. Development of DNA Molecular ID in Camellia oleifera Germplasm Based on Transcriptome-Wide SNPs [J]. Scientia Agricultura Sinica, 2023, 56(2): 217-235.
[10]	DU BingChen, WANG Ming, LIU ChunGuo, WANG ShiDa, WEI XinYu, LU YaMan, SUN ZhenZhao, LIU ZaiSi, WEI LiLi, WANG JingFei, YANG DeCheng. Construction of Infectious cDNA Clone of GETV SC483 Strain [J]. Scientia Agricultura Sinica, 2023, 56(17): 3479-3486.
[11]	XUE YaPeng, DING YiBing, WANG YuZhuo, WANG XiaoDan, CAO XiaoNing, SANTRA Dipak K, CHEN Ling, QIAO ZhiJun, WANG RuiYun. Construction of DNA Molecular Identity Card of Core Germplasm of Broomcorn Millet in China Based on Fluorescence SSR [J]. Scientia Agricultura Sinica, 2023, 56(12): 2249-2261.
[12]	CHEN YuMei, ZHANG CongCong, HU LiRong, FANG Hao, DOU JinHuan, GUO Gang, WANG Yan, LIU QiaoXiang, WANG YaChun, XU Qing. Effect of Heat Stress on DNA Methylation of GNAS Promoter Region in Dairy Cows [J]. Scientia Agricultura Sinica, 2023, 56(12): 2395-2406.
[13]	ZHAO ChunFang,ZHAO QingYong,LÜ YuanDa,CHEN Tao,YAO Shu,ZHAO Ling,ZHOU LiHui,LIANG WenHua,ZHU Zhen,WANG CaiLin,ZHANG YaDong. Screening of Core Markers and Construction of DNA Fingerprints of Semi-Waxy Japonica Rice Varieties [J]. Scientia Agricultura Sinica, 2022, 55(23): 4567-4582.
[14]	HUANG XunHe,WENG ZhuoXian,LI WeiNa,WANG Qing,HE DanLin,LUO Wei,ZHANG XiQuan,DU BingWang. Genetic Diversity of Indigenous Yellow-Feathered Chickens in Southern China Inferred from Mitochondrial DNA D-Loop Region [J]. Scientia Agricultura Sinica, 2022, 55(22): 4526-4538.
[15]	MA XueMeng,YU ChengMin,SAI XiaoLing,LIU Zhen,SANG HaiYang,CUI BaiMing. PSORA: A Strategy Based on High-Throughput Sequence for Analysis of T-DNA Insertion Sites [J]. Scientia Agricultura Sinica, 2022, 55(15): 2875-2882.

Metrics

Viewed

Full text

Abstract

Cited

Shared

Discussed

Comments

Recommended 0

No Suggested Reading articles found!