Loading...

Table of Content

    01 July 2019, Volume 52 Issue 13
    CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS
    Comprehensive Analysis on Grain and Processing Quality of Several Wheat Varieties in the Middle and Lower Reaches of Yangtze River
    WU Hao,HUANG YuanYuan,WANG Hui,ZHOU Yu,SHEN JiaCheng,ZHANG Can,DING JinFeng,ZOU Juan,MA ShangYu,GUO WenShan,ZHENG WenYin,YAO DaNian
    Scientia Agricultura Sinica. 2019, 52(13):  2193-2207.  doi:10.3864/j.issn.0578-1752.2019.13.001
    Abstract ( 738 )   HTML ( 62 )   PDF (585KB) ( 839 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】 The present study was conducted to analyze the quality differences of tested wheat varieties in the middle and lower reaches of Yangtze River, including Jiangsu, Anhui and Hubei Provinces. The important factors influencing the noodle quality was assessed in providing theoretical basis for the wheat quality evaluation, variety selection with high-quality, and regional distribution of wheat quality. 【Method】 Based on the variance analysis of quality properties, principal component analysis was carried out in 25 quality traits of 13 wheat varieties planted in 6 pilot sites from 3 provinces, so as to evaluate and screen the important quality properties in this area. Then, partial least square analysis was used to distinguish the quality variation among provinces. Finally, the factors affecting the quality of noodle were analyzed by path analysis. 【Result】 Principal component analysis classified all quality traits into starch gelatinization index, flour water absorption index, flour quality index, protein index, flour color index, glutenin index and starch breakdown index and their cumulative contribution value reached 81.250% covering the vast majority of quality indexes. In the middle and lower reaches wheat areas of the Yangtze River, starch gelatinization index was the leading factor in quality evaluation, followed by flour water absorption index and flour quality index. The results of orthogonal partial least squares discriminant analysis (OPLS-DA) showed that the specific quality differences among the three provinces in this region were manifested in the gelatinization characteristics of starch, such as final viscosity and setback. From the results of path analysis, sodium carbonate solvent retention capacity could be seen as the largest directly positive effect on the sensory evaluation of noodles, while the disintegrating value of starch gelatinization and gluten performance index had relatively great negative effect on noodle quality. 【Conclusion】 Wheat quality in the middle and lower reaches of the Yangtze River is a complex integrative character, and there are significant differences in quality traits among different cultivars and planting areas. Starch gelatinization index and other quality traits are all easily affected by the environment. The great quality variation among the three provinces is setback and final viscosity of starch. With the increase of Trough, final viscosity and setback in starch, the quality of noodle enhance. Damaged starch content is the main factor that affects the quality of noodles based on the sensory evaluation. The wheat flour with high damaged starch content could be used to produce the high-quality noodle.

    CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS
    QTL Mapping of Hard Seededness in Wild Soybean Using BSA Method
    CHEN JingJing, LIU XieXiang, YU LiLi, LU YiPeng, ZHANG SiTian, ZHANG HaoChen, GUAN RongXia, QIU LiJuan
    Scientia Agricultura Sinica. 2019, 52(13):  2208-2219.  doi:10.3864/j.issn.0578-1752.2019.13.002
    Abstract ( 908 )   HTML ( 38 )   PDF (3934KB) ( 722 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】 Hard seededness of wild soybean is an important effector that limits the utilization of wild resources in soybean genetic improvement. Bulked segregant analysis (BSA) was employed to identify major quantitative trait loci (QTLs) related with hard seededness in soybean, which laid a foundation for effective utilization of wild soybean germplasm in cultivated soybean improvement. 【Method】 F2 and F7 segregation populations were constructed from a cross between cultivated soybean Zhonghuang39 and wild soybean NY27-38. Uniformly sized seeds were selected from each line, and 30 seeds were soaked in a petri dish with 30 mL distilled water for 4 hours at 25℃. The assay was replicated 3 times. The number of permeable and impermeable seeds were counted. In F2 population, the first DNA pool was constructed from 22 individuals with permeable seeds (imbibition rate >90%), and second DNA pool was constructed from 16 individuals with impermeable seeds (imbibition rate <10%). In F7 population, 20 lines with permeable seeds (100% imbibition) and 20 lines with impermeable seeds (no imbibition) were used to construct two DNA pools, respectively. To detect genomic regions associated with hard seededness, these DNA bulks were genotyped with 259 polymorphic SSR markers to identify markers linked to QTL. A linkage map was constructed with 192 SSR markers, QTLs related with hard seededness were identified by composite interval mapping in F7 segregation population. 【Result】 Out of 259 SSR loci polymorphic between Zhonghuang39 and NY27-38, 10 and eight polymorphic SSR markers between the permeable and impermeable pools were detected in 16.3 Mb interval on chromosome 2 and 23.4 Mb interval on chromosome 6, respectively, in F2 population. The QTL region (276.0 kb) located between Satt274 and Sat_198 on chromosome 2 contained previously cloned gene GmHs1-1, the QTL explained 17.2% of the total genetic variation. The other QTL was mapped on chromosome 6 flanked by BARCSOYSSR_06_0993 and BARCSOYSSR_06_1068, accounting for 17.8% of the total genetic variation. In F7 population, eleven, nine and four SSR polymorphic markers between the permeable and impermeable pools were detected in 27.4 Mb interval on chromosome 2, 27.8 Mb interval on chromosome 6, 18.2 Mb interval on chromosome 3, respectively. A linkage map of 192 SSR markers and covering 2 390.2 cM was constructed through composite interval mapping in F7 population. Three QTLs related with hard seededness were detected. The QTL on chromosome 2 located between Satt274 and Sat_198, explained 23.3% of the total genetic variation; the QTL on chromosome 6 flanked by Sat_402 and Satt557, explained 20.4% of the total genetic variation; the QTL on chromosome 3 flanked by Sat_266 and Sat_236 accounted for 4.9% of the total genetic variation. 【Conclusion】 In this study, three QTLs related to soybean hard seededness were identified by both BSA and traditional linkage mapping, indicating that BSA is an effective strategy for identifying QTLs in soybean.

    TILLAGE & CULTIVATION·PHYSIOLOGY & BIOCHEMISTRY·AGRICULTURE INFORMATION TECHNOLOGY
    Cotton Nitrogen Nutrition Diagnosis Based on Spectrum and Texture Feature of Images from Low Altitude Unmanned Aerial Vehicle
    CHEN PengFei, LIANG Fei
    Scientia Agricultura Sinica. 2019, 52(13):  2220-2229.  doi:10.3864/j.issn.0578-1752.2019.13.003
    Abstract ( 813 )   HTML ( 29 )   PDF (1100KB) ( 706 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】 Based on the high spatial resolution images of unmanned aerial vehicle (UAV), the effects of removing soil background information and increasing image texture information on the inversion of cotton plant nitrogen concentration were investigated, in order to provide new technology for accurate estimation of cotton nitrogen nutrition status. 【Method】 Cotton water and nitrogen coupling experiment was conducted, and UAV images and plant nitrogen concentration data were measured during different cotton growth stages. Based on the above data, the effect of soil background on cotton canopy spectrum was firstly investigated. Secondly, the correlations between image texture parameters and plant nitrogen concentration were analyzed. Finally, the obtained data was divided into calibration dataset and validation dataset. Different scenarios, including before and after removing the soil background, and adding texture features, were set. The inversion models of plant nitrogen concentration under various scenarios were designed by using the coupled method of spectral indexes and principal component regression, and the performances of the models were compared. 【Result】 The soil background had an effect on the cotton canopy spectrum, and the trends were not the same at different growth stages. There existed significant correlations between image texture parameters and plant nitrogen concentration. For the scenarios before removal soil background, the plant nitrogen concentration prediction model had determination coefficient (R 2) value of 0.33 and root mean square error (RMSE) value of 0.21% during model calibration, and R 2 value of 0.19 and RMSE value of 0.23% during validation. For the scenarios after removing soil background, the plant nitrogen concentration prediction model had R 2 value of 0.38 and RMSE value of 0.20% during model calibration, and R 2 value of 0.30 and RMSE value of 0.21% during validation. For the scenarios adding image texture information, the plant nitrogen concentration prediction model had R 2 value of 0.57 and RMSE value of 0.17% during model calibration, and R 2 value of 0.42 and RMSE value of 0.19% during validation. 【Conclusion】 Based on high spatial resolution images of low-altitude UAVs, both removing soil background and adding image texture information could improve the inversion accuracy of cotton plant nitrogen concentration. Image texture could be considered as important information to support prediction of crop nitrogen nutrition status using UAV images.

    TILLAGE & CULTIVATION·PHYSIOLOGY & BIOCHEMISTRY·AGRICULTURE INFORMATION TECHNOLOGY
    Effects of Phosphorus-Solubilizing Bacteria and Arbuscular Mycorrhizal Fungi on Production Performance and Root Biomass of Alfalfa
    SUN YanMei,ZHANG QianBing,MIAO XiaoRong,LIU JunYing,YU Lei,MA ChunHui
    Scientia Agricultura Sinica. 2019, 52(13):  2230-2242.  doi:10.3864/j.issn.0578-1752.2019.13.004
    Abstract ( 726 )   HTML ( 24 )   PDF (432KB) ( 887 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】 Phosphorus-solubilizing bacteria (PSB) and arbuscular mycorrhizal fungi (AMF) play an important role in promoting nutrient uptake and increasing yield of crop. In order to explore the effects of PSB and AMF on growth and root biomass of alfalfa and to clarify the interaction between PSB and AMF, the mechanism of their effects on alfalfa growth were studied, so as to provide theoretical basis for alfalfa artificial cultivation and the development of high-efficiency compound microbial fertilizer. 【Method】 Single factor randomized block design was used in the experiment, and four kinds of bacteria were selected, including Bacillus megaterium (Bm) and Bacillus subtilis (Bs) with high phosphorus-solubilizing ability, and Funneliformis mosseae (Fm) and Glomus etunicatum (Ge), which could coexist with alfalfa roots, and the two types of bacteria were double inoculated with BmBs, BmFm, BmGe, BsFm, BsGe, FmGe, and adding inactivated bacteria as a control (CK), respectively. A total of 11 treatments.. After inoculation of the bacteria, the hay yield, plant height, stem diameter, crude protein concentration, neutral detergent fiber, acid detergent fiber, phosphorus concentration, taproot length, root biomass of alfalfa were determined, and pH value, total phosphorus, available phosphorus concentration of soil were also analyzed. Then, the effects of single and double inoculation on alfalfa were evaluated by membership function analysis. 【Result】 The above-ground biomass, plant height, stem diameter, crude protein concentration, phosphorus concentration, taproot length, under-ground biomass, soil available phosphorus under inoculated bacteria treatments were significantly higher than that under CK (P<0.05), while neutral detergent fiber and acid detergent fiber of alfalfa, pH value and total phosphorus concentration under soil inoculated bacteria treatments were significantly lower than that under CK (P<0.05). Comparisons between inoculated bacteria and CK, above-ground biomass, plant height and stem diameter of alfalfa increased by 18.57%-24.49%, 8.59%-21.33% and 3.86%-9.54% under PSB in Bm and Bs treatments, respectively, and increased by 9.15%-27.35%, 2.51%-18.60 and 4.59%-8.58% under AMF in Fm and Ge treatments, respectively; BmBs, BmFm, BmGe, BsFm, BsGe, and FmGe treatments increased them by 7.66%-41.62%, 7.44%-34.56% and 5.58%-26.61%, respectively. The taproot length of alfalfa in single inoculated Fm and Ge treatments were significantly longer than those treated with Bm and Bs (P<0.05), but the differences between Fm and Ge, Bm and Bs treatments were not significant (P>0.05); Under the mixed inoculation treatments, the FmGe was the largest and significantly larger than that under other inoculation treatments in the taproot length of alfalfa (P<0.05); BmBs treatments was the weakest. The correlation analysis showed that there was no significant negative correlation between acid detergent fiber concentration and stem diameter (P>0.05); The under-ground biomass had no significant positive correlation with alfalfa phosphorus (P>0.05), and no significant negative correlation with soil total phosphorus (P>0.05). The comprehensive assessment various indicator of alfalfa by a membership function analysis showed that BmFm>BmGe>FmGe, which were the top three treatments for alfalfa production performance. 【Conclusion】 The effect of simultaneous inoculation of PSB and AMF on alfalfa plant growth and phosphorus nutrition was better than that of single inoculation of PSB or AMF, and the effect was related to the types of PSB and AMF. Considering the growth status, plant phosphorus nutrition and underground biomass of alfalfa, the effect of simultaneous inoculation of phosphorus-solubilizing bacteria was Bacillus megaterium (Bm) and arbuscular mycorrhizal fungus was Funneliformis mosseae (Fm) on alfalfa growth and phosphorus nutrition were well improved, and the next was BmGe treatments.

    PLANT PROTECTION
    Screening of Interacting Proteins of Anti-Canker Transcription Factor CsBZIP40 in Citrus by GST Pull-Down Combined with LC-MS/MS
    DOU WanFu,QI JingJing,HU AnHua,CHEN ShanChun,PENG AiHong,XU LanZhen,LEI TianGang,YAO LiXiao,HE YongRui,LI Qiang
    Scientia Agricultura Sinica. 2019, 52(13):  2243-2255.  doi:10.3864/j.issn.0578-1752.2019.13.005
    Abstract ( 708 )   HTML ( 19 )   PDF (3463KB) ( 1199 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】 CsBZIP40 is a citrus canker-related transcription factor. The objective of this study is to screen the interacting proteins of CsBZIP40 in response to Xanthomonas citri subsp. citri (Xcc) infection, and to analyze the interaction network of CsBZIP40, so as to provide a theoretical basis for molecular breeding of citrus canker resistance. 【Method】 The GST pull-down strategy was used to screen the interacting proteins of CsBZIP40 in the infection process of Xcc. Firstly, the vector of GST-CsBZIP40 was constructed and induced by IPTG (isopropyl β-D-thiogalactoside). The fusion protein of GST-CsBZIP40 was purified for the next GST pull-down. Then GST-CsBZIP40 was fixed on the GST-beads and incubated with total proteins extracted from CsBZIP40 over-expression plants infected by Xcc or LB medium as control. The protein complex bound to GST-CsBZIP40 bait protein was eluted and collected, and then verified by SDS-PAGE gel electrophoresis. The interacting proteins of CsBZIP40 were detected by LC-MS/MS and then annotated based on the genomic database of Citrus sinensis. The GO, KEGG pathways and the interaction network of the interacting proteins were also analyzed. 【Result】 The phenotype of transgenic plants over-expression CsBZIP40 was normal, and there was no significant difference between the transgenic plants and the control plants. The lesion area on the over-expression plant was significantly smaller compared to that on the wild-type (WT) (45%) and the disease index of CsBZIP40 over-expression plant was significantly lower than that of WT (54%). The total proteins were successfully extracted from CsBZIP40 over-expression plant infected by Xcc or LB medium, and the GST-CsBZIP40 was expressed and purified for the GST pull-down. GST-CsBZIP40 bait protein was used to catch the protein from the total proteins of Xcc-infected and uninfected citrus, then the protein was detected by LC-MS/MS. After comparison, annotation and screening, there are 53 interacting proteins specifically binding to GST-BZIP40 in the process of Xcc infection. These proteins are involved in many molecular functions and pathways. Among the 53 proteins, 6 proteins (Cs1g02310, Cs3g05280, Cs3g23950, Cs6g13880, Cs7g12130, orange1.1t04973) may be closely related to the plant disease resistance, 44 of the 53 proteins have been proven to interact directly or indirectly with CsBZIP40 in the database. 【Conclusion】 In the infection of Xcc, 53 proteins interacted with CsBZIP40 were detected. According to the annotation, 6 proteins are closely related to plant disease resistance. These proteins may play an important role in improving the stress resistance of citrus under biological stress.

    Identification of Viruses Infecting Peppers in Guangdong by Small RNA Deep Sequencing
    TANG YaFei,PEI Fan,LI ZhengGang,SHE XiaoMan,YU Lin,LAN GuoBing,DENG MingGuang,HE ZiFu
    Scientia Agricultura Sinica. 2019, 52(13):  2256-2267.  doi:10.3864/j.issn.0578-1752.2019.13.006
    Abstract ( 862 )   HTML ( 20 )   PDF (784KB) ( 587 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】 The viral disease is one of the major diseases of pepper production in Guangdong Province. The disease incidence is generally 5%-30% in the field, which can up to 100% in serious field. The objective of this study is to identify virus species infecting pepper in Guangdong Province, and to provide a theoretical basis for the prevention and control of pepper virus disease. 【Method】 From 2013 to 2016, a total of 125 susceptible pepper plant samples were collected from 8 major pepper growing areas of Guangzhou, Foshan, Huizhou, Jiangmen, Meizhou, Zhanjiang, Maoming and Shaoguan in Guangdong Province. Total RNA was extracted respectively from the leaves of 125 pepper samples. The 7 mixed samples collected from Maoming, Meizhou and Shaoguan were analyzed by small RNA deep sequencing. According to the results of small RNA deep sequencing analysis, two pairs of specific primers of each virus were designed to RT-PCR. The first pair of specific primers was designed according to the sequences of spliced gene fragments from small RNA deep sequencing. The second pair of specific primers was designed according to the conserved region sequences of viral genome in the GenBank database with the highest homology to sequences of spliced gene fragments from small RNA deep sequencing. Using disease samples RNA involved in small RNA deep sequencing as a template, the RT-PCR amplification was carried out with the two pairs of primers. Based on RT-PCR amplification results, the better pair of specific primers of each virus was selected. Furthermore, all 125 samples collected from Guangdong Province were subjected to detect viruses with the better pair of specific primers by RT-PCR. 【Result】 Fourteen viruses were identified in 125 samples collected from major pepper growing areas in 8 cities of Guangdong Province. According to the order of detection rate from high to low, they were Pepper mild mottle virus (PMMoV) (44.0%), Bell pepper endornavirus (BPEV) (32.8%), Tobacco mild green mosaic virus (TMGMV) (31.2%), Chilli veinal mottle virus (ChiVMV) (29.6%), Pepper vein yellow virus 1 (PeVYV-1) (26.4%), Pepper veinal mottle virus (PVMV) (25.6%), Cucumber mosaic virus (CMV) (18.4%), Chilli ringspot virus (ChiRSV) (16.8%), Pepper vein yellow virus 6 (PeVYV-6) (16.8%), Potato virus Y (PVY) (15.2%), Capsicum chlorosis virus (CaCV) (14.4%), Broad bean wilt virus 2 (BBWV-2) (9.6%), Pepper cryptic virus 1 (PCV1) (8.8%), Tobacco mosaic virus (TMV) (4.0%). The detection rates of PMMoV, BPEV, TMGMV, ChiVMV, PeVYV-1 and PVMV were over 25%. PMMoV, ChiVMV and PVMV were widely distributed in Guangdong Province. PMMoV (except Maoming), ChiVMV (except Shaoguan) were detected in pepper producing areas of other 7 cities. PVMV was detected in pepper producing areas of 8 cities. According to detection rate and distribution range, it was concluded that PMMoV, ChiVMV and PVMV were the dominant viruses infecting pepper in Guangdong Province. The mixed infection phenomenon was common on peppers in Guangdong Province. The detection rate of mixed infection was up to 88.0% in 125 samples. Among them, the mixed detection rates of 2 kinds, 3 kinds, 4 kinds, 5 kinds, 6 kinds, 7 kinds and 8 kinds of viruses were 28.0%, 25.6%, 12.0%, 9.6%, 6.4%, 1.6%, 2.4%, respectively. So, 2 kinds and 3 kinds of viruses mixed infection were the main infection forms on peppers in Guangdong Province. 【Conclusion】 There are 14 kinds of viruses endangering pepper plants in Guangdong Province, among which PMMoV, ChiVMV and PVMV are the dominant viruses. The phenomenon of mixed infection is common. The main infection forms on peppers are 2 kinds and 3 kinds of viruses mixed infection in Guangdong Province.

    SOIL & FERTILIZER·WATER-SAVING IRRIGATION·AGROECOLOGY & ENVIRONMENT
    Microbial Transformation Process of Straw-Derived C in Two Typical Paddy Soils
    QIU CunPu, CHEN XiaoFen, LIU Ming, LI WeiTao, WU Meng, JIANG ChunYu, FENG YouZhi, LI ZhongPei
    Scientia Agricultura Sinica. 2019, 52(13):  2268-2279.  doi:10.3864/j.issn.0578-1752.2019.13.007
    Abstract ( 817 )   HTML ( 13 )   PDF (501KB) ( 956 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】 The straw degradation rate, microbial community structure changes and functional microbial community composition involved in straw decomposition in soils were researched, and the research results could provide the theoretical foundation for revealing microbial mechanism of the soil organic matter transformation and accumulation. 【Method】 Two typical subtropical paddy soil in China, including Changshu Wushan soil and Yingtan Red paddy soil, were collected as the research materials. We anaerobically incubated the soils with/without 13C-enriched rice straw for 38 days. Gaseous samples were regularly collected to investigate mineralization rate of straw in dynamic changes. The soil samples were collected to analyze the dynamic changes of the microbial community composition related to straw decomposition by using 13C-PLFA-SIP technology. 【Result】 At the early stage before day 12 of the anaerobic culture, straw degraded slowly, and straw had positive priming effect on soil organic matter (SOM). At the stage of day 12-18, straw degraded rapidly and then the rate tended to be slow after day 18. At the end of incubation, straw mineralization rate was 24% and 33% in Red paddy soil and Wushan soil, respectively. The contribution of straw C to C efflux increased with incubation time, which was 53%-60% and 54%-57% to CO2 and CH4 efflux, respectively. The microbial biomass and activity were improved in the soil with straw, and the microbial activity in Wushan soil was higher than that in Red paddy soil. During straw degradation, 16:0 (general bacteria) was the main groups. i16:0, i15:0 (G + bacteria) and 18:1ω9c (fungi) were also important microbial groups involved in straw degradation. The relative abundance of straw-derived gram-positive (G +) bacteria and actinomycetes increased and gram-positive (G -) bacteria decreased with incubation time. The proportions of straw-derived PLFAs were 27%-32% and 18%-24% in Red paddy soil and Wushan soil PLFAs, respectively. The straw utilization efficiency was higher in fungi and general bacteria, while G - bacterial and actinomycetes PLFAs were preferentially linked to extant soil organic matter (SOM) mineralization. The microbial community composition was different between Wushan soil and Red paddy soil with rice straw. The straw-derived microbial community composition was similar in two soils, but the SOM-derived microorganisms were differences. 【Conclusion】 The mineralization of straw C lagged behind extant SOM during anaerobic straw degradation. The microbial activity and diversity in soil were important factors influencing the efficiency of straw mineralization. After adding straw in soil, it’s showed differences from the microbial community composition, which were mainly involved in the differences between SOM-derived microorganisms, and SOM was an important factor leading to these differences.

    SOIL & FERTILIZER·WATER-SAVING IRRIGATION·AGROECOLOGY & ENVIRONMENT
    Response of Fungal Community and Function to Different Tillage and Straw Returning Methods
    DAI HongCui,ZHANG Hui,XUE YanFang,GAO YingBo,QIAN Xin,ZHAO HaiJun,CHENG Hao,LI ZongXin,LIU KaiChang
    Scientia Agricultura Sinica. 2019, 52(13):  2280-2294.  doi:10.3864/j.issn.0578-1752.2019.13.008
    Abstract ( 698 )   HTML ( 18 )   PDF (2944KB) ( 3758 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】 This study was conducted to explore the change of fungal community structure and function response to different tillage and straw returning methods in wheat-maize rotation system in the North China Plain. It aimed to clarify the biological mechanism of soil fertility improvement, which provided a theoretical support for sustainable development for agricultural production. 【Method】 A six-year field study with split plot design was conducted to investigate the effects of different soil tillage methods (no tillage, CT; deep tillage, DT; rotation tillage, ST) and straw returning methods (wheat and maize straws were returned to the field, DS; only wheat straw was returned to the field, SS) on changes of fungal community structure and function in soils from wheat-maize rotation system in the North China Plain. In combination with soil properties, multiple regression trees and correlation analysis was carried out to investigate driving factors of fungal community structure and function in soil.【Result】 The results showed that, compared with NT, soil organic carbon content under DS and SS were reduced by 35.04% and 44.30% in 0-10 cm layer, respectively. The available nitrogen of NT under SS treatment was significantly lower than that under other treatments in 10-20 cm layer. Ascomycetes (68.98%), Basidiomycetes (16.96%) and Chytridiomycetes (1.62%) were the dominant fungus in 0-10 cm layer, while Ascomycetes (68.44%), Basidiomycetes (15.52%), Chytridiomycetes (1.51%) and Coccidiomycetes (1.23%) were the dominant fungus in 10-20 cm layer. The different tillage and straw returning methods changed soil fungal community structure. Specifically, the relative abundance of Basidiomycota in DS increased 50.07% and 29.08% respectively in 0-10 cm and 10-20 cm layers than that of SS. The multiple regression trees showed that soil fungal communities were divided into soil organic carbon nodes with a threshold of 11.17 mg·kg -1 in 0-10 cm layer, additionally, the soil fungi community were divided into available nitrogen nodes with a threshold of 6.52 mg·kg -1 in 10-20 cm layer. In this study, Pathotroph was mainly function type of soil fungi in 0-10 cm (26.84%) and 10-20 cm (23.91%) layers in wheat-maize rotation in the North China Plain. Compared with NT, Pathotroph relative abundance under DT and RT treatments were reduced by 25.16% and 16.45%, respectively. The results of correlation analysis showed that Pathotroph relative abundance were positively correlated with soil total organic carbon, dissolved organic carbon, total nitrogen, available nitrogen and available potassium. 【Conclusion】 In general, our results indicated that different tillage and straw returning methods changed soil fungal community structure and relative abundance of functional groups. The content of soil organic carbon and available nitrogen were the driving factors shaped the fungal community structure. Besides, DT could reduce Pathotroph relative abundance, which was conducive to maintaining the soil ecosystem health.

    HORTICULTURE
    Expression and Structural Analysis of SC MI390-5p and Its Target Genes in Potato Response to Low Temperature
    XIE Jie,WANG Ming,DING HongYing,LI Qing,WANG WanXing,XIONG XingYao,QIN YuZhi
    Scientia Agricultura Sinica. 2019, 52(13):  2295-2308.  doi:10.3864/j.issn.0578-1752.2019.13.009
    Abstract ( 561 )   HTML ( 31 )   PDF (4805KB) ( 548 )   Save
    Figures and Tables | References | Related Articles | Metrics

    The study was carried out to investigate the mechanism of potato leucine-rich repeat receptor-like protein kinase (LRR-RLK) receptor protein kinase SCLRRK1 regulated by miR390 (ScmiR390-5p) in response to abiotic stress. 【Method】 By sequencing and analyzing potato miRNAs in response to low temperature conditions and predicting target genes, we found that ScmiR390-5p responded to low temperatures by regulating a potential LRR-like receptor protein kinase gene. The expression levels of ScmiR390-5p and SCLRRK1 in response to low temperature stress were verified by quantitative real-time PCR (RT-qPCR). The cleavage site of ScLRR390-5p on SCLRRK1 was determined by using RLM-5'RACE. The DNA sequence and CDS sequence of SCLRRK1 were cloned by PCR and the structure and function of SCLRRK1 were predicted by bioinformatics analysis. The expression levels of ScmiR390-5p/SCLRRK1 in various tissues of potato and under various abiotic stress were analyzed by RT-qPCR. 【Result】 The results of RT-qPCR showed that the expression of ScmiR390-5p was induced by low temperature, while the expression of SCLRRK1 was inhibited. There was a negative correlation between the expression of ScmiR390-5p and scrrk1 under low temperature stress. The result of RLM-5′RACE indicated that cleavage site of ScmiR390-5p on SCLRRK1 was ATTCCT// CCTGAGTT, and potato ScmiR390-5p/SCLRRK1 regulatory module was respond to low temperature. The cloning results indicated that the CDS of SCLRRK1 was 2 685 bp in length, encoding 894 amino acids, and the gene sequence was 3 549 bp containing 1 intron, 2 exons, 3' non-coding region and 5' non-coding region. ScmiR390-5p target site was located at SCLRRK1 CDS (960-981 bp, GGAACTATTCCTCCTGAGTTT). Bioinformatics analysis showed that the SCLRRK1 encoded a leucine-richrepeat (LRR)-like receptor protein kinase, belonging transmembrane secreted protein. RT-qPCR analysis of potato tissue expression pattern showed that the expression level of the ScmiR390-5p was highest in the leaves, followed by roots, and relatively lowers in stem (terrestrial stem, tuber and stolon). Differently, the expression level of SCLRRK1 was the lowest in leaves and the highest in stems. The results under various abiotic stresses showed that the expression of ScmiR390-5p and SCLRRK1 was negatively correlated, and ScmiR390-5p was induced by NaCl stress. Compared with the control, the expression of ScmiR390-5p was decreased and then increased slightly after treatment with ABA and 6-BA. The SCLRRK1 level increased continuously under 6-BA treatment, while the expression of SCLRRK1 increased first and then decreased under ABA treatment. The expression of ScmiR390-5p reached the peak after treatment with GA3, PEG and IAA for 8 h. The expression of SCLRRK1 was induced by GA3, PEG and IAA, but the change trend was not correlated to ScmiR390-5p. 【Conclusion】 SCLRRK1 had the amino acid sequence and structural basis of nucleic acid to encode LRR-like receptor protein kinase, which was the target gene of ScmiR390-5p; ScmiR390-5p/SCLRRK1 regulatory module had a significant role in potato tissues; ScmiR390-5p responded to low temperature stress by inhibiting the expression of potato SCLRRK1 at the post-transcriptional level, while ScmiR390-5p/SCLRRK1 regulated module played a role in salt and 6-BA stress response. The ScmiR390-5p/SCLRRK1 regulatory module did not respond to ABA, GA3, IAA and PEG stress, and the ScmiR390-5p and SCLRRK1 were regulated by the above signals at the transcriptional level, respectively.

    Comparative Study on Fruit Volatiles of Different Day-Neutral Strawberry Cultivars in Autumn and Winter
    DONG Jing,ZHONG ChuanFei,WANG GuiXia,CHANG LinLin,SUN Jian,SUN Rui,ZHANG HongLi,LI Rui,WEI YongQing,ZHENG ShuQi,ZHANG YunTao
    Scientia Agricultura Sinica. 2019, 52(13):  2309-2327.  doi:10.3864/j.issn.0578-1752.2019.13.010
    Abstract ( 941 )   HTML ( 7 )   PDF (2339KB) ( 7748 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】 Fruit volatiles of day-neutral strawberries harvested in autumn and winter were compared to clarify the effects of seasonal changes on volatile composition and odor activity value (OAV) of volatiles, aiming to provide theoretical basis for research on strawberry aroma and utilization of day-neutral cultivars. 【Method】 Matured fruits of day-neutral cultivars (including Albion, Monterey, Portola, and San Andreas) were harvested from high-tunnel in autumn and greenhouse in winter, respectively. Volatiles were extracted by using solid-phase microextraction (SPME), detected by gas chromatograph-mass spectrometer (GC-MS) and analyzed qualitatively and quantitatively. The numbers, contents, percentages and OAVs of volatiles were calculated. Principal component analysis (PCA) was employed to analyze the differences in volatiles content between autumn and winter strawberries. Clustered heatmap was used to classify the samples depending on the volatiles with OVA higher than 1. 【Result】 A total of 88 individual volatiles were identified and the OAVs of 57 volatiles were calculated. It was found that there were 30 components with OAV higher than 1. Effects of seasonal changes on the number of each chemical category and the total content of volatiles varied among cultivars. Compared to the autumn fruits, the content and percentage of esters in winter fruits were significantly higher, while terpenes were remarkably lower. The result of PCA indicated that, compared with other cultivars, volatiles pattern of Portola showed less variation, whereas San Andreas showed the highest variation between two seasons. Ethyl butanoate was very important for these tested cultivars since its average OAV was the highest in all volatiles. The OAVs of butyl acetate and methyl butanoate in winter fruits were noticeably higher than that in autumn fruits. However, compared with autumn fruits, the winter fruits of each cultivar had a lower sum of terpene OAVs that were higher than 1. Ethyl butanoate, butyl butanoate, 4-methoxy-2, 5-dimethyl- 3(2H)-furanone, ethyl hexanoate and linalool played an important role in the aroma differences between fruits of different seasons. The eight tested samples were classified into 3 groups using clustered heatmap. The group I included Albion autumn, Albion winter and Monterey autumn, of which total OAVs and the OAVs of ethyl butanoate were significantly higher than other groups. 【Conclusion】 Seasonal change had a remarkable impact on esters and terpenes in fruit volatiles of day-neutral strawberry cultivars. It was showed that the content and percentage of esters in winter fruits were significantly higher than autumn fruits, while the percentage of terpenes was remarkably lower in winter fruits. Among the 4 tested cultivars, Portola showed the least variation in volatile content between autumn and winter. Albion was the cultivar with intense aroma and its aroma performance presented the least changes when season changed, however, San Andreas was the one with the largest volatile variation both in volatile content and fruit aroma.

    FOOD SCIENCE AND ENGINEERING
    Difference Analysis of Pectin Content and Structure from Various Apple Cultivars
    CAO Feng,LIU Xuan,BI JinFeng,WU XinYe,ZHANG Biao,LIU JiaNing
    Scientia Agricultura Sinica. 2019, 52(13):  2328-2340.  doi:10.3864/j.issn.0578-1752.2019.13.011
    Abstract ( 2102 )   HTML ( 37 )   PDF (2266KB) ( 940 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】 The differences in pectin structure of different apple raw materials were compared and analyzed to give assistance for variety identification, so as to provide theoretical data basis for the processing of apple-related products and the utilization of apple by-products. 【Method】 Twenty apple samples of fourteen cultivars from seven producing areas in China were researched. Three types of pectin were extracted from the alcohol-insoluble residue (AIR) of each apple, including water-soluble pectin (WSP), CDTA-soluble pectin (CSP) and Na2CO3-soluble pectin (NSP). The galacturonic acid (GalA) content, esterification degree, weight-average molar mass (Mw), neutral sugar content, and structural functional groups of pectin were analyzed, then the principal component analysis (PCA) and heat map analysis were performed. 【Result】 The results showed that the content and structure of pectin were different in varying degrees. Among the three types of pectin, the content of NSP was the highest (determined with GalA as standard), followed by WSP and CSP. The most pectin-rich apple variety was the Granny Smith (215.75 mg GalA·g -1 AIR). Fuji (Qixia, Xinjiang, Yan6-Qingdao and Hebei) from different regions had great differences in the contents of galacturonic acid. The DM of Qiujin was the highest among the WSP of various varieties of apples. CSP had relatively higher DM and the most of them were high DM pectin. The degree of acetylation of WSPs were all below 3.5%. The Mw of WSP was the most significant one among all apple varieties. The Mw of Huayue’s WSP showed the highest value. The Mw/Mn of Hongjiangjun’s WSP was the highest, but the Mw/Mn of Hongjiangjun’s CSP was the lowest one. Mw/Mn had a small difference between the three types of pectin. Through the heatmap analysis, Rhamnose (Rha), arabinose (Ara) and galactose (Gal) were three main neutral sugars, and fucose (Fuc), xylose (Xyl) and mannose (Man) were in trace amount. The reason for plenty of glucose might be due to the presence of soluble starch, dextrin or oligosaccharides during the extraction of pectin. The pectin structure mainly consisted of homogalacturonan and rhamnogalacturonan-II. The PCA showed that the main differential indexes of different apple cultivars were WSP-Gal, WSP-Ara, CSP-Gal, CSP-Rha, WSP-Fuc and CSP-Rha/GalA. 【Conclusion】 There were certain differences among the content and structure of three types of pectin from various apple cultivars. Which were related to the pectin structural characteristics of apple varieties with parental and maternal crosses. The study could provide a theoretical support for the structural adjustment of apple breeding and planting.

    ANIMAL SCIENCE·VETERINARY SCIENCE·RESOURCE INSECT
    Expression Profile and Correlations of Kruppel Like Factors During Caprine (Capra Hircus) Preadipocyte Differentiation
    ZHU JiangJiang,LIN YaQiu,WANG Yong,LIN Sen
    Scientia Agricultura Sinica. 2019, 52(13):  2341-2351.  doi:10.3864/j.issn.0578-1752.2019.13.012
    Abstract ( 679 )   HTML ( 24 )   PDF (1538KB) ( 670 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】 The aim of this study was to optimize the culture system of goat preadipocytes in vitro and elucidate the expression patterns of Kruppel like factors (KLFs) during preadipocytes differentiation. 【Method】 Three 7-day-old Jianzhou Big-Eared goats were selected randomly from Sichuan Jianyang DAGEDA Animal Husbandry Co. Ltd. as experimental animal. After bloodletting death of goats, their subcutaneous fat tissues were collected in a sterile room. The goat subcutaneous preadipocytes were collected using collagenase I digestion method. The cells at Generation Three were then passaged to a 6-well plate when the cells were grown to 80% density. The combined use of were used for preadipocytes differentiate inducing. The cells were then collected after cultivation for 0 d, 3 d, 5 d and 7 d. The total RNA was extracted by using Trizol method. Real-time fluorescent quantitative PCR (RT-qPCR) was performed to determine the expression levels of 11 members of KLFs, including KLF2-10, KLF12 and KLF15, during goat preadipocytes differentiation. Pearson correlation coefficient was used for expression correlation analysis between KLF individuals. 【Result】 The results showed that the combined use of 150 μmol·L -1oleic acid and 10 mg·L -1 insulin promoted the formation of small lipid droplets after 24 h cultivation. After 48 h, the lipid droplets became bigger and much more. The differentiation of the preadipocytes were enhanced significantly after 120 h comparing with preadipocytes at 0 h. The results of RT-qPCR showed that the combined use of oleic acid and insulin stimulated the expression of peroxisome proliferator-activated receptor-gamma (PPARγ) continuously companying the differentiation of preadipocytes, and toped at 7 d which significantly higher than other groups (P<0.01). The expression levels of KLF2, KLF3, KLF4, KLF6, KLF7 and KLF15 in adipocytes were significantly (P<0.05) or extremely significantly (P<0.01) higher than those in preadipocytes. While the expression of KLF3, KLF6 and KLF15 were topped at 5 d, the KLF2 and KLF4 toped at 7 d. However, the KLF7 expressed most at 3 d. For the other KLF individuals, the expression levels of KLF5, KLF8, KLF9, KLF10 and KLF12 in preadipocytes were extremely significantly higher (P<0.01) than those in adipocytes. The expression of KLF8, KLF10 and KLF12 bottomed at 5 d, while that of the KLF5 and KLF9 bottomed at 7 d. Correlation analysis showed that KLF individual significantly (P<0.05) correlated with each other across cell differentiation. KLF12 was strongly correlated with 6 individuals, followed by KLF4 and KLF9 both of which were significantly correlated with 5 individuals. However, KLF2 was not significantly correlated with other individuals. 【Conclusion】 In this study, the expression patterns of KLFs during goat preadipocytes differentiation were clarified, and also the correlations among KLF individuals. These results provided important basic data for elucidating the molecular mechanism of goat preadipocytes differentiation.

    Effects of Rearing Modes on Nocturnal Feeding Behavior in Goslings
    HE Hang,XIONG ZiBiao,SHOU YaXiao,XIE Qing,XIE HeFang
    Scientia Agricultura Sinica. 2019, 52(13):  2352-2358.  doi:10.3864/j.issn.0578-1752.2019.13.013
    Abstract ( 712 )   HTML ( 25 )   PDF (339KB) ( 878 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】 This study was carried out to investigate the effects of rearing modes on nocturnal feeding behavior of goslings aged from 0 to 3 weeks, and to analyze the relationship between nocturnal feeding behavior and production performance. 【Method】 A total of 120 Sichuan white geese at 1 day (the initial body weight was (97.78±2.67) g), with equal amount of male and female, were randomly allocated into two groups, net rearing (NR) and floor rearing (FR) , with 6 replicates and 10 geese each. The experiment was conducted at the Livestock and Poultry Breeding Base of Southwest University in August 2016; the experiment lasted for 21 days. And the average temperature during the experiment period was (28.72±2.16)℃, and the relative humidity was (85.76±8.73)%. According to the nutritional needs of the US NRC (1994) geese, the diet has a metabolic energy of 11.97 MJ·kg -1and a crude protein value of 20.43%. Geese had access to feed and water ad libitum in the experiment period. We recorded daily feed intake during the trial and weighed at 7 days, 14 days, and 21 days. And according to the agricultural industry standard of the People’s Republic of China - Poultry Production Performance Terminology and Metric Statistical Method (NY/T 823-2004) to determine the average daily feed intake, average daily gain and feed-to-weight ratio during the experiment period. And the nocturnal feeding behavior of goslings at days 19, 20 and 21, from 18:00 to the next day 6:00, was used infrared high-definition surveillance camera system for video capture. After the video was collected, the video software (VSPalyer V7.2.0, Hangzhou Hikvision Digital Technology Co., Ltd.) was used to improve the nocturnal behavior observation method of chicken and mice, and set to a video segment at intervals of 10 minutes. The totals of video segments were 72. We observed the nocturnal feeding behavior of the geese and recorded the nocturnal feeding behavior time of the geese. 【Result】 Data showed that the duration of nocturnal feeding behavior and the average daily feed intake of geese in group NR were highly significant difference from those of animals in group FR (P<0.01), and the average daily gain and final weight of NR was significantly higher than that of FR (P<0.05), while there were no significant difference in the feed/gain ratio and initial weight (P>0.05) . Correlation analysis revealed that there was a significant positive correlation between nocturnal feeding behavior and production performance except for feed/gain ratio in group FR. The correlation coefficients between the duration of nocturnal feeding behavior and the average daily feed intake, the average daily gain, and feed/gain ratio were 0.796 (P<0.05), 0.807 (P<0.05), and -0.816 (P<0.05) in group NR, and 0.950 (P<0.01), 0.801 (P<0.05), and -0.573 (P>0.05) in group FR, respectively. Regression analysis, with the duration of nocturnal feeding behavior as the independent variable, also demonstrated that there was either a linear regression or a quadratic regression between nocturnal feeding behavior and production performance except feed/gain ratio in group FR. The regression equations of average daily feed intake y1 (g·d -1), average daily gain y2 (g·d -1) and feed/gain ratio y3 and nocturnal feeding behavior time x1 (min/12h) were y2=-222.70+ 29.96x1-0.78x 21(R 2=0.956, P=0.009), y2=6.73+1.46x1 (R 2=0.650, P=0.043), y3=2.83-0.05x1 (R 2=0.654, P=0.050) in group NR, respectively. Since there was no significant correlation between the feed/gain ratio of the FR group and the duration of the nocturnal feeding behavior, it was impossible to establish a regression equation. Therefore, the regression equations of average daily feed intake y4 (g·d -1), average daily gain y5 (g·d -1) and nocturnal feeding behavior time x2 (min/12h) were y4=-10.10+4.13x2 (R 2=0.904, P=0.004), y5=-39.82+4.83x2 (R 2=0.644, P=0.045) in group FR, respectively. 【Conclusion】 This finding suggested that the duration of nocturnal feeding behavior of goslings in group NR should be higher than that of animals in group FR, and that the nocturnal feeding behavior could increase the production performance of geese. Therefore, we recommended the net rearing methods as well as ensuring the supplies of nocturnal food at night in production were used to meet the nocturnal feeding activities of goslings.

    Analysis of Amino Acid Composition and Six Native Alfalfa Cultivars
    SUN JuanJuan, A LaMuSi, ZHAO JinMei, XUE YanLin, YU LinQing, YU Zhu, ZHANG YingJun
    Scientia Agricultura Sinica. 2019, 52(13):  2359-2367.  doi:10.3864/j.issn.0578-1752.2019.13.014
    Abstract ( 1259 )   HTML ( 34 )   PDF (370KB) ( 1041 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】 Six domestic alfalfa cultivars (Zhongcao No.3, Gannong No.1, Longmu No. 806, Zhongmu No.2, Xinjiang Big Leaf, Gongnong No.1) were used, amino acid content and the nutrition evaluation of alfalfa were studied, to provide the scientific basis for utilization and further research on native alfalfa germplasm resources or alfalfa resources development and utilization. 【Method】 Randomized block design with three replications was used. Different cultivars were planted in different experimental plot, the experimental plot area was 30 m 2. The first year, first cut alfalfa which in the early flower stage were used. After 20 min heated at 105℃ and 48 h heated at 65℃, alfalfa were smashed to pass through a screen of 60 meshes. The samples were hydrolyzed by HCl and analyzed by automatic amino acid analyzer. Amino acid constituents and contents were analyzed. Alfalfa essential amino acid composition were compared with FAO/WHO amino acid pattern spectrum and FAO/WHO ideal protein standards. Ratio of essential amino acid (RAA), ratio coefficient (RC), score of RC (SRC) or essential amino acid index (EAAI) were calculated to evaluate the nutritional value. 【Result】 All of six domestic alfalfa cultivars contained 17 amino acids, 7 essential amino acids and 9 medicinal amino acids. Except Asp, Cys, Pro, F and (S+F)/B were significant difference among six cultivars, other amino acids compositions had no significant differences. The content of total amino acids in alfalfa were ranged from 14.85% to 19.48%, essential amino acids were range from 5.35% to 6.93%, non-essential amino acids were range from 9.50% to 12.55%, medicinal amino acids was greater than 60%. The content of total amino acids, essential amino acids and non-essential amino acids were highest in Xinjiang Big Leaf alfalfa. The ratio of sweet and fresh taste to bitter taste amino acid was above 1.8. Only Met+Cys were lower than FAO/WHO amino acid pattern. E/T was ranged from 35% to 36% and E/N was ranged from 54% to 57%, which were a little lower than FAO/WHO ideal protein standards. SRC was ranged from 73 to 74, and EAAI of all alfalfa was closed to 1. 【Conclusion】 There were abundant species and high content amino acid in alfalfa. The essential amino acids were relatively balanced and reasonable. Alfalfa were good protein sources, which also has medicinal value. The first limiting amino acid was Met+Cys. When used as vegetables, it is recommended that something which has high content of Met+Cys were used as complementary food to improve their nutritional value.

    Effect of Dietary α-Linolenic Acid Levels on Physiological Function of Apis mellifera ligustica Worker Bee Larvae
    YU Jing,ZHANG WeiXing,MA LanTing,XU BaoHua
    Scientia Agricultura Sinica. 2019, 52(13):  2368-2378.  doi:10.3864/j.issn.0578-1752.2019.13.015
    Abstract ( 595 )   HTML ( 8 )   PDF (471KB) ( 849 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】 The objective of this study is to explore the effect of dietary α-linolenic acid levels on the antioxidant activity and immunity of Apis mellifera ligustica worker bee larvae. 【Method】 Twelve hundreds 1-day-old worker bee larvae were randomly divided into 5 group, with 5 replicates in each group and 48 worker bee larvae in each replicate. The control group was fed with basic diets without α-linolenic acid, and the 4 treatment groups were fed experimental diets containing different amounts of α-linolenic acid (0.02%, 0.04%, 0.06%, and 0.08%). According to the indoor feeding in vitro method, the 1-day-old worker bee larvae were moved to a 24-well cell culture plate with 200 μL diet at suitable temperature. The larvae were moved by worm-moving needle. The culture plate was placed in a constant temperature incubator (temperature 33℃, relative humidity 55%), the diet was changed daily during the test. Feeding until the end of the 6th day or the beginning of the 7th day, when the larvae started to stand upright or defecate, the larvae were moved to the 24-well cell culture plate covered with sterilized paper in advance to prepare for pupation. From the 1st day of feeding, the death number of larvae and pupae was checked and recorded every day, and the dead individuals were removed in time until all adult emerged. The number of undead pupae and emergence new bees was recorded, and pupation rate and emergence rate were calculated. The 5-, 6- and 7-day-old worker bee larvae were used to measure antioxidant, immune, lipid metabolism indexes and related gene expression. 【Result】 When the addition level of α-linolenic acid in the diet was 0.02% and 0.04%, the pupation rate and emergence rate were significantly higher than those in other treatment groups (P<0.05), while the contents of triglyceride (TG), total cholesterol (TC) and low density lipoprotein (LDL) in the hemolymph of worker bee larvae were significantly lower than those of the control group, the content of high density lipoprotein (HDL) was significantly higher than that of the control group (P<0.05). Compared with the control group, the activity of superoxide dismutase (SOD) was significantly increased, while the content of malondialdehyde (MDA) was significantly decreased when the addition level of α-linolenic acid was 0.04% (P<0.05). When the addition level of α-linolenic acid was 0.02%, 0.04% and 0.06%, the activities of lysozyme and phenoloxidase (PO) of 6-day-old worker bee larvae were significantly higher than those in the control group (P<0.05). When the addition level of α-linolenic acid was 0.04%, the activities of fatty acid synthase (FAS) and acetyl CoA carboxylase (ACC) of 6-day-old worker bee larvae were significantly lower than those in the control group (P<0.05). When the addition level of α-linolenic acid was 0.04%, the relative expression levels of lysozyme and PO of 5- and 7-day-old worker bee larvae were significantly higher than those in the control group, but when the addition level of α-linolenic acid was 0.08%, the relative expression level of lysozyme was significantly decreased (P<0.05). 【Conclusion】 Different dietary supplementation levels of α-linolenic acid have significant effects on antioxidant activity and immunity of A. m. ligustica worker bee larvae, and the appropriate addition level of α-linolenic acid in larval diet is 0.02%-0.04%.