Scientia Agricultura Sinica ›› 2026, Vol. 59 ›› Issue (5): 1128-1140.doi: 10.3864/j.issn.0578-1752.2026.05.016

• ANIMAL SCIENCE·VETERINARY SCIENCE • Previous Articles    

Molecular Mechanism of USP18 Facilitating Ferroptosis by Suppressing GPX4 Ubiquitination and Degradation in Duck Granulosa Cells

CHEN YaRu1(), WANG Lei2, FU Ming1, HUANG Tao1, ZHANG Hao1, LIANG ZhenHua1, PI JinSong1, WU Yan1()   

  1. 1 Institute of Animal Husbandry and Veterinary, Hubei Academy of Agricultural Science/Hubei Innovation Center of Agricultural Science and Technology/Hubei Key Lab of Animal Embryo Technology and Molecular Breeding, Wuhan 430064
    2 Wuhan Green Giant Agriculture & Animal Husbandry Company Limited, Wuhan 432200
  • Received:2025-09-07 Accepted:2025-10-30 Online:2026-03-01 Published:2026-03-06
  • Contact: WU Yan

RichHTML

0

PDF

3

Abstract:

【Background】 Follicle development is characterized by a unique hierarchical progression in poultry, regulated by autocrine, paracrine, growth factors, and multiple functional genes. Granulosa cells are the most abundant functional somatic cells within the follicle, and their survival directly determines follicular growth, development, and maturation. Ferroptosis, a newly identified type of regulated cell death, has been closely linked to follicular development. USP18 plays an important regulatory role in ferroptosis, however, its function in duck granulosa cells remains unclear. 【Objective】 The objective of this study was to investigate the molecular regulatory mechanisms of USP18 in the process of ferroptosis in duck granulosa cells of laying ducks, so as to provide a theoretical basis and molecular targets for the genetic improvement of egg production traits in poultry. 【Method】 Four high-yield and four low-yield laying ducks aged 300-day-old were selected. Prehierarchical follicular tissues were collected from each group. The expression level of USP18 was assessed using quantitative real-time PCR (qRT-PCR) and Western blotting in follicles of high-yield and low-yield laying ducks. Granulosa cells isolated from prehierarchical follicles were transfected with the interference fragment of USP18. The effects of USP18 on cell viability were evaluated using the CCK-8 assay and Calcein-AM/PI double staining. The effects of USP18 on intracellular oxidative status were evaluated using the reactive oxygen species (ROS) detection kit and enzyme-linked immunosorbent assay (ELISA). The impact of USP18 on ferroptosis was examined using the mitochondrial membrane potential assay kit, the lipid peroxidation fluorescent probe, FerroOrange iron probe, and Prussian blue staining. Furthermore, the interaction between USP18 and GPX4 protein, as well as GPX4 protein expression, were analyzed by immunofluorescence, co-immunoprecipitation, and Western blotting.【Result】 The expression level of USP18 in prehierarchical follicles of high-yield ducks was significantly higher than that in low-yield ducks (P<0.01); USP18 knockdown significantly reduced granulosa cell viability (P<0.01), inhibited cell survival (P<0.05), promoted ROS accumulation (P<0.01), increased malondialdehyde (MDA) content (P<0.01), and suppressed the activities of superoxide dismutase (SOD) and catalase (CAT) (P<0.01); USP18 knockdown notably elevated lipid peroxidation levels (P<0.05), decreased mitochondrial membrane potential (P<0.05), enhanced mitochondrial membrane permeability (P<0.01), increased intracellular iron levels and iron deposition (P<0.01), increased the expression of ferroptosis suppressor markers ACSL4 and GPX4, and suppressed the expression of TFR1 (P<0.01); the interaction relationship between USP18 and GPX4 was confirmed by co-immunoprecipitation and immunofluorescence assays. Western blotting and co-immunoprecipitation analyses further demonstrated that USP18 knockdown promoted ubiquitination and degradation of GPX4 protein.【Conclusion】 USP18 was highly expressed in the prehierarchical follicles of high-yield laying ducks. USP18 knockdown significantly increased oxidative stress levels and induced ferroptosis in duck granulosa cells. Moreover, USP18 was found to interact with GPX4 protein, and USP18 knockdown promoted ubiquitination and degradation of GPX4 protein. In summary, USP18 modulated ferroptosis in duck granulosa cells by suppressing the ubiquitination and degradation of GPX4.

Key words: duck, granulosa cells, USP18, GPX4, ferroptosis

Table 1

Experimental animal information"

试验样本
Test sample		 300 d产蛋数
Egg production in 300 days (No.)		 体重
Bodyweight
(kg)
高产蛋鸭1 High-yield laying duck 1 130 1.65
高产蛋鸭2 High-yield laying duck 2 145 1.79
高产蛋鸭3 High-yield laying duck 3 138 1.68
高产蛋鸭4 High-yield laying duck 4 140 1.58
低产蛋鸭1 Low-yield laying duck 1 84 1.75
低产蛋鸭2 Low-yield laying duck 2 86 1.64
低产蛋鸭3 Low-yield laying duck 3 80 1.60
低产蛋鸭4 Low-yield laying duck 4 75 1.67

Table 2

Primer information"

基因Gene 引物序列Primer sequence 产物长度Product length (bp)
β-actin F: CCGCTCTATGAAGGCTACGC
R: CTCTCGGCTGTGGTGGTGAA		 105
FLAG-USP18 F: CCTGAGGCAAATCTGTCAGTC
R: CGAACACCTGAATCAAGGAGTTAATGTGCGCCGTGCCGGCCC		 1281
HA-GPX4 F: TAGCCCGGGCGGATCCAAGCTTATGAGCTTTAG
R: GACTCGAGAGATCTGTCGACGATATCGAATTCGTGCTACCTCTAG		 594
ACSL4 F: CATCCCTGGAGCAGATACTCT
R: TCACTTAGGATTTCCCTGGTCC		 98
GPX4 F: CCAGCCCCTACACCTACCTC
R: GCTGGGCTTGTCAGTTTCTC		 106
TFR1 F: AACTCAGCAAAGTCTGGCGT
R: GACCCCCAATACACCGCATA		 87
USP18 F: CCTGAGGCAAATCTGTCAGTC
R: CGAACACCTGAATCAAGGAGTTA		 124

Fig. 1

The expression of USP18 in prehierarchical follicles of high- and low-yield laying ducks A: qRT-PCR analysis of USP18 mRNA expression in prehierarchical follicular tissues of high‐ and low‐yield laying ducks（n=3）; B-C: Western blotting analysis（B）and quantification analysis（C）of USP18 protein expression in prehierarchical follicular tissues of high‐ and low‐yield laying ducks（n=3）. * means significant difference, P<0.05, and ** means extremely significant difference, P<0.01. The same as below"

Fig. 2

Effect of USP18 on oxidative stress levels in duck granulosa cells A: Immunofluorescence identification of duck granulosa cells; B:qRT-PCR analysis of USP18 mRNA interference efficiency; C, D: Western blotting analysis（C）and quantification analysis（D）of USP18 protein expression interference efficiency; E-F: Representative images (E) and quantification analysis (F) of cell viability in duck granulosa cells silencing USP18（n=3）; G, H: Representative micrographs (G) and quantification analysis (H) of Calcein-AM/PI double staining in duck granulosa cells silencing USP18（n=3）; I, J: Fluorescence intensity (I) and quantification analysis (J) of ROS in duck granulosa cells silencing USP18（n=3）; K-M: The content of MDA (K), SOD (L), CAT (M) in duck granulosa cells silencing USP18（n=3）"

Fig. 3

Effect of USP18 on ferroptosis in duck granulosa cells A, B: Lipid peroxidation analysis (A) and quantification (B) of C11-BODIPY 581/591 fluorescence in duck granulosa cells（n=3）; C, D: Mitochondrial membrane potential (C) and quantification (D) of the JC-1 red/green fluorescence ratio in duck granulosa cells（n=3）; E, F: Mitochondrial permeability transition pore (MPTP) (E) and quantification (F) of MPTP in duck granulosa cells（n=3）; G, H: Representative micrographs (G) and quantification analysis (H) of FerroOrange staining in duck granulosa cells（n=3）; I, J: Representative micrographs (I) and quantification analysis (J) of Prussian blue staining in duck granulosa cells（n=3）; K: qRT-PCR analysis of ACSL4, GPX4, TFR1 mRNA expression in duck granulosa cells（n=3）; L, M: Western blotting analysis (L) and quantification analysis (M) of ACSL4, GPX4, TFR1 protein expression in duck granulosa cells（n=3）"

Fig. 4

Interaction between USP18 and GPX4 in duck granulosa cells A: Co-immunoprecipitation analysis of the interaction between USP18 and GPX4 proteins in duck granulosa cells; B: Immunofluorescence analysis of the localization of USP18 and GPX4 in duck granulosa cells"

Fig. 5

Effects of USP18 on ubiquitin-proteasome degradation of GPX4 protein A, B: Western blotting analysis (A) and quantification analysis (B) of GPX4 protein expression in duck granulosa cells treated with si-USP18 and CHX; C, D: Western blotting analysis (C) and quantification analysis (D) of GPX4 protein expression in duck granulosa cells treated with si-USP18 and MG132; E: The ubiquitination level of GPX4 in duck granulosa cells silencing USP18"

[1]
孙雪. NF2/SWH通路调控鸡前等级卵巢颗粒细胞增殖、分化与凋亡的分子机制[D]. 长春: 吉林农业大学, 2023.
SUN X. The molecular mechanism of NF2/SWH pathway regulating granulosa cell proliferation, differentiation and apoptosis of the ovarian prehierarchical follicles in hen[D]. Changchun: Jilin Agricultural University, 2023. (in Chinese)
[2]
LI D Y, NING C Y, ZHANG J M, WANG Y J, TANG Q Z, KUI H, WANG T, HE M N, JIN L, LI J, et al. Dynamic transcriptome and chromatin architecture in granulosa cells during chicken folliculogenesis. Nature Communications, 2022, 13: 131.

doi: 10.1038/s41467-021-27800-9 pmid: 35013308
[3]
GUO Y Y, ZHANG Y H, WANG Y, CHEN Q Y, SUN Y, KANG L, JIANG Y L. Phosphorylation of LSD1 at serine 54 regulates genes involved in follicle selection by enhancing demethylation activity in chicken ovarian granulosa cells. Poultry Science, 2024, 103(8): 103850.
[4]
ZHANG W H, CHEN X J, NIE R X, GUO A X, LING Y, ZHANG B, ZHANG H. Single-cell transcriptomic analysis reveals regulative mechanisms of follicular selection and atresia in chicken granulosa cells. Food Research International, 2024, 198: 115368.

doi: 10.1016/j.foodres.2024.115368
[5]
WU H, HAN Y X, LIU J K, ZHAO R, DAI S Z, GUO Y J, LI N, YANG F, ZENG S M. The assembly and activation of the PANoptosome promote porcine granulosa cell programmed cell death during follicular atresia. Journal of Animal Science and Biotechnology, 2024, 15(1): 147.
[6]
WANG F X, LIU Y F, NI F D, JIN J N, WU Y Q, HUANG Y, YE X H, SHEN X L, YING Y, CHEN J H, et al. BNC 1 deficiency-triggered ferroptosis through the NF2-YAP pathway induces primary ovarian insufficiency. Nature Communications, 2022, 13: 5871.

doi: 10.1038/s41467-022-33323-8
[7]
MISHIMA E, NAKAMURA T, DOLL S, PRONETH B, FEDOROVA M, PRATT D A, FRIEDMANN ANGELI J P, DIXON S J, WAHIDA A, CONRAD M. Recommendations for robust and reproducible research on ferroptosis. Nature Reviews Molecular Cell Biology, 2025, 26(8): 615-630.

doi: 10.1038/s41580-025-00843-2 pmid: 40204928
[8]
JIANG X J, STOCKWELL B R, CONRAD M. Ferroptosis: mechanisms, biology and role in disease. Nature Reviews Molecular Cell Biology, 2021, 22(4): 266-282.

doi: 10.1038/s41580-020-00324-8 pmid: 33495651
[9]
LI X Y, LIN Y Y, CHENG X Y, YAO G X, YAO J F, HU S G, ZHU Q L, WANG Y, DING Y, LU Y, et al. Ovarian ferroptosis induced by androgen is involved in pathogenesis of PCOS. Human Reproduction Open, 2024, 2024(2): hoae013.
[10]
ZHANG J H, SU T T, FAN Y, CHENG C, XU L P. Spotlight on iron overload and ferroptosis: Research progress in female infertility. Life Sciences, 2024, 340: 122370.

doi: 10.1016/j.lfs.2023.122370
[11]
ZHOU J Q, LIN L, LIU L P, WANG J B, XIA G L, WANG C. The transcriptome reveals the molecular regulatory network of primordial follicle depletion in obese mice. Fertility and Sterility, 2023, 120(4): 899-910.

doi: 10.1016/j.fertnstert.2023.05.165
[12]
LIN S, JIN X, GU H, BI F F. Relationships of ferroptosis-related genes with the pathogenesis in polycystic ovary syndrome. Frontiers in Medicine, 2023, 10: 1120693.

doi: 10.3389/fmed.2023.1120693
[13]
Editorial Department of the Journal. Towards an improved understanding of ubiquitylation. Nature Structural & Molecular Biology, 2024, 31(2): 203-204.

doi: 10.1038/s41594-024-01240-7
[14]
HAN S S, YU C L, QIU M H, XIONG X, PENG H, SONG X Y, HU C M, ZHANG Z R, XIA B, YANG L, et al. USP 13 regulates ferroptosis in chicken follicle granulosa cells by deubiquitinating ATG7. Poultry Science, 2024, 103(11): 104209.
[15]
ZHANG Z Y, ZHENG Z Q, CHEN Y B, NIU X G, OUYANG T H, WANG D L. Mechanism of USP18-mediated NCOA4 m6A modification via maintaining FTO stability in regulating ferritinophagy- mediated ferroptosis in cerebral ischemia-reperfusion injury. Molecular Neurobiology, 2025, 62(3): 3848-3862.

doi: 10.1007/s12035-024-04494-w
[16]
YE S T, CHEN J X, ZHENG Y, HE M M, ZHANG Y Q, CHENG Y, LENG Y R, WU E Y, KONG L Y, ZHANG H. Targeting USP18 overcomes acquired resistance in hepatocellular carcinoma by regulating NCOA4 deISGylation and ferroptosis. Cell Death & Disease, 2025, 16: 448.
[17]
ZHOU Q Y, YU H F, CHEN Y X, REN J Y, LU Y, SUN Y. The CRL3(KCTD10) ubiquitin ligase-USP18 axis coordinately regulates cystine uptake and ferroptosis by modulating SLC7A11. PNAS 2024, 121(28): e2320655121.
[18]
YANG H, ZHAO L F, KONG W W, LIU S S, ZHOU Q, LANG X B, LAN L, WANG Y C. USP18 promotes ferroptosis in lipopolysaccharide-induced human kidney organoids by stabilizing STING1. Cell Biology and Toxicology, 2025, 41(1): 126.
[19]
DONG B W, JIANG Y Y, SHI B D, ZHANG Z Q, ZHANG Z W. Selenomethionine alleviates decabromodiphenyl ether-induced oxidative stress and ferroptosis via the NRF2/GPX4 pathway in the chicken brain. Journal of Hazardous Materials, 2024, 465: 133307.

doi: 10.1016/j.jhazmat.2023.133307
[20]
FAN Y, ZHANG C S, ZHU G Y. Profiling of RNA N6- methyladenosine methylation during follicle selection in chicken ovary. Poultry Science, 2019, 98(11): 6117-6124.

doi: 10.3382/ps/pez277
[21]
LIN Z Z, GONG Y R, SUN H, YANG C W, TANG Y, YIN L Q, ZHANG D H, WANG Y, YU C L, LIU Y P. Lipid deposition and progesterone synthesis are increased by miR-181b-5p through RAP1B/ERK1/2 pathway in chicken granulosa cells. Journal of Agricultural and Food Chemistry, 2023, 71(34): 12910-12924.

doi: 10.1021/acs.jafc.3c03178 pmid: 37602643
[22]
STRINGER J M, ALESI L R, WINSHIP A L, HUTT K J. Beyond apoptosis: Evidence of other regulated cell death pathways in the ovary throughout development and life. Human Reproduction Update, 2023, 29(4): 434-456.

doi: 10.1093/humupd/dmad005 pmid: 36857094
[23]
LIU M, WU K M, WU Y K. The emerging role of ferroptosis in female reproductive disorders. Biomedicine & Pharmacotherapy, 2023, 166: 115415.

doi: 10.1016/j.biopha.2023.115415
[24]
AGRATA R, KOMANDER D. Ubiquitin: A structural perspective. Molecular Cell, 2025, 85(2): 323-346.

doi: 10.1016/j.molcel.2024.12.015
[25]
POPOVIC D, VUCIC D, DIKIC I. Ubiquitination in disease pathogenesis and treatment. Nature Medicine, 2014, 20(11): 1242-1253.

doi: 10.1038/nm.3739 pmid: 25375928
[26]
MIYAUCHI S, ARIMOTO K I, LIU M D, ZHANG Y, ZHANG D E. Reprogramming of tumor-associated macrophages via NEDD4- mediated CSF1R degradation by targeting USP18. Cell Reports, 2023, 42(12): 113560.
[27]
ARIMOTO K I, MIYAUCHI S, TROUTMAN T D, ZHANG Y, LIU M D, STONER S A, DAVIS A G, FAN J B, HUANG Y J, YAN M, GLASS C K, ZHANG D E. Expansion of interferon inducible gene pool via USP18 inhibition promotes cancer cell pyroptosis. Nature Communications, 2023, 14: 251.

doi: 10.1038/s41467-022-35348-5
[28]
JIANG Z Y, SHEN J, DING J, YUAN Y, GAO L L, YANG Z C, ZHAO X. USP18 mitigates lipopolysaccharide-induced oxidative stress and inflammation in human pulmonary microvascular endothelial cells through the TLR4/NF-κB/ROS signaling. Toxicology in Vitro, 2021, 75: 105181.

doi: 10.1016/j.tiv.2021.105181
[29]
SONG M Y, YI F, ZENG F Y, ZHENG L, HUANG L, SUN X Y, HUANG Q Y, DENG J, WANG H, GU W P. USP18 stabilized FTO protein to activate mitophagy in ischemic stroke through repressing m6A modification of SIRT6. Molecular Neurobiology, 2024, 61(9): 6658-6674.

doi: 10.1007/s12035-024-04001-1 pmid: 38340205
[30]
JIA M T, QIN D H, ZHAO C Y, CHAI L, YU Z X, WANG W W, TONG L, LV L, WANG Y Y, REHWINKEL J, YU J M, ZHAO W. Redox homeostasis maintained by GPX4 facilitates STING activation. Nature Immunology, 2020, 21(7): 727-735.

doi: 10.1038/s41590-020-0699-0 pmid: 32541831
[31]
XUE Q, YAN D, CHEN X, LI X F, KANG R, KLIONSKY D J, KROEMER G, CHEN X, TANG D L, LIU J B. Copper-dependent autophagic degradation of GPX4 drives ferroptosis. Autophagy, 2023, 19(7): 1982-1996.

doi: 10.1080/15548627.2023.2165323
[32]
URSINI F, MAIORINO M, VALENTE M, FERRI L, GREGOLIN C. Purification from pig liver of a protein which protects liposomes and biomembranes from peroxidative degradation and exhibits glutathione peroxidase activity on phosphatidylcholine hydroperoxides. Biochimica et Biophysica Acta (BBA) - Lipids and Lipid Metabolism, 1982, 710(2): 197-211.

doi: 10.1016/0005-2760(82)90150-3
[33]
HUANG B, WANG H, LIU S, HAO M, LUO D, ZHOU Y, HUANG Y, NIAN Y, ZHANG L, CHU B, YIN C Q. Palmitoylation-dependent regulation of GPX4 suppresses ferroptosis. Nature Communications, 2025, 16: 867.

doi: 10.1038/s41467-025-56344-5
[34]
ZHANG J F, QIU Q H, WANG H Y, CHEN C, LUO D W. TRIM46 contributes to high glucose-induced ferroptosis and cell growth inhibition in human retinal capillary endothelial cells by facilitating GPX4 ubiquitination. Experimental Cell Research, 2021, 407(2): 112800.
[35]
ZHANG E H, WANG Y C, ZHANG H L, LI X M, SU Y J, CUI J N, XU R, MAO X, SANG M M, LIN Z H, ZHOU X R. Resveratrol induces ferroptosis in triple-negative breast cancer through NEDD4L- mediated GPX4 ubiquitination and degradation. Free Radical Biology and Medicine, 2025, 235: 231-247.

doi: 10.1016/j.freeradbiomed.2025.04.052
[36]
FAN Y Z, WANG Y Z, DAN W C, ZHANG Y L, NIE L, MA Z Q, ZHUANG Y X, LIU B, LI M X, LIU T J, et al. PRMT5-mediated arginine methylation stabilizes GPX4 to suppress ferroptosis in cancer. Nature Cell Biology, 2025, 27(4): 641-653.

doi: 10.1038/s41556-025-01610-3
[1] TAO ZhiYun, XU WenJuan, LU LiZhi, SONG WeiTao, ZHANG ShuangJie, LIU HongXiang, WANG ZhiCheng, GU HaoTian, ZHU ChunHong, LI HuiFang. Atlas Construction and Regulatory Analysis of Duck Testicular Cell Development [J]. Scientia Agricultura Sinica, 2026, 59(2): 441-458.
[2] LIU HongXiang, ZHANG XuePing, WANG YiFei, WANG ZhiCheng, GU HaoTian, SONG WeiTao, TAO ZhiYun, XU WenJuan, ZHANG ShuangJie, LU LiZhi, LI HuiFang, ZHU ChunHong. Genome-Wide Association Study of Egg Production Traits in Jinding Duck [J]. Scientia Agricultura Sinica, 2025, 58(15): 3145-3158.
[3] WU YongBao, TANG Jing, CAO JunTing, WANG QiMeng, XIE Ming, ZHOU ZhengKui, HOU ShuiSheng, WEN ZhiGuo. Effects of Methionine Supplementation on Growth Performance, Carcass Trait, and Plasma Biochemical Indice of Growing Pekin Ducks Fed a Low-Energy and Low-Protein Diet [J]. Scientia Agricultura Sinica, 2025, 58(12): 2475-2486.
[4] XU YuanYuan, HUANG LiQing, LU XingRong, FENG Chao, SHANG JiangHua. Effects of β-mercaptoethanol on Rapamycin Induced Autophagy, Apoptosis and Steroid Hormone Synthesis in Buffalo Granulosa Cells [J]. Scientia Agricultura Sinica, 2025, 58(11): 2265-2274.
[5] ZHANG HuaPeng, ZHANG QingZe, HE Fan, QI MengFan, FU BinBin, LI QingChun, LI MengXun, MA LiPeng, LIU Yi, HUANG Tao. Cloning and Identification of Differentially Expressed lncRNAs in Follicles of Meishan Pigs and Duroc Pigs with Their Correlation Analysis with miRNAs [J]. Scientia Agricultura Sinica, 2024, 57(9): 1807-1819.
[6] MENG ZhaoYi, WANG YunLu, YAO YiLong, XI GuangYin, NIU JiaQiang, SOLANGSIZHU, GUO Min, XU YeFen. lncRNA-MSTRG.7889.1 Competitively Binds to bta-miR-146a Targeting Smad4 to Regulate Apoptosis of Yak Granulosa Cells [J]. Scientia Agricultura Sinica, 2024, 57(4): 797-809.
[7] SUN YanFa, WU Qiong, LIN RuLong, CHEN HongPing, GAN QiuYun, SHEN Yue, WANG YaRu, XUE PengFei, CHEN FeiFan, LIU JianTao, ZHOU ChenXin, LAN ShiShi, PAN HaoZhe, DENG Fan, YUE Wen, JIANG XiaoBing, LI Yan. Genome-Wide Association Study of Egg Quality Traits in Longyan Shan-Ma Duck [J]. Scientia Agricultura Sinica, 2023, 56(3): 572-586.
[8] JING LiQuan, LI Fan, ZHAO YiHan, WANG XunKang, ZHAO FuCheng, LAI ShangKun, SUN XiaoLin, WANG YunXia, YANG LianXin. Research Progress on the Carbon and Nitrogen Sink of Duckweed Growing in Paddy and Its Effects on Rice Yield [J]. Scientia Agricultura Sinica, 2023, 56(23): 4717-4728.
[9] WU ShiHao, HUANG TianRan, HUANG Ming. Effect of Heat Treatment on the Warmed-Over Flavor of Nanjing Water-Boiled Salted Duck Detected by HS-SPME-GC-MS Technology and Electronic Nose [J]. Scientia Agricultura Sinica, 2023, 56(17): 3435-3451.
[10] GUO ZeYuan, DU ZhangSheng, ZHANG YaQi, CHEN ChunLu, MA XiaoYan, CHENG Ying, WANG Kai, LÜ LiHua. Effects of Smad7-Mediated TGF-β Signaling Pathway on Proliferation of Sheep Granulosa Cells [J]. Scientia Agricultura Sinica, 2023, 56(13): 2597-2608.
[11] LIU YuFang,CHEN YuLin,ZHOU ZuYang,CHU MingXing. miR-221-3p Regulates Ovarian Granulosa Cells Apoptosis by Targeting BCL2L11 in Small-Tail Han Sheep [J]. Scientia Agricultura Sinica, 2022, 55(9): 1868-1876.
[12] WANG JiaMin,SHI JiaChen,MA FangFang,CAI Yong,QIAO ZiLin. Effects of Soy Isoflavones on the Proliferation and Apoptosis of Yak Ovarian Granulosa Cells [J]. Scientia Agricultura Sinica, 2022, 55(8): 1667-1675.
[13] WU Yan,ZHANG Hao,LIANG ZhenHua,PAN AiLuan,SHEN Jie,PU YueJin,HUANG Tao,PI JinSong,DU JinPing. circ-13267 Regulates Egg Duck Granulosa Cells Apoptosis Through Let-7-19/ERBB4 Pathway [J]. Scientia Agricultura Sinica, 2022, 55(8): 1657-1666.
[14] ZHANG YaNan,JIN YongYan,ZHUANG ZhiWei,WANG Shuang,XIA WeiGuang,RUAN Dong,CHEN Wei,ZHENG ChunTian. Comparison of Shell Mechanical Property, Ultrastructure and Component Between Chicken and Duck Eggs [J]. Scientia Agricultura Sinica, 2022, 55(24): 4957-4968.
[15] LI LiYing,HE YingTing,ZHONG YuYi,ZHOU XiaoFeng,ZHANG Hao,YUAN XiaoLong,LI JiaQi,CHEN ZanMou. CTNNB1 Regulates the Function of Porcine Ovarian Granulosa Cells [J]. Scientia Agricultura Sinica, 2022, 55(15): 3050-3061.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
京ICP备09089781号-30
Copyright 2018 © Editorial office of Scientia Agricultura Sinica
Tel: 86-010-82106279    E-mail: zgnykx@mail.caas.net.cn
Supported by Beijing Magtech Co.Ltd