Abstract: 【Objective】 MicroRNAs (miRNAs) are a conserved class of non-coding 20-22 nt small RNAs. miRNAs have been reported in many viruses, animals and plants such as Mareks diseased virus, fruit flies, zebra fish, humans and Arabidopsis so far. MiRNAs regulate gene expression by binding to mRNA at post-transcriptional levels, leading to mRNA inhibition or degradation. MiRNAs regulate a variety of biological processes, including cell proliferation, differentiation, metabolism and apoptosis. The purpose of this experiment is to understand the potential biological function of miR-10 in Hyalomma asiaticum. To obtain the precursor and mature of microRNA-10 (miR-10), its relative expression and the biologic significance in different developmental stages and various tissues from Hyalomma asiaticum were analyzed, which will be helpful for further study the relationship between the function of miR-10 and development of H. asiaticum. 【Method】 Total RNA of the different developmental stages and various tissues were extracted using Trizol Reagent, then transcripted to cDNA using SYBR ®Prime Script TM miRNA RT-PCR Kit( TaKaRa Code: RR716). To obtain the miR-10 precursor sequence from H. asiaticum, the specific primers were designed according to the miRBase database (Accession number: MI0012262). Then its homology was compared with the sequence from miRBas database by the MEGA4 software. The expression of miR-10 from different developmental stages and various tissues of H. asiaticum was assessed by qPCR. The biological function of miR-10 in H. asiaticum was presumed. 【Result】 A 73 bp gene was cloned by PCR, which was CUACAUCUACCCUGUAGAUCCGAAUUUGUUUGCCA CUAGACUACAAAUUCGGUUCUAGAGAGGCUUUGUGUGG. There was a relatively high genetic similarity among 16 varieties. The similarity between H. asiaticum and Ixodes scapularis was 95.9%, and 88.9%-91.7% compared with other arthropods. The miR-10 sequence was highly conserved in various species. The mature sequence of miR-10 was UACCCUGUAGAUCCGAAUUUGU，in which ACCCUGU was seed region. The expression of miR-10 that was 48.3-fold compared with the eggs and was the highest in unfed-nymph. However, the expression of miR-10 in unfed-adult and unfed-larvae was only 7.78-fold and 2.78-fold, respectively. The expression of miR-10 in the 3rd day feeding adult was 4.28-fold compared with the unfed-adult. But the expression of miR-10 in the 5th day feeding adult and fed-adult was only 0.31-fold and 0.087-fold, respectively. The relative expression levels of miR-10 increased in the early stage, but gradually decreased with the blood feeding. The relative expression levels of miR-10 among salivary gland, trachea, ovary, epidermis, midgut were remarkably different. The highest expression of miR-10 was salivary gland which was 13.2-fold compared with the epidermis that showed the lowest expression. The expression of miR-10 in ovary and trachea was 2.98-fold and 6.46-fold compared with the epidermis, respectively.【Conclusion】In the present study, the sequence of miR-10 was obtained. The analysis of miR-10 sequence suggested that it was highly conserved between arthropod. The expression of miR-10 in different developmental stages and various tissues of H. asiaticum were obviously different, which suggested that miR-10 was selectively expressed in H. asiaticum. It was deduced that according to the difference of expression and the reported function of miR-10, miR-10 may play potential roles in cell proliferation, development and blood-sucking. These results provided evidence for further study of microRNAs in parasites. MiRNA expression may be a new way for the therapeutic control of parasitic diseases in the future.

Key words: Hyalomma asiaticum , miR-10 , clone , expression analysis , qPCR亚洲璃眼蜱 , miR-10 , 克隆 , 表达分析 , qPCR