Loading...

Table of Content

    15 February 2014, Volume 47 Issue 4
    CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS
    Chromosome Localization of Phosphate Transporter Gene TaPHT2;1 and Its Effects on Phosphate Uptake and Utilization in Wheat
    GUO Li-1, GUO Cheng-Jin-1, LU Wen-Jing-2, LI Xiao-Juan-2, XIAO Kai-1
    Scientia Agricultura Sinica. 2014, 47(4):  613-621.  doi:10.3864/j.issn.0578-1752.2014.04.001
    Abstract ( 578 )   HTML ( 2 )   PDF (528KB) ( 613 )   Save
    References | Related Articles | Metrics
    【Objective】 In this study, the chromosome localization of TaPHT2;1, a phosphate transporter gene in wheat, was determined by using Chinese spring (CS) and its chromosome-based ditelosimic lines of B genome. Moreover, the expression pattern of TaPHT2;1 as well as its relationship with plant dry matter production and P use efficiency was studied under high- and low-Pi conditions.【Method】The cultivar CS together with its chromosome-based ditelosimic lines of B genome as well as wheat cultivars with varied P use efficiencies was hydroponically cultured. The chromosomal localization of TaPHT2;1 was detected by PCR amplification using specific primers with genome DNA of the tested materials as the template. The expression patterns of TaPHT2;1 in CS, its chromosome-based ditelosimic lines of B genome, and wheat cultivars with different P use efficiencies were determined by semi-quantitative RT-PCR and real time PCR. The plant dry weight and P acquisition parameters of the tested materials were assayed by following the conventional approach. 【Result】 For the CS and its chromosome-based ditelosimic lines of B genome, only 1BS that a line lacking the long arm of 1B was failed to detect the transcripts of TaPHT2;1, indicating that TaPHT2;1 is located in the long arm of 1B. Under P sufficience and P deprivation, the expression of TaPHT2;1 in roots and leaves of CS and other ditelosimic lines of B genome other than 1BS exhibited to be predominant in leaves and the expression levels were induced by Pi deprivation stress. The expression of TaPHT2;1 in roots was not regulated by Pi deprivation stress. These results suggest that TaPHT2;1 is involved in mediating plant Pi acquisition and cellular Pi translocation under Pi sufficience and in regulating re-transportation of cellular Pi under Pi deprivation. Under P sufficience, the plant dry weight and total Pi content in 1BS were significantly decreased in comparison with those in CS; under Pi deprivation, the plant dry weight of 1BS was also significantly lower than that of CS, but 1BS had higher total Pi content than CS. Therefore, the phosphate transporter gene TaPHT2;1 that located on the long arm of 1 B exerts dramatic effects on plant dry mass production under various Pi-supply conditions through its regulation of plant P acquisition and cellular Pi translocation. Under Pi sufficience, the accumulative Pi amount per plant of 1BS was significantly increased compared with that of CS, but there were no variations in Pi use efficiency between them. Under Pi deprivation, the Pi use efficiency of 1BS was significantly decreased compared with that of CS, but there were no variations in accumulative Pi amount per plant between them. In addition, under Pi sufficience, the expression level of TaPHT2;1, plant dry weight, total Pi content, and accumulative Pi amount per plant were all increased along with the increase of Pi use efficiencies across the tested wheat cultivars that displayed varied Pi use utilization properties. Under Pi deprivation, the expression level, plant dry weight, and Pi use efficiency were also increased along with the increase of the Pi use efficiencies in the tested wheat cultivars. However, the total Pi content exhibited a decrease tendency and the accumulative Pi amount per plant showed little variation among the wheat cultivars. Taken together, these results clearly indicate that there is a close association between the expression level of TaPHT2;1 and plant Pi acquisition, Pi utilization, and dry matter production in wheat cultivars with varied Pi use efficiencies under the conditions of Pi sufficience and Pi deprivation.【Conclusion】The wheat phosphate transporter gene TaPHT2;1 is located on the long arm of 1B. TaPHT2;1 plays an important role in regulation of plant dry mass production through its distinct response to external Pi conditions, which further modifies to most extent the plant Pi acquisition and utilization. This study confirms that TaPHT2;1 is a critical component in regulating plant Pi acquisition under Pi sufficience and Pi utilization under Pi deprivation. It can act as a molecular reference in evaluating Pi use efficiencies in wheat.
    Cloning and Function Analysis of a Salt-Stress-Induced HD-Zip Trascription Factor MsHB2 from Alfalfa
    LI Ming-Na-1, 2 , LONG Rui-Cai-1, YANG Qing-Chuan-1, 2 , SHEN Yi-Xin-2, KANG Jun-Mei-1, ZHANG Tie-Jun-1
    Scientia Agricultura Sinica. 2014, 47(4):  622-632.  doi:10.3864/j.issn.0578-1752.2014.04.002
    Abstract ( 608 )   HTML ( 6 )   PDF (1081KB) ( 1060 )   Save
    References | Related Articles | Metrics
    【Objective】Based on an EST of unknown gene, cloning and function analysis of a salt-induced gene (MsHB2) from alfalfa (Medicago sativa L. cv. Zhongmu-1) were conducted to further research the salt tolerance mechanism in alfalfa. 【Method】The RACE primers were designed according to the known EST sequence. The 3′- and 5′-end of the MsHB2 were amplificated by RACE method. The full length of the gene was assembled by DNAMAN program. The ORF of MsHB2, and the isoelectric point, molecular weight, molecular weight, subcellular localization, phylogenetic tree of the encoding protein were analyzed by some bioinformatics programs. The subcellular localization transient expression vector was constructed and transformed into onion epidermal cell by particle gun. MsHB2 and GFP were expressed in a fusion, which could be used to analyze the subcellular localization by the fluorescence signal. After being treated with 300 mmol•L-1 NaCl or 0.1 mmol•L-1 ABA for 0, 2, 4, 10 and 24 h, total RNA was extracted from root and shoot of 30-day-old Medicago sativa L. cv. Zhongmu-1 to analyze the expression pattern of MsHB2. The overexpression vector of MsHB2 was also contructed and transformed into GV3101 Agrobacterium. The phenotype of transgenic Arabidopsis plants was analyzed under salt and ABA stresses. 【Result】 A full length of 1 126 bp sequence was obtained by assembling 3′- and 5′-end RACE sequence. The sequence analysis result indicated that MsHB2 encoded 247 amino acid and contained a homeobox domain and a leucine zipper domain. MsHB2 had a high similarity with ATHB12. The phylogenetic tree analysis indicated that MsHB2 belonged to the class Ⅰ of plant homeobox domain protein. The subcellular localization result suggested that MsHB2 located in the nucleus of onion epidermal cell. MsHB2 mRNA was induced by NaCl and ABA stresses in alfalfa root and shoot. Its overexpression driven by a constitutive cauliflower mosaic virus-35S promoter in Arabidopsis plants conferred salinity and ABA sensitivity, as compared with WT plants. 【Conclusion】 A homeobox domain and leucine zipper domain protein gene (MsHB2) was cloned from alfalfa, which is induced by NaCl and ABA stresses. MsHB2 also retards the growth of transgenic Arabidopsis after NaCl and ABA stresses. These imply that MsHB2 may affect growth through an ABA dependent regulation pathway. MsHB2 may play a negetive role in salt and some other abiotic stress regulation in alfalfa.
    TILLAGE & CULTIVATION·PHYSIOLOGY & BIOCHEMISTRY·AGRICULTURE INFORMATION TECHNOLOGY
    Effects of Supplemental Irrigation and Nitrogen Application on Starch Granule Size Distribution of Maize Grain
    SHI De-Yang-1, 2 , ZHANG Hai-Yan-1, 3 , DONG Shu-Ting-2, 3
    Scientia Agricultura Sinica. 2014, 47(4):  633-643.  doi:10.3864/j.issn.0578-1752.2014.04.003
    Abstract ( 591 )   HTML ( 1 )   PDF (636KB) ( 922 )   Save
    References | Related Articles | Metrics
    【Objective】Starch granule size distribution is an important factor to evaluate starch quality and is greatly influenced by environmental factor. Irrigation and nitrogen are the major agronomic measures for high yield and good quality of maize. Therefore, it is very important for quality control and directional utilization of starch to clarify the effects of supplemental irrigation and nitrogen application on starch granule size distribution, and analyze the relationship between starch granule size distribution, grain weight, starch pasting properties and starch components of maize grain.【Method】In this study, Zhengdan 958 was used. Two water treatments were carried out, rain-fed (W1) and supplemental irrigation (W2). Supplemental irrigation treatment and irrigation amount were determined by soil water content. If soil water content was lower than 60% of field capacity, irrigation was applied. If soil water content after irrigation arrived 80% of field capacity, irrigation was stopped. Irrigation amount was calculated according to the formula of m=10ρbH(?i -?j), where m is the amount of supplementary irrigation (mm), H is the supplementary irrigation depth (cm) of the period, ρb is soil bulk density(g•cm-3) of the supplementary irrigation depth, βi is the objective water content (field capacity×objective and relative water content), βj is the natural water content. The highest nitrogen application rate was determined according to 3 kg nitrogen requirement for 100 kg kernels and the yield standard of 10 500 kg•hm-2 in 67 500 plants•hm-2 density. So, three nitrogen treatments were carried out, 0 (N1), 160 (N2) and 320 (N3) kg•hm-2. The volume, number and surface area distribution of starch granule in mature maize endosperm in irrigation and nitrogen application treatments were determined using laser particle size analyzer. Starch pasting properties were measured by RVA analyzer. Starch components were determined according to the double wavelengh method. The correlations between volume distribution of starch granule and starch pasting properties, kernel weight, yield and starch components were analyzed. 【Result】 Starch granule of maize was in the range of 0.38-39.78 μm, and the upper limit was 30.07-39.78 μm. Starch granule volume and surface area showed a three-peak curve. According to the concave point of the double peak curve, taking 3.5 μm and 7.4 μm as limit, starch granules were divided into three types: small (<3.5 μm), middle (3.5-7.4 μm) and large (>7.4 μm). Starch granule number showed a single peak curve. Starch granule of maize grain was mainly composed of small starch granule, which accounted for over 98% of total starch granule. Nitrogen fertilization and supplemental irrigation reduced the percentages of volume, surface area and number of small starch granule, and increased the volume percentage of large starch granule. Nitrogen fertilization and supplementary irrigation increased starch peak viscosity, trough viscosity, breakdown, final viscosity, setback, grain yield and weight, total starch and amylopectin content, reduced peak time, pasting temperature, amylose content and the ratio of amylose to amylopectin. Correlation analysis indicated that amylose content, the ratio of amylose to amylopectin, peak time and pasting temperature were positively correlated with volume percentage of small starch granule, and negatively correlated with volume percentage of large starch granule. Grain yield and weight, amylopectin and total starch content, peak viscosity, trough viscosity, breakdown, final viscosity and setback were negatively correlated with volume percentage of small starch granule, and positively correlated with volume percentage of large starch granule. 【Conclusion】Water and nitrogen fertilization significantly affected starch granule size distribution and pasting properties. Supplemental irrigation and 320 kg•hm-2 nitrogen fertilization treatment had the lowest volume percentage of small starch granule, the highest volume percentage of large starch granule and the best starch pasting properties.
    Morphological and Physiological Traits of Leaf in Different Drought Resistant Peanut Cultivars
    LI Guang-Hui, ZHANG Kun, LIU Feng-Zhen, LIU Dan-Dan, WAN Yong-Shan
    Scientia Agricultura Sinica. 2014, 47(4):  644-654.  doi:10.3864/j.issn.0578-1752.2014.04.004
    Abstract ( 846 )   HTML ( 10 )   PDF (616KB) ( 1414 )   Save
    References | Related Articles | Metrics
    【Objective】The main purpose of this paper was to screen leaf traits related to drought resistance, explore the methods of traits index evaluation, and to reveal drought resistance mechanisms of different peanut cultivars. 【Method】 The drought resistance was studied in twelve peanut cultivars under drought stress and normal irrigation in a pot experiment at seedling stage and a pool culture experiment at pod setting stage. Keeping the water treatments by using weighing at seedling stage and supplemental irrigation based on testing soil moisture at pod setting stage with rain-shedding during drought stress. Leaf morphological and physiological traits including organization structure, thickness, specific leaf weight (SLW), leaf area per plant (PLA), photosynthetic rate (Pn), chlorophyll content under the conditions of normal water supply and drought stress at seedling stage were tested, and the relationship between those traits and drought resistance was studied. Drought resistances of cultivars were scored with drought coefficient of biomass at seedling stage and yield at pod setting stage. Drought resistance mechanisms of leaf were evaluated by traits index. 【Result】 The results by two years experiments showed that, under drought stress, the drought resistance coefficients of different peanut cultivars were significantly different. Drought resistance at seedling and pod-setting stages was basically identical. According to yield-drought resistance coefficient, twelve peanut cultivars could be divided into 3 grads: high-resistance, including A596, Shanhua 11 and Rugaoxiyangsheng; mid-resistance, including Huayu 20, Nongda 818, Haihua 1, Shanhua 9 and 79266; weak-resistance, including ICG6848, Baisha1016, Hua17 and Penglaiyiwohou. Water stress changed organization structure in leaves, functional leaf area, PLA, Gs, Pn and Tr were reduced, but SLW of peanuts was increased under soil drought stress. A significant difference in leaf traits among peanut cultivars with different drought resistances was observed. Leaf thickness, ratio of palisade tissue to spongy tissue (PTT/STT), SLW, PLA and Pn were higher under both drought stress and normal irrigation in cultivars with high drought resistance. The drought resistance mechanism of twelve peanut cultivars was different, under drought stress, Rugaoxiyangsheng and Shanhua 11 presented as higher PTT/STT, SLW and Pn, Shanhua 9 and Huayu 20 had larger PLA, A596 was mainly higher in Pn. Correlation analysis between drought resistance coefficient and leaf PTT/STT, SLW, PLA and Pn under drought stress condition was significant. 【Conclusion】 Shanhua11 could be used as a standard variety for high drought resistance identification, and 79266 could be used as a standard variety for weak resistance identification. Treatment of 40% RWC drought stress at 10 d after germination, the leaf PTT/STT, SLW, PLA and Pn could be used to identify the drought resistance of peanuts leaf. PTT/STT, SLW and PLA also could be used to identify the drought resistance of peanuts leaf under normal water condition at anthesis stage. Shanhua 11 could be used as a suitable standard cultivar for leaf drought resistance traits identification in peanut.
    Effects of Drought Stress on Photosynthetic Characteristics and Endogenous Hormone ABA and CTK Contents in Green-Stayed Sorghum
    ZHOU Yu-Fei, WANG De-Quan, LU Zhang-Biao, WANG Na, WANG Yi-Tao, LI Feng-Xian, XU Wen-Juan, HUANG Rui-Dong
    Scientia Agricultura Sinica. 2014, 47(4):  655-663.  doi:10.3864/j.issn.0578-1752.2014.04.005
    Abstract ( 729 )   HTML ( 15 )   PDF (498KB) ( 990 )   Save
    References | Related Articles | Metrics
    【Objective】The objective of the experiment was to investigate the effect of drought stress on photosynthetic characteristics and contents of endogenous hormones and to provide a scientific basis for exploring and utilizing the stay-green sorghum. 【Method】 A pot-grown experiment was conducted with green-stayed sorghum (B35) and non-green-stayed sorghum (Sanchisan) as materials with two water treatments including non-drought stress (75%-80% of the field moisture capacity) and drought stress (45%-50% of the field moisture capacity) at anthesis stage or grain filling stage, respectively. Photosynthesis, chlorophyll fluorescence and endogenous hormone contents including abscisic acid (ABA) and cytokinin (CTK) both in leaves and roots were examined under drought stress. In addition, the dynamic balance of endogenous hormone contents in leaves and roots and the relationship between photosynthetic characteristics and endogenous hormone contents in leaves under drought stress were analyzed. 【Result】 Photosynthesis of the two different stay-green sorghum materials were restrained by drought stress at both anthesis stage or grain filling stage, however, the chlorophyll contents (Chl), photosynthetic rate (Pn), stomatal conductance (Gs), PSⅡ original fluorescence (Fo), maximal photochemical efficiency (Fv/Fm), photochemical quenching (qL) and electron transport rate (ETR) of B35 decreased significantly less than those of Sanchisan under drought stress. At filling stage, in Sanchisan, the decrease of Chl under drought stress was more obvious, and Pn decreased markedly, which might be resulted from damage or inactivity of the structure of PSⅡreaction centre. Drought increased ABA contents in leaves and roots of the two different stay-green sorghum cultivars. ABA contents in leaves and roots of B35 increased significantly greater than those in Sanchisan especially at grain filling stage. While drought decreased CTK contents in leaves and roots of the two different stay-green sorghum cultivars. CTK contents in leaves and roots decreased significantly greater than those in B35 especially at grain filling stage. ABA contents of B35 and Sanchisan were higher in leaves than in roots, while CTK contents were the opposite. CTK/ABA both in leaves and roots decreased under drought stress, and the reduction extents in B35 were greater than those in Sanchisan at both anthesis stage and grain filling stage. Moreover, ABA contents were negatively related with Pn at 0.05 level and with ETR at 0.01 level, and CTK contents were positively related with Gs at 0.05 level and with Chl, Pn, Fv/Fm, qL and ETR at 0.01 level.【Conclusion】 Stay-green sorghum has higher chlorophyll contents and photosynthetic capacity than non green-stayed sorghum under drought stress. Interaction between ABA and CTK influences the movement of stomata and other related physiological process regarding photosynthesis such as Pn and ETR.
    Recognition of Rice Leaf Diseases Based on Computer Vision
    LIU Tao-1, ZHONG Xiao-Chun-2, SUN Cheng-Ming-1, GUO Wen-Shan-1, CHEN Ying-Ying-1, SUN Juan-1
    Scientia Agricultura Sinica. 2014, 47(4):  664-674.  doi:10.3864/j.issn.0578-1752.2014.04.006
    Abstract ( 940 )   HTML ( 28 )   PDF (858KB) ( 1631 )   Save
    References | Related Articles | Metrics
    【Objective】The purpose of this article was to recognize 15 kinds of rice disease located at leaf accurately, especially among the similar diseases. 【Method】 For disease spot image acquisition, the original image was got by digital camera from paddy fields and modified mean shift image segmentation algorithm was used to extract rice disease spot from the original image. For the selection and design of feature parameters, Firstly, the color moments arranged from first to third order and color histogram were selected as color feature parameters, and sphericity, eccentricity, invariant moment as shape feature parameters, and angular second moment, contrast, correlation as texture feature parameters. Secondly, junction feature parameters were designed aiming at high missing report rate of similar diseases, this feature was established based on the difference between inside, margin and periphery of disease spot, and euclidean distances of color in different regions were used to calculate this feature parameters which could describe the junction of health and disease. Thirdly, for the design of diseases identification process, the process of diseases was designed based on the key characters of each disease, in this process, diseases were distinguished by the biggest character difference. The concrete step of identification process are as follows: Firstly, color feature was used to divide all the diseases into six groups. Secondly, shape feature was used to subdivide. Finally, texture and junction feature were used for ultimate recognition. Color, shape, texture and junction feature parameters were obtained by related equation, and the parameters were divided into fifteen groups by their disease types. Fourthly, for the establishment of recognition model, the Support Vector Machine(SVM) model was applied to classify and recognize the 15 kinds of rice diseases stepwise. The images were divided into two groups, one was selected to build the model, and another to verify it. LibSVM software package was used to modeling, of which svmtrain function, svmpredict function and grid software were separately used to establish and verify the model and parameter optimization. In this research, a comprehensive study was conducted about the impact of junction feature parameters and identification process on improving accuracy.【Result】A total of 15 kinds of rice disease could be extracted and recognized by this method successfully, and the average recognition accuracy rate was up to 92.67% , average missing report rate was 7.00%, the max missing report rate and false report rate was 15.00% and 25.00%, respectively. After using junction feature parameters, recognition accuracy rate was 14.00% higher, average missing report rate was 7.50% lower, the max decreasing ranges of missing report rate and false report rate were 20.00% and 65.00%, respectively. The identification process proposed in this study could make the recognition accuracy rate 12.67% higher, missing report rate was 9.33% lower, and decreasing ranges of some diseases were more than 30.00%. In all the steps of diseases identification process, the accuracy rate of color recognition was 96.71%, missing report rate and false report rate were both under 10.00%. At the second step, the accuracy rate was 94.17%, missing report rate and false report rate were both under 15.00%. The accuracy rate of texture and junction feature step recognition was 91.5%, missing report rate and false report rate were both under 25.00%.【Conclusion】The 15 kinds of rice disease spots could be segmented from the original images based on the modified mean shift image segmentation algorithm, and the disease could be accurately classified with the method of SVM model with proper feature parameters. The junction feature parameter and the classifying process which were put forward in this paper could improve recognition accuracy. The junction feature parameter could increase the recognition accuracy significantly, especially when the target diseases are similar. Common rice leaf diseases could be recognized by using all those technologies. This paper offered a technical support for automatic diagnoses of rice diseases further.
    PLANT PROTECTION
    Functional Analysis of HrpX/HrpY in Dickeya zeae Virulence
    CHEN Xue-Feng, WEI Chu-Dan, ZHANG Qing, LIU Qiong-Guang
    Scientia Agricultura Sinica. 2014, 47(4):  675-684.  doi:10.3864/j.issn.0578-1752.2014.04.007
    Abstract ( 654 )   HTML ( 5 )   PDF (727KB) ( 682 )   Save
    References | Related Articles | Metrics
    【Objective】Rice bacterial foot rot caused by Dickeya zeae is one of the important bacterial diseases on rice. The virulence and regulation mechanism of D. zeae are imperfect at present. This paper aims to analyze the sequence characteristics of HrpX/HrpY, a two-component regulatory system (TCS) in D. zeae, and study on the roles of this system in D. zeae virulence and the relationships between HrpX/HrpY and its downstream genes.【Method】The sequences of HrpX/HrpY were analyzed by bioinformatics, a suicide recombinant plasmids pKNG-ΔhrpX and pKNG-ΔhrpY with reverse selection marker gene scaB were constructed, then transferred into wild strain EC1, respectively, by triparental mating, so the gene deletion mutants ΔhrpX and ΔhrpY were constructed after two alleles homologous recombination screening. The biological characteristics such as growth rate, extracellular enzyme, toxin, motility, biofilm, virulence on rice and HR on tobacco were compared and analyzed. In addition, bacterial total RNA was extracted, and real-time quantitative PCR was carried out so as to assess the expression of downstream genes of HrpX/HrpY.【Result】In the genome of D. zeae strain EC1, hrpX and hrpY were single copy. The coding region of hrpX was 1 473 bp, which encoding 490 amino acids, while hrpY with the size of 642 bp encodes 213 amino acids. There were only 32 base pairs between hrpX and hrpY. They were in the same transcriptional direction, and had functional relationship. HrpX was a histidine protein kinase combined with the bacterial membrane and HrpY was a response regulator in the cytoplasm. They constitute a two-component system and regulate the downstream genes expression of hrp. Further by genetic manipulation, two gene deletion mutants ΔhrpX and ΔhrpY were constructed successfully. The results of phenotypic determination showed that ΔhrpX and ΔhrpY lost motility, could not form pellicle (biofilm), weakened the inhibitory effect on rice and seed germination. Furthermore, mutants virulence tests showed that the symptoms alleviated than the wild strain EC1 did when the bacterial suspensions were poured into the root of rice plant. There were no significant differences between mutants and EC1 in growth rate, activities of extracellular enzyme and toxin production, they could also induce HR on tobacco. Real-time fluorescent quantitative PCR results showed that HrpX/HrpY regulated positively some downstream hrp genes, and the expression quantity of hrpA, hrpF and hrpN decreased obviously. Further analysis found that the regulation effect of HrpY was more significant than HrpX. 【Conclusion】HrpX/HrpY is a two-component regulatory system in D. zeae. It regulates bacterial motility, biofilm, and virulence, and regulates the expression of downstream hrp genes positively.
    Charericterization of a Phage-Displayed Nanobody Imitating Aflatoxin Antigen
    WANG Yan-Ru-1, 2 , 4 , LI Pei-Wu-1, 2 , 3 , 4 , 5 , ZHANG Qi-1, 3 , 4 , DING Xiao-Xia-1, 4 , 5 , ZHANG Wen-1, 2 , 5
    Scientia Agricultura Sinica. 2014, 47(4):  685-692.  doi:10.3864/j.issn.0578-1752.2014.04.008
    Abstract ( 654 )   HTML ( 5 )   PDF (644KB) ( 902 )   Save
    References | Related Articles | Metrics
    【Objective】A phage-displayed aflatoxin mimotope was obtained from a home-made phage-displayed nanobody library, and used to develop enzyme-linked immunoassay (ELISA) towards aflatoxins. In this research, the performance of the selected mimotope was characterized. 【Method】In previous work of author’s laboratory, an alpaca had been immunized with anti-aflatoxin MAb 1C11 mixed with Freund’s incomplete adjuvant. Total RNA was extracted from alpaca’s blood and used to synthesize first strand cDNA. The phage displayed VHH library was constructed by ligating amplified VHH genes with plasmid pComb3X. In this work, anti-aflatoxin monoclonal antibody 1C11 was coated on a 96-well microplate, phage-displayed nanobody solution was mixed with aflatoxin standard or sample extracts and added into the wells to compete binding to the antibody. The assay’s sensitivity towards aflatoxin B1, cross-reactivity towards aflatoxin B2, G1, G2 and M1 was determined. The assay buffer’s pH value, ironic strength and methanol concentration were also optimized. In order to apply this assay to agro-products, peanut, rice and corn were selected to test its matrix effects.【Result】Determined by checkerboard procedure, the optimized concentration of the coating antibody was 1.25 mg·mL-1 and phage was 5´1011 pfu/mL. Under this condition, the assay had an IC50 value of 0.054 ng·mL-1 towards aflatoxin B1. Its cross-reactivity towards aflatoxin B2, G1, G2 and M1 was 38.6%, 70.1%, 14.5% and 14.6%, respectively. Methanol concentration could be as high as 20% without interference to the assay. The assay had the highest sensitivity under pH value of 7.0. Increasing or decreasing the pH value of the assay buffer reduced its sensitivity. Ionic strength influenced ELISA performance. And the selected optimum concentration was 0.01 mol·L-1, which led to the lowest IC50 value. As a result, the optimized assay buffer was 0.01 mol·L-1 phosphate buffered saline (PBS) with a pH value of 7.0. There was no significant matrix effect when the sample extract was diluted by 4 times or higher. 【Conclusion】 The immunoassay based on phage 2-5 has a high sensitivity, high tolerance to methanol and sample matrix. Phage-displayed nanobody 2-5 can be used in immunoassays towards aflatoxins in agro-products as aflatoxin mimotope.
    Effect of Exposure to Heat Stress on Survival and Fecundity of Panonychus citri
    YANG Li-Hong-1, 2 , HUANG Hai-2, WANG Jin-Jun-2
    Scientia Agricultura Sinica. 2014, 47(4):  693-701.  doi:10.3864/j.issn.0578-1752.2014.04.009
    Abstract ( 704 )   HTML ( 2 )   PDF (525KB) ( 617 )   Save
    References | Related Articles | Metrics
    【Objective】 The objective of this study is to clarify the effect of heat stress on survival and reproduction of the female citrus red mites (Panonychus citri), and to explore the population dynamic law under high-temperature condition. 【Method】The P. citri were collected from Citrus Research Institute, Chinese Academy of Agricultural Science. Mites were reared on the citrus seedlings at least for 10 generations prior to the experiments in phytotron ((25±1) ℃, 75%-80% RH, 14 h﹕10 h (L﹕D) photoperiod). Some female adult mites were selected to detached citrus leaves remaining 12 h for oviposition. Then the females were moved, and the eggs were continuously cultured until the mite reached detonymph. Then every mite was reared on a fresh leaf disc. When the mites developed to adulthood, every female adult mite was shocked at 32, 35, 38 and 41℃ for some time in constant temperature incubator, respectively. After that the treated mites were returned to the above-mentioned phytotron, accompanied by a male adult mite for each female. Each treatment was repeated thirty times at least, 25℃ served as control. The survival and oviposition were observed every 24 h until the female died, to determine the effect of heat stress on the survival and fecundity of P. citri. Data were analyzed by one-way analysis of variance (ANOVA) and Duncan multiple range test (DMRT, P<0.05) using SPSS 10.0 software.【Result】High temperature had a significant effect on life-span of female adult. The longevity became shorter with the temperature rising from 32 to 41℃ after exposed to the mentioned temperatures for 1 h, respectively (P<0.001). The longevity became even shorter with the stress time elapsed. For example, when exposed to 38℃ for 3 h, the longevity was 9.6 d (P<0.01), and it was 5.0 d when exposed to 41℃ for 3 h (P<0.001). Furthermore, high temperature had an adverse effect on fecundity of female adult. The average oviposition distinctly decreased under exposure of high temperature for 1 h (P<0.05), and the oviposition became fewer and fewer with the stress time elapsed, for instance, when exposed to 38℃ for 3 h, the average fecundity of a female distinctly decreased to 23.1 eggs (P<0.001), the same case happened to 41℃ (P<0.001). When the citrus red mite was exposed to 32, 35, 38 and 41℃ for 1 h, respectively, the age-specific survival rate (lx) curve all had “plateau duration”, but the “plateau duration” disappeared after the female exposed to 38 and 41℃ for 3 h, respectively, also, the gradient of lx curve became abrupt with the rise of treatment temperature and extension of treatment time. The age-specific fecundity (mx) curve showed that heat stress made the oviposition summit in advance and mx decline, especially when exposed to 38 and 41℃ 3 h, respectively, the mx of female adult mite obviously decreased. 【Conclusion】The longevity and oviposition dropped under short-time heat stress condition and the degree became even serious with the rise of treatment temperature and extension of treatment time. The exposure to heat stress had harmful effect on survival and fecundity of the female citrus red mite. This suggested that the population of P. citri could be distinctly inhibited by hot summer climate.
    SOIL & FERTILIZER·WATER-SAVING IRRIGATION·AGROECOLOGY & ENVIRONMENT
    Application of Rough Set Theory to Determine Weights of Soil Fertility Factor
    YE Hui-Chun-1, ZHANG Shi-Wen-2, HUANG Yuan-Fang-1, ZHOU Zhi-Ming-1, SHEN Zhong-Yang-1
    Scientia Agricultura Sinica. 2014, 47(4):  701-717.  doi:10.3864/j.issn.0578-1752.2014.04.011
    Abstract ( 554 )   HTML ( 3 )   PDF (540KB) ( 592 )   Save
    References | Related Articles | Metrics
    【Objective】Soil fertility is controlled by many basic soil characters. Assessing soil fertility scientifically, rationally and practicably is of importance for guidance of agricultural production, land use planning and administration. Evaluation of soil fertility is a multiattribute decision-making process without decision attribute. The premise of multiattribute decision-making process is to determine attribute weights. 【Method】The methods to determine attribute weights mainly include subjective weighting method (SWM) and objective weighting method (OWM). However, the SWM usually requires massive prior knowledge, which is somewhat subjective and do not consider the dependency between evaluation indexes. The OWM has not fully considered the difference of each index’s influence on evaluation. Meanwhile, even if statistical data have well correlations, it does not necessarily mean that the two variables have causation relationship. By considering the advantages and disadvantages of SWM and OWM, the concepts of reduction of knowledge and relative positive region in rough set theory were adopted in this study to explore the method for determination of indexes weights by combining subjective method with objective method in soil fertility evaluation and by testifying the evaluation results using crop yield data. 【Result】The determination of weight using rough set theory for soil fertility evaluation involve several steps: data discretization, preliminary determination of soil fertility grade, attribute value reduction, equivalence partitioning, attribute significance calculation, and index weights calculation. Taking soil fertility evaluation of farmland samples in Daxing district in Beijing City, China as an example, the weights of soil organic matter, total N, available P and available K determined by Delphi method were 0.300, 0.250, 0.250, and 0.200, respectively. There was a significant linear correlation between soil integrated fertility index (IFI) and crop yield. The determination coefficient R2 was 0.77 and root mean square error (RMSE) was 1.25. Using rough set theory, the determined weights of soil organic matter, total N, available P, and available K were 0.455, 0.111, 0.111, and 0.333, respectively. Again, a significant linear correlation between IFI and crop yield was observed. The later method has higher accuracy, as indicated by higher values of R2 (0.83) and lower value of RMSE (1.06). 【Conclusion】Results of this study indicates that it is feasible to adopt rough set theory for determining the index weights of soil fertility, which provides a useful choice for evaluation of soil fertility and other related fields.
    Study on the Nitrogen Mineralization Characters of Paddy Soil in Cold Area
    PENG Xian-Long-1, LIU Yang-1, YU Cai-Lian-2, WANG Di-1
    Scientia Agricultura Sinica. 2014, 47(4):  702-709.  doi:10.3864/j.issn.0578-1752.2014.04.010
    Abstract ( 664 )   HTML ( 25 )   PDF (532KB) ( 645 )   Save
    References | Related Articles | Metrics
    【Objective】Compare to southern paddy fields, total applied nitrogen amount is lower and nitrogen use efficiency is higher in northeast of China. Soil N supply ability is closely related to nitrogen application and nitrogen efficiency. It is very important to compared nitrogen supply ability between southern and northern paddy soil. This would be helpful to reveal the relationship between soil nitrogen supply and high N efficiency in northern paddy.【Method】The tested soil was composed of gleyed paddy soil with high fertility and hydromorphic paddy soil with medium fertility from Jiangsu province, as well as albic paddy soil with high and medium fertility from Heilongjiang province. The samples were incubated at 25℃,30℃ and 40℃ for 28 days, respectively. Soil ammonium nitrogen was detected before and after incubation. At the same time, soil organic matter, total nitrogen and organic N forms were determined before incubation. Effective cumulated temperature model and One-pool model were fitted to the observed mineral-N vs incubation days using non-linear regression procedure. 【Result】 Ratios of the hydrolysamino acid N and amino acid N to total N were higher in southern paddy soil than the northern soil with corresponding fertility, however, the C/N in northern soil was higher. There was no significant difference of cumulative mineralization N on 28 days after incubation between southern and northern paddy soil under 25℃. When the incubation temperature was increased from 25℃ to 40℃, the cumulative mineralization N of southern soil with high fertility or medium fertility was higher than northern soil with corresponding fertility due to high organic nitrogen forms of soil or ratio of organic nitrogen forms to total nitrogen in southern soil. One-pool model between cumulative soil mineralization N and incubation days showed that soil N mineralization potential (N0) of northern soil increased by 35.9%-36.3% compared to southern soil with corresponding fertility under 25℃. On the contrary, N0 of northern soil decreased by 6.1%-32.7% and 20.9%-36.7% than southern soil with corresponding fertility under 30 ℃ and 40℃, respectively. Low soil microbial activity under high temperature may be the reason of lower N0 in northern soil. Effective cumulated temperature model between cumulative soil mineralization N and incubation days showed that the n value of same soil decreased with the increase of temperature. Southern soil had higher K value and Northern soil had higher n value. Therefore, earlier mineralization rate of southern soil was clearly higher than northern soil, but later N mineralization rate was lower. 【Conclusion】 The content of mineralized nitrogen and N0 depends on soil microbial activity, ratio of soil carbon to nitrogen, content of soil organic nitrogen and the proportion of organic form nitrogen to total nitrogen. Nitrogen mineralization potential of northern paddy soil was higher than southern soil under 25 ℃. Compared to southern paddy soil, the rate of nitrogen mineralization in northern soil was slower and faster in the early and late stage, respectively. This nitrogen mineralization character for northern paddy soil matched to rice N uptake, which was one of the reasons for high nitrogen use efficiency in cold area.
    HORTICULTURE
    Genetic Diversity and Phylogenetic Relationship of Ginger Germplasm Resources Revealed by SRAPs LI Xiu, XU Kun, GONG Biao
    LI Xiu, XU Kun, GONG Biao
    Scientia Agricultura Sinica. 2014, 47(4):  718-726.  doi:10.3864/j.issn.0578-1752.2014.04.012
    Abstract ( 682 )   HTML ( 7 )   PDF (531KB) ( 1106 )   Save
    References | Related Articles | Metrics
    【Objective】Ginger is vegetatively asexual crop that owns lots of local varieties, and its biological characteristics have been verified in many aspects caused by climate change, natural and artificial selection for thousands of years. This study was conducted to make a scientific classification of ginger germplasm, provide evidence for germplasm collection, protection and innovation of ginger by investigating the genetic diversity and relationship.【Method】Good genomic DNA was extracted from young leaves of 51 ginger accessions from different areas of the world following the CTAB method, and then were amplified by sequence-related amplified polymorphism molecular markers to analyze genetic diversity and phylogenetic relationship. Separation of the amplified fragments was performed on 6% denaturing polyacrylamide gels, The gels were stained with AgNO3 for visualizing the SRAP fragments, and then“0, 1” matrix was obtained according to the electrophoresis results. The number of polymorphic loci, percentage of polymorphic loci, effective number of alleles, Nei’s genetic similarity coefficient, genetic distance and the indexes of Nei’s genetic diversity and Shannon information were estimated by POPGENE version1.32. The cluster analysis of 51 ginger accessions based on unweighted pair-group method and 7 ginger populations based on Nei’s genetic distance were performed on NTSYS version2.10e to classify the ginger germplasm. Meanwhile, the origin and transmission of ginger were discussed in accordance with genetic diversity and phylogenetic relationship of ginger germplasm in different ecotopes and in light of the relevant characteristics of origin center and historical records.【Result】Among the 305 bands detected by 15 selective primer pairs, 188 (61.68%) were polymorphic. On average, each primer combination amplified 20.33 loci and 12.53 polymorphic loci. This showed that genetic variation of ginger is extensive. The average indexes of Nei’s genetic diversity and Shannon information were 0.3689 and 0.5510, respectively. Ginger germplasms were divided into 3 groups and 9 subgroups accordingly. Through comparative analysis, it was found that the same group gingers were from the same or similar region. Further analysis showed that ginger populations were separated into seven groups by geographical distribution, whose Shannon information index ranged from 0.2901 to 0.4807. The seven geographical populations were divided into 4 groups when the genetic similarity coefficient was set at 0.9. The Northern China population and Africa population formed their own group, respectively; Southeast Asia population, the Japan and Korea population formed a group; the coastal Southeastern China population, Southwest Plateau population and Central China population fell into another group.【Conclusion】 Analysis of 51 ginger accessions based on the indexes of Nei’s genetic diversity and Shannon information showed that genetic diversity of ginger was abundant though it is an asexual crop. The cluster analysis conducted with UPGMA of 51 ginger accessions based on genetic diversity coefficient indicated that genetic diversity of ginger germplasm was greatly influenced by geographical origins. Analysis on populations’ genetic diversity showed that genetic diversity of domestic populations in China was higher compared with foreign populations, in particular, Northern China population was far from other populations, moreover where the ginger cultivation has a long history, so the Northern China could be determined as the secondary center of origin; Africa is likely one of the native origin of gingers besides Southeast Asia, as the Africa population not only has a higher genetic diversity index, is far from other populations, and its space distribution is near from geometry center, but Africa also has wild species.
    Developing Mechanism of Fruits Texture in ‘Jonagold’ Apple and Its Crisp Flesh Sport
    CHEN Xue-Sen, SONG Jun, GAO Li-Ping, JI Xiao-Hao, ZHANG Zong-Ying, MAO Zhi-Quan, ZHANG Yan-Min, LIU Da-Liang, ZHANG Rui, LI Min
    Scientia Agricultura Sinica. 2014, 47(4):  727-735.  doi:10.3864/j.issn.0578-1752.2014.04.013
    Abstract ( 661 )   HTML ( 3 )   PDF (613KB) ( 662 )   Save
    References | Related Articles | Metrics
    【Objective】 The differences of the firmness, fracturability, contents of aroma components and expression of softing relevant genes during later-developing stage of fruit between ‘Jonagold’ and its bud mutation were studied to completely understand the mechanism of a crisp-fleshed bud mutation of ‘Jonagold’ apple. Furthermore, these results will be beneficial for perfecting the theoretical system of the quality development of fruit texture. 【Method】 The fruits of ‘Jonagold’ apple variety and its crisp-fleshed bud mutation during later-developing stage were used. Some physiological index, such as the content of firmness, fracturability and aroma components, and the expression of genes participating in ethylene synthesis (ACO,ACS) and fruit softing (PG, PME, β-Gal, α-L-Af, XET, AM,LOX and β-xyl) were measured. 【Result】 The firmness and fracturability of the fruits of ‘Jonagold’ apple and its crisp-fleshed bud mutation during later-developing stage were decreased in general, especially 50-35 d before harvest. The firmness and fracturability of bud mutation were much higher than ‘Jonagold’. The species numbers and contents of ester compounds of ‘Jonagold’ apple were 1.5 times and 1.2 times of bud mutation, but the content of alcohols and aldehydes of ‘Jonagold’ apple were 15.1% and 14.3% of bud mutation; the expression of ACO changed very greatly during the development of ‘Jonagold’ fruit, while the expression of ACS and ACO changed little in the bud mutation, which were 73.9% and 1.1% of ‘Jonagold’ , and the expression peaks of bud mutation lagging behind ‘Jonagold’. In ‘Jonagold’ fruit, the expressions of PG, PME, β-Gal, α-L-Af, XET, AM,LOX and β-xyl during 113-120 d after fullbloom were all over 35% of the total expression, which were the main reasons of the firmness and fracturability declined rapidly; while the total expression of 12 genes measured, the bud mutation was 23.2% of ‘Jonagold’, which PG,α-L-Af, XET and β-Gal was 12.5%, 62.7%, 72.6% and 75.3%, respectively. 【Conclusion】 The species numbers and contents of ester compounds were higher in the fruits of ‘Jonagold’ apple than in its bud mutation, while the species numbers and contents of alcohols and aldehydes were opposite. The difference of the firmness and fracturability of the fruits of ‘Jonagold’ and its bud mutation during later-developing stages may be the results of synergistic effects of ACS, ACO, PG, β-Gal, β-xyl , a-L-Af and XET genes, among them, ACO, PG, β-Gal and XET may be the key genes.
    STORAGE·FRESH-KEEPING·PROCESSING
    Effects of Different Storage Methods on Fruit Quality of ‘Newhall’ Navel Orange (Citrus sinensis Osbeck‘Newhall’) in Southern Jiangxi Province
    HE Yi-Zhong-1, CHEN Zhao-Xing-1, 2 , LIU Run-Sheng-1, FANG Yi-Wen-2, GU Zu-Liang-3, YAN Xiang-2, CHEN Hong-3, ZHANG Hong-Ming-2, TANG Huan-Qing-3, CHENG Yun-Jiang-1
    Scientia Agricultura Sinica. 2014, 47(4):  736-748.  doi:10.3864/j.issn.0578-1752.2014.04.014
    Abstract ( 925 )   HTML ( 13 )   PDF (3290KB) ( 576 )   Save
    References | Related Articles | Metrics
    【Objective】The objective of this study is to optimize the storage conditions of citrus and provide a scientific foundation for storage warehouse improvement.【Method】Storage experiments were performed with commercially mature ‘Newhall’ navel orange fruits using three storage methods, including mechanical cold storage (Mcs), evaporative cooling ventilating storage in mountainous region (Ecvs) and ventilating warehouse storage (Vws). Environmental parameters of these storage conditions were termly detected. Meanwhile, the fruit physiological and biochemical indexes were measured with gas chromatography and infra-red CO2 analyzer. Moreover, fruit organoleptic properties were evaluated as well. 【Result】 The environment parameters under the three storage conditions changed constantly. The temperature and relative humidity in Mcs ranged from 2.1℃ to 11.2℃ and 64.4% to 99.0%, respectively. As the weather gets warm, the temperature variations of Mcs between storehouse and transport or shelf life condition were significantly different from those of Ecvs and Vws. Although the changing trends of storage parameters in Ecvs were similar to those in Vws, industry experiences revealed that the storage condition was more suitable to orange storage in Ecvs than in Vws. The concentrations of CO2 and ethylene in Mcs were significantly higher than those in Ecvs and Vws. The contents of titratable acid, soluble solid and concentration of organic acids in fruit juice decreased with the extension of storage phase. Among these storage methods, there were significant differences in the content of titratable acid and malic acid, but not in total soluble solid in fruit juice. The content of titratable acidity after 105 days of storage (DOS) remained much higher in Ecvs than that in Mcs and Vws, and similar result was observed from the changing tendency of organic acids after 65 DOS. Prior to 135 DOS, fruit firmness, content of soluble sugar and vitamin C were higher in Mcs than those in Ecvs and Vws. The content of ethanol, acetaldehyde, methanol increased sharply at 105 DOS. At 160 DOS, the ethanol content was also significantly higher in Mcs than that in Ecvs and Vws, which aggravated fruit quality derogation and accumulated abundant off-flavor components in Mcs. During the storage, the hedonic scale of fruits in Ecvs and Vws fluctuated occasionally, the peak was observed at 35 DOS, subsequently declined gradually, and reached the lowest level at 135 DOS. Among these storage conditions, the lowest hedonic scale was detected in Mcs at 160 DOS.【Conclusion】In storage warehouse, the contents of fruit organic acids, ethanol, methanol and acetaldehyde were mainly affected by gas components, especially ethylene, and temperatures differences between storehouse and transport or shelf life conditions. And these indexes are directly related to fruit quality and organoleptic properties among these storage warehouses. Fruit quality in Mcs deteriorated at 135 DOS, while fruit in Ecvs could maintain relatively high quality until 160 DOS. Moreover, Vws is more suitable for orange short-term storage, as fruit quality degenerated gradually after 65 DOS.
    Effect of Oxidized Sheep Bone Oil on Volatile Flavor Compounds of Mutton Flavor Seasoning
    LIU Jin-Kai-1, 2 , GAO Yuan-1, WANG Zhen-Yu-1, CHEN Li-1, ZHANG De-Quan-1, AI Qi-Jun-2
    Scientia Agricultura Sinica. 2014, 47(4):  749-758.  doi:10.3864/j.issn.0578-1752.2014.04.015
    Abstract ( 607 )   HTML ( 2 )   PDF (645KB) ( 774 )   Save
    References | Related Articles | Metrics
    【Objective】The effect of a moderate addition of oxidation sheep bone oil on the volatile flavor compounds in thermal reactive mutton flavor seasoning were investigated in order to provide a scientific basis for improving the flavor of the high quality mutton flavor seasoning.【Method】Samples of oxidized sheep bone oil indicating peroxide value, acid value and p-anisidine value were prepared by the control oxidization technology. Influences of sheep bone oil on the volatile flavor compounds in thermal reactive mutton flavor seasoning were discussed. An electronic nose was used to analyze the three thermal reactive mutton flavor seasoning, including without adding sheep bone oil, adding non-oxidized sheep bone oil and adding moderate oxidized sheep bone oil. With the discrimination index of the PCA about the three mutton flavor seasonings as response value, the effects of sheep bone oil on mutton flavor seasonings were studied. The volatile flavor compounds in three systems were analyzed by solid phase micro-extraction (SPME) combined with gas chromatography mass spectrometry (GC-MS), and a parameter named “relative odor activity value (ROAV)”was applied in evaluating the contributions to global odor perception of three systems. The characteristic volatile flavor compounds of mutton flavor seasoning added with oxidized sheep bone oil were identified by cluster analysis (CA) method.【Result】The electronic nose responded differently to the flavor of different mutton flavor seasonings. The discrimination index of adding non-oxidized sheep bone oil and without adding sheep bone oil was 0.589. The discrimination index of adding oxidized sheep bone oil and without adding sheep bone oil was 0.917. The discrimination index of adding non-oxidized sheep bone oil and adding oxidized sheep bone oil was 0.787. A total of 42, 63 and 61 kinds of volatile flavor compounds were identified in the three thermal reactive mutton flavor seasonings, including without adding sheep bone oil, adding non-oxidized sheep bone oil and adding moderate oxidized sheep bone oil. Among these compounds, the predominant ones were aldehydes and hydrocarbons. The relative contents of S, N-containing heterocyclic compounds were not significantly different. Adding sheep bone oil resulted in a significant decrease in hydrocarbons relative contents but a significant increase in aldehydes. CA showed that octanal, nonanal, capraldehyde, (E, E)-2,4-decadienal, tetradecanal, heptaldehyde, (E)-2-nonenal, dodecanal, 1-octen-3-ol, heptanol, (E, E)-2,4- nonadienal were the key volatile flavor compounds of the mutton flavor seasonings. It could be known that the key volatile flavor compounds have more fat ordor with less sweet/green, burnt, and citrus smell. The 11 key volatile flavor compounds could be classified into 3 clusters. After adding oxidized sheep bone oil, the relative odor activity value of (E, E)-2,4-decadienal and (E)-2-nonenal increased, on the contrary, the relative odor activity value of capraldehyde decreased. The relative odor activity value of (E, E)-2,4-decadienal, (E)-2-nonenal and capraldehyde were not significantly different between adding non-oxidized sheep bone oil and without adding sheep bone oil.【Conclusion】After adding oxidized sheep bone oil, the kinds of the volatile flavor compounds were increased, (E, E)-2,4-decadienal and (E)-2-nonenal were the important characteristic volatile flavor compounds for improving the mutton flavor seasoning.
    ANIMAL SCIENCE·VETERINARY SCIENCERE·SOURCE INSECT
    Analysis of Bacterial Diversity in Rumen of Sika Deer (Cervus nippon) fed Different Forages Using DGGE and T-RLFP
    LI Zhi-Peng-1, JIANG Na-2, LIU Han-Lu-1, CUI Xue-Zhe-1, JING Yi-1, YANG Fu-He-1, LI Guang-Yu-1
    Scientia Agricultura Sinica. 2014, 47(4):  759-768.  doi:10.3864/j.issn.0578-1752.2014.04.016
    Abstract ( 613 )   HTML ( 2 )   PDF (710KB) ( 1138 )   Save
    References | Related Articles | Metrics
    【Objective】Bacterial communities play critical roles in the rumen fermentation of Sika deer (Cervus nippon), while the bacterial composition in the rumen of Sika deer is rarely reported. The objective of present study is to investigate the bacterial diversity in the rumen of sika deer, which can provide a molecular basis for manipulation of rumen fermentation.【Method】Four two year old male rumen-cannulated Sika deers fed oak leaf (OL group, Sika deer A and B) and corn stover (CS group, Sika deer C and D) based diets were used in the present study. After 30 days of feeding, rumen contents including solid and liquid fractions were sampled, and the microbial genomic DNA was extracted. V3 region of ruminal bacterial 16S rRNA gene and 16S rRNA gene was amplified, which was used in the DGGE and T-RFLP analysis, respectively. The clustering analysis was applied to DGGE results. The dominant bands in DGGE profiles were obtained, and then used to clone sequencing in order to indentify the bacterial communities. The results of T-RFLP were also applied to clustering analysis, and the possible bacterial structure was speculated by Microbial Community AnalysisⅢ (MiCAⅢ) dataset. 【Result】The clustering patterns of DGGE revealed that the similarity of bacterial diversity between CS group and OL group was lower than 65%, indicating that the bacterial diversity was affected by forage source. The similarity between Sika deer A and B in the OL group, and between Sika deer C and D in the CS group was greater than 70% and 75%, respectively. In addition, the differences were found between animals in the same group. A total of 20 and 24 unique DGGE bands were obtained from the OL and CS groups, respectively. Sequences analysis of DGGE showed that the bacteria in the OL group were composed of Bacteroides, Firmicutes and Proteobacteria phyla, while they were composed of Bacteroides, Firmicutes, Proteobacteria and Synergistetes phyla in the CS group. Prevotella spp. were the dominant bacteria in the OL and CS groups, but the composition of genus Prevotella at species level was different in two groups. The dominant fibrolytic bacteria in two groups includes Clostridium spp. and Eubacterium spp.. The results of T-RFLP showed that the highest the highest richness, diversity and evenness indices, and the lowest dominance index were found in Sika deer D (CS group). The diversity indices in Sika deer A and B were comparative, but lower than that in Sika deer D, suggesting that forage (oak leaf) in the OL group affected the relative biomass of rumen microbiome. There were clear discrepancies in the diversity indices of Sika deer C and D, and the diversity indices in Sika deer C were lower than Sika deer A and B, indicating that the intra-individual variation. T-RFs representing 81, 214, 272 and 308 bp in OL group were dominant, 90, 95, 175, 273 and 274 bp were predominant in CS group, and 161, 259, 264, 266 and 284 bp were presented in all animals. According to the results of MiCAⅢ, the possible bacteria represented by these T-RFs could assign to the phyla Bacteroides, Firmicutes, Proteobacteria and Acidobacteria. The clustering analysis of T-RFs showed that two clusters were generated from the T-RFs in the two groups, and the T-RFs profiles in Sika deer A, B and C were similar, indicating that forage sources affected the profiles of T-RFs.【Conclusion】These results suggested that Prevotella spp. were the dominant bacteria in rumen of sika deer. The forage source affected the rumen bacterial communities.
    Construction of Human CoaguLation Factor Ⅸ Mammry Expression Vector and Transfection
    HAN Xue-Jie, SA Ri-Na, LIANG Hao, LI Xue-Ling, LI Rong-Feng
    Scientia Agricultura Sinica. 2014, 47(4):  769-778.  doi:10.3864/j.issn.0578-1752.2014.04.017
    Abstract ( 587 )   HTML ( 1 )   PDF (745KB) ( 697 )   Save
    References | Related Articles | Metrics
    【Objective】 Human coagulation factor Ⅸ (hFIX) plays a key role in blood coagulation and is important for clinical treatment of hemophilia. The objective of this study is to construct human coagulation factor Ⅸ (hFIX) mammary expression vector and test the expression of hFIX in porcine mammary epithelial, and obtain hFIX-transgenic porcine mammary epithelial and female porcine fetal fibroblast cells to prepare to produce hFIX mammary specific expression transgenic pigs .【Method】Total RNA was extracted from human fetal liver tissues and human coagulation factor Ⅸ (hFIX) cDNA was amplified by RT-PCR followed the instructions of RNAiso Reagent and Prime Script RT-PCR Kit from TAKARA. PCR was performed to amplify bovine growth hormone (BGH) polyA fragment. Both hFIX cDNA and BGH polyA fragments were cloned to pbCSN2-RC plasmid, located after the bovine beta-Casein (CSN2) promoter, to achieve mammary specific expression vector pbCSN2-hFIX-pA-RC with neomycin- resistance and red fluorescence genes. Porcine mammary epithelial cells were obtained by culturing 1mm3 mammary tissue cubes from the breast tissue of lactation pigs that slaughtered in the local slaughterhouse and purifying with time-controlled trypsinization. The chromosome analysis was performed on the derived cells, and the cells with normal number of chromosomes were transfected with pbCSN2-hFIX-pA-RC by lipofection technology. The transfected porcine mammary epithelial cells were screened by neomycin-resistance and red fluorescent expression. The expression of hFIX was further confirmed by real-time PCR. To only transfect the female fibroblasts, the SRY PCR was performed on the porcine fibroblasts cultured in the lab to determine the sex of the cells. Finally, the confirmed vector was transferred to porcine fetal fibroblast cells by lipofection technology. 【Result】 The results of PCR and restricted endonucleases digestion analysis showed that the hFIX cDNA and BGH PolyA were cloned into pbCSN2-RC, and the pbCSN2-hFIX-pA-RC with double screening labels was successfully constructed. After screening by G418 and red fluorescent expression of transfected porcine mammary epithelial cells, the expression of hFIX directed by bovine β-casein in porcine mammary epithelial cells was confirmed by real-time PCR in the positive cells. This result indicated that the vector pbCSN2-hFIX-pA-RC has the ability to direct the hFIX mammary specific expression. Then the constructed vector was transferred into female porcine fetal fibroblasts. After screening, the positive hFIX-transgenic female porcine fetal fibroblast cells were obtained successfully. 【Conclusion】The bovine β-casein promoter can successfully direct the mammary specific expression of exogenous gene. This research has laid a massive foundation for cultivating mammary gland bioreactor by somatic cell nuclear transfer.
    The Immunostimulation of F4ac ETEC-Culture Supernatant to Porcine Small Intestinal Epithelial Cells
    ZHOU Chuan-Li-1, LIU Zheng-Zhu-1, 2 , YU Ying-1, ZHANG Qin-1
    Scientia Agricultura Sinica. 2014, 47(4):  779-785.  doi:10.3864/j.issn.0578-1752.2014.04.018
    Abstract ( 567 )   HTML ( 6 )   PDF (539KB) ( 767 )   Save
    References | Related Articles | Metrics
    【Objective】 Porcine enterotoxigenic Escherichia coli (ETEC) is a worldwide cause of bacteria induced diarrhoea in piglets. In the veterinary practices of pig production, serological identification of ETEC shows that F4ac is the most common serological type expressed in ETEC strains isolated from diarrheic piglets. So far, the mechanism by which ETEC produces diarrhoea in piglets has been clearly elucidated. However, the immunostimulation of ETEC-culture to host target cells has not been studied or described. In the present study, the immunostimulation of the supernatant of F4ac ETEC-culture to IPEC-J2 cells was studied. 【Method】 The culture of F4ac ETEC strain 200 was collected and centrifuged (4℃, 4 000 r/min for 15 min) after 12 hours in culture, and the supernatant was sterilized by passing it through a 0.22 μm filter. The solution combined the sterilized supernatant with equivalent DMEM/F12 medium was used to challenge IPEC-J2 cells for 3 hours. The IPEC-J2 cells co-cultured with fresh LB medium and equivalent DMEM/F12 medium were as the control group. For both treatments, each experiment was repeated three times. Total RNAs of the stimulated and control IPEC-J2 cells were extracted using TRIZOL Reagent following the manufacturer’s instructions. According to the manufacturer’s instructions, complementary DNA (cDNA) was synthesized from RNA using the Prime Script® RT reagent Kit with gDNA Eraser (Perfect Real Time). The cDNA samples were then analyzed with real time RT-PCR using a LightCycler® 480 Real-Time PCR System. The real time RT-PCR reactions were performed in a final volume of 20 μL with the Roche SYBR Green PCR Kit according to the manufacturer’s instructions. The pig house-keeping gene β-actin was used as the internal standards to correct the input of cDNA. Triplicate qRT-PCRs were performed on each cDNA and the average Ct was used for further analysis. The relative quantification values were calculated using the 2-ΔΔCt. Differential mRNA expression profiles of IL8、TNF-α, CXCL2, IL6, IL1A, TLR4, SLPI, PLAU and MUC13 between the stimulated and control IPEC-J2 cell groups were tested by amplification using documented and self-designed primers in the presence of SYBR Green. 【Result】 Compared with the control group, the mRNA expression of three important cytokines IL8, TNF-α and CXCL2 were up-regulated in the stimulated treatment group with the fold-change of IL8 being 3.24 (P<0.05), the fold-change of TNF-α also being 3.24 (P<0.01) and that of CXCL2 being 1.65 (P<0.001). For the rest six genes (IL6, IL1A, TLR4, SLPI, PLAU and MUC13), no statistically significant difference was observed in the mRNA expression levels between the two groups. 【Conclusion】 In this study, the IPEC-J2 cells were challenged with the supernatant of F4ac ETEC-culture for 3 hours, and it was found that this stimulation increased the mRNA expression levels of three key pro-inflammatory genes IL8, TNF-α and CXCL2, which proved that the supernatant of F4ac ETEC-culture showed immunostimulation to the IPEC-J2 cells. The discovery in this study provided insights into the immunostimulation of enterotoxin and/or adhesion of F4ac ETEC to porcine intestinal epithelial cells.
    AGRICULTURAL ECONOMY & MANAGMENT
    Study on Value Loss Evaluation Model and Compensation Mechanism of Cultivated Land Conversion
    REN Ping, WU Tao, ZHOU Jie-Ming
    Scientia Agricultura Sinica. 2014, 47(4):  786-795.  doi:10.3864/j.issn.0578-1752.2014.04.019
    Abstract ( 627 )   HTML ( 2 )   PDF (614KB) ( 855 )   Save
    References | Related Articles | Metrics
    【Objective】The most serious problem associated with the cultivated land protection project in China is the long-term neglect of ecological value and social value existing within cultivated land. The value loss along with the cultivated land conversion is much beyond the economic value estimated with traditional perspective. Based on such understanding, this research is considering the deficiency of theory for understanding cultivated land conversion, and the insufficiency of comprehensive research on the scientific questions associated with cultivated land protection/conversion, such as the value constitute, the system, and the research method, are the core problems when studying cultivated land loss and conversion. Such questions are the basic theoretic issues that must be understood. To realize quantitative evaluation and simulation of value loss happening with cultivated land conversion, this paper established a value evaluation method and model for cultivated land, so as to provide a theoretical and practical reference for cultivated land protection and compensation policy.【Method】Based on the value classification method for cultivated land resources, income capitalization approach, equivalent replacement method, and market value method were applied to establishing a comprehensive evaluation model incorporating resource economic value, social value, and ecological service value. The economic value of cultivated land resource is based on through income capitalization approach, by which a serious of yield variance weights indices for different crops are modified. The social value is estimated by equivalent replacement method, in which the basic security value is replaced by the correction parameter of urban endowment insurance, the wage level for farmers’ employment is replaced by the productivity effect of agricultural labor, and the social stability value is replaced by the regional food supply-and-demand difference parameter. Finally, based on the amendment of unit ecological equivalence factor, the economical service value of cultivated land resource is calculated by market value method, through which the correlation between the economic value of ecological service equivalence factor and the food average yield per unit area is considered. 【Result】 The evaluation model objectively restored the monetization value for cultivated land resources. The entire approach is scientific and also feasible. Besides, the model is regional-cross for the evaluation and simulation functions can be applied to different areas-it possesses favorable universality and applicability. The evaluation results by such model also showed that for Sichuan province the cultivated land protection value in 2010 was 1 million and 22.85 thousand yuan per hm2 , of which the economic value, social value and ecological service value account for 5.74%, 64.17% and 30.09% respectively. (3) Taking 2010 as the basic analysis year, the total cultivated land protection value for the entire Sichuan province in 2010 was 825 trillion and 55.2 billion yuan, and the value loss happening with the non-agriculture conversion was 43.612 billion yuan, which accounts for 2.5% of Sichuan’s GDP.【Conclusion】According to the response mode at micro level for different interest agents associated with cultivated land conversion, the function by the central government should not exclude from the compensation for value loss caused by cultivated land conversion (protection). The central government should accept the responsibility of ecological service value and social stability value for cultivated land protection, based on which a security fund will be created to support the cultivated land protectors. Meanwhile the local governments and enterprises should take the responsibility of value compensation for cultivated land value loss. There is a regional difference in cultivated land resource value. So, it is an important technical issue for construct a value assessment and amendment system for cultivated land resource in future work. Such evaluation methods and the results derived from such research could be applied to practical evaluation of value loss for cultivated land conversion. The research results could supply a theoretical foundation to create a security fund as the central government’s responsibility. Such results also will offer technical supports for framing a concrete compensation standard. Furthermore, this research will provide a new perspective for constituting the compensation mechanism of cultivated land conversion, and promote the upgrade of cultivated land protection from the traditional mode and the establishment of a new compensation mechanism for cultivated land protection.
    Analysis of International Competitive Ability of Seed Industry in China Based on the Market Share
    WANG Lei, LIU Li-Jun, SONG Min
    Scientia Agricultura Sinica. 2014, 47(4):  796-805.  doi:10.3864/j.issn.0578-1752.2014.04.020
    Abstract ( 728 )   HTML ( 6 )   PDF (659KB) ( 1380 )   Save
    References | Related Articles | Metrics
    【Objective】Seed industry is a national strategic and basic core industry. Seed industry competitiveness not only determines the development of the seed industry itself , but also determines the safety of agricultural industrialization. Nowadays, the competition of market share has become the core of the modern seed industry in international competition. Therefore, the study aims at investigating the competitiveness of China’s seed industry in the international seed market share competition.【Method】In the perspective of market share, this paper tries to illustrate and analyze the competitiveness of China’s seed industry by applying the index of revealed comparative advantage (RCA) and export quality indices (QC), by using the data from ISF, WTO and China Customs statistics. 【Result】Findings from statistical analysis show that China’s seed industry accessed less abroad market share and lost more domestic market share. Export markets are mainly concentrated in Asia (59.04%), the large markets in Africa (0.83%) and South America (0.18%) are occupied a little. China’s seed industry has little competitive species, in comparison, rice seeds and vegetable seeds now occupy more market share, they are all at around $ 100 million, while the global seed market demand for wheat, corn, soybean and other seeds occupy less market shares and they are less than $1 million. Overall, China’s seed industry is less competitive. The result of RCA clarifies that RCA index of China's seed industry is low and far less than the value of evaluation criteria 0.8, and has a large difference compared with the United States and the Netherlands. China’s seed industry has no comparative advantages, the competitiveness is weak but the uptrend is obvious. Relatively speaking, the competitiveness of vegetable varieties is higher than crop varieties. The result of QC shows that QC index of China’s seed industry is higher than the value of evaluation criteria 1, and higher than the United States and the Netherlands which is the powerful nation in seed industry. The various types of export seeds, except wheat seed and soybean seed, currently have relatively high added value, and a certain competitive advantage in the aspect of quality.【Conclusion】In the competition of the international seed market share, the competiveness of China’s seed industry is weak but rising as a whole. The added value is high as well. China’s seed industry should accelerate and consolidate the ability of expanding and controlling market share in order to cope with the fierce competition of international seed market.
    RESEARCH NOTES
    Analysis of the Relative Expression of microRNA-10 in Different Developmental Stages and Various Tissues of Hyalomma asiaticum
    YUAN Xiao-Song-1, 2 , LUO Jin-1, TIAN Zhan-Cheng-1, XIE Jun-Ren-1, WANG Fang-Fang-1, TIAN Mei-Yuan-1, ZHANG Yi-Fang-2, LIU Guang-Yuan-1
    Scientia Agricultura Sinica. 2014, 47(4):  806-813.  doi:10.3864/j.issn.0578-1752.2014.04.021
    Abstract ( 511 )   HTML ( 2 )   PDF (518KB) ( 959 )   Save
    References | Related Articles | Metrics
    【Objective】 MicroRNAs (miRNAs) are a conserved class of non-coding 20-22 nt small RNAs. miRNAs have been reported in many viruses, animals and plants such as Mareks diseased virus, fruit flies, zebra fish, humans and Arabidopsis so far. MiRNAs regulate gene expression by binding to mRNA at post-transcriptional levels, leading to mRNA inhibition or degradation. MiRNAs regulate a variety of biological processes, including cell proliferation, differentiation, metabolism and apoptosis. The purpose of this experiment is to understand the potential biological function of miR-10 in Hyalomma asiaticum. To obtain the precursor and mature of microRNA-10 (miR-10), its relative expression and the biologic significance in different developmental stages and various tissues from Hyalomma asiaticum were analyzed, which will be helpful for further study the relationship between the function of miR-10 and development of H. asiaticum. 【Method】 Total RNA of the different developmental stages and various tissues were extracted using Trizol Reagent, then transcripted to cDNA using SYBR ®Prime Script TM miRNA RT-PCR Kit( TaKaRa Code: RR716). To obtain the miR-10 precursor sequence from H. asiaticum, the specific primers were designed according to the miRBase database (Accession number: MI0012262). Then its homology was compared with the sequence from miRBas database by the MEGA4 software. The expression of miR-10 from different developmental stages and various tissues of H. asiaticum was assessed by qPCR. The biological function of miR-10 in H. asiaticum was presumed. 【Result】 A 73 bp gene was cloned by PCR, which was CUACAUCUACCCUGUAGAUCCGAAUUUGUUUGCCA CUAGACUACAAAUUCGGUUCUAGAGAGGCUUUGUGUGG. There was a relatively high genetic similarity among 16 varieties. The similarity between H. asiaticum and Ixodes scapularis was 95.9%, and 88.9%-91.7% compared with other arthropods. The miR-10 sequence was highly conserved in various species. The mature sequence of miR-10 was UACCCUGUAGAUCCGAAUUUGU,in which ACCCUGU was seed region. The expression of miR-10 that was 48.3-fold compared with the eggs and was the highest in unfed-nymph. However, the expression of miR-10 in unfed-adult and unfed-larvae was only 7.78-fold and 2.78-fold, respectively. The expression of miR-10 in the 3rd day feeding adult was 4.28-fold compared with the unfed-adult. But the expression of miR-10 in the 5th day feeding adult and fed-adult was only 0.31-fold and 0.087-fold, respectively. The relative expression levels of miR-10 increased in the early stage, but gradually decreased with the blood feeding. The relative expression levels of miR-10 among salivary gland, trachea, ovary, epidermis, midgut were remarkably different. The highest expression of miR-10 was salivary gland which was 13.2-fold compared with the epidermis that showed the lowest expression. The expression of miR-10 in ovary and trachea was 2.98-fold and 6.46-fold compared with the epidermis, respectively.【Conclusion】In the present study, the sequence of miR-10 was obtained. The analysis of miR-10 sequence suggested that it was highly conserved between arthropod. The expression of miR-10 in different developmental stages and various tissues of H. asiaticum were obviously different, which suggested that miR-10 was selectively expressed in H. asiaticum. It was deduced that according to the difference of expression and the reported function of miR-10, miR-10 may play potential roles in cell proliferation, development and blood-sucking. These results provided evidence for further study of microRNAs in parasites. MiRNA expression may be a new way for the therapeutic control of parasitic diseases in the future.
    Variation of Muscle Glycogen of IRA Rabbit After Slaughter and Its Correlation with Changes of Rabbit Meat Quality
    XUE Shan, HE Zhi-Fei, LI Hong-Jun
    Scientia Agricultura Sinica. 2014, 47(4):  814-822.  doi:10.3864/j.issn.0578-1752.2014.04.022
    Abstract ( 577 )   HTML ( 3 )   PDF (619KB) ( 860 )   Save
    References | Related Articles | Metrics
    【Objective】This paper is to discuss the relevance between the change of muscle glycogen and meat quality of IRA rabbit within 36 h slaughter. 【Method】After slaughter, the intramuscular glycogen of IRA rabbit occurs glycolysis reaction into lactic acid in a certain period of time, thus changing the pH value of the carcass, and further affecting meat quality indicators, such as water holding capacity, shear force, color and so on. The longissimus dorsi (LD) muscle and the left leg (LL) muscle were used as raw materials and the variation in content of muscle glycogen of IRA rabbit at 45 min, 4 h, 8 h, 12 h, 24 h and 36 h slaughter period was measured, respectively, by kit method, and the related meat quality indexes during corresponding post-mortem, such as pH, cooking loss, drip loss, shear force and color changes were all determined. In addition, the correlation between meat quality and muscle glycogen variation of IRA rabbit from LD and LL during the 36 h post-mortem were discussed, by the way of partial least squares regression analysis (PLS2), making the main design factors (pH, cooking loss, drip loss, total loss, shear force, L*, a*, b*, C*) as X variables, and muscle glycogen content as Y variables. 【Result】The muscle glycogen content of LD and LL of IRA rabbit decreased significantly (P<0.05) within 36 h slaughter, reduced from the initial (2.61±0.50) mg•g-1 and (2.77±0.55) mg•g-1 to (0.94±0.05) mg•g-1 and (0.99 ± 0.07) mg•g-1 after 36 h slaughter, respectively. At the same time, the pH value of LD and LL of Iraq rabbit meat decreased from (6.91 ± 0.02) and (6.85 ± 0.04) in the initial post-mortem to (5.62 ± 0.09) and (5.61 ± 0.09) after 36 h slaughter, respectively. In the meantime, the meat quality index of Ira rabbit occurred corresponding changes as the pH value decreased, such as shear strength, lightness value L*, redness value a* decreased; cooking loss, drip loss, total losses, the value of b* and the value of C* increased. PLS2 analysis shows that the correlations between the above meat quality indicators and muscle glycogen content of IRA rabbit during 36 h post-mortem were significant, and the R regression value of location LD and LL reached up to 0.796-0.972 and 0.890-0.996, respectively. Among them, the total loss indicators (sum of cooking loss and drip loss) of the two parts (LD and LL) were provided with more significant sources of variation, compared to other meat quality indexes. What’s more, these meat quality indicators after slaughter can be used as independent variables to predict the score of muscle glycogen changes of IRA rabbit successfully by using Unscrambler regression equation. 【Conclusion】The decrease of muscle glycogen of IRA rabbit within 36 h slaughter period was significant, and the variation was closely related to the corresponding meat quality. Therefore, the correlation between glycolysis law and meat quality indicator can be used to set regression equation for the better prediction of muscle glycogen content changes.