Scientia Agricultura Sinica ›› 2024, Vol. 57 ›› Issue (5): 900-908.doi: 10.3864/j.issn.0578-1752.2024.05.006

• PLANT PROTECTION • Previous Articles     Next Articles

Identification and Gene Function Analysis of StCks1, a Cyclin- Dependent Kinase Subunit of Setosphaeria turcica

ZHANG BoWen1,4(), ZHAO LiWen2, XU Lu2,4, LI Pan1,4, ZENG FanLi2,3,4, MENG YaNan2,3,4(), DONG JinGao1,3,4()   

  1. 1 College of Plant Protection, Hebei Agricultural University, Baoding 071001, Hebei
    2 College of Life Science, Hebei Agricultural University, Baoding 071001, Hebei
    3 State Key Laboratory of North China Crop Improvement and Regulation, Baoding 071001, Hebei
    4 Key Laboratory of Hebei Province for Plant Physiology and Molecular Pathology, Baoding 071001, Hebei
  • Received:2023-10-12 Accepted:2023-11-05 Online:2024-03-01 Published:2024-03-06
  • Contact: MENG YaNan, DONG JinGao

Abstract:

【Objective】Cks1 is a structural subunit of the cyclin-dependent kinase complex CDK, and is a key gene in the process of cell cycle regulation. The aim of this article is to identify the StCks1 of Setosphaeria turcica, analyze the differences in StCks1 expression and its interacting proteins during the development of appressorium of S. turcica, and to lay the foundation for further research on the role of StCks1 in the development of appressorium.【Method】By analyzing the entire genome data of the wild-type strain 01-23 of S. turcica, the StCks1 protein sequence was obtained. Using software MEGA 5.0 and online databases Pfam and SMART, phylogenetic tree construction and conserved domain analysis of Cks1 proteins from different species such as Saccharomyces cerevisiae, Schizosaccharomyces cerevisiae, and Arabidopsis thaliana were conducted. Samples were collected from different stages of appressorium of S. turcica for transcriptome sequencing and expression analysis. Using a prokaryotic induction expression system, a prokaryotic expression vector pGEX-6p-3-StCks1 was constructed, and transformed the E. coli expression strain BL21 to induce expression and purification of the recombinant protein GST-StCks1. The interaction protein of StCks1 was identified through GST pull-down, Western blot, and yeast two-hybrid assay.【Result】The only StCks1 protein coding gene was identified in the entire genome of S. turcica, which is composed of 130 amino acids. Its tertiary structure mainly consists of four strands of β-fold and three α helices, containing HxPEPH (His-any-Pro-Glu-Pro-His) conserved sites and Cks conserved domains. Through transcriptome sequencing and expression analysis, it was found that the expression level of StCks1 was significantly up-regulated at different stages of appressorium development. A large amount of soluble protein could be obtained by inducing recombinant protein GST-StCks1 at 1 mmol·L-1 IPTG and 30 ℃ for 2 h. A large number of interacting proteins were obtained using GST pull-down technology and identified by mass spectrometry. Western blot and yeast two-hybrid experiments were conducted to verify the interaction between StCks1 and the cyclin-dependent kinase CDK1.【Conclusion】There is a unique StCks1 in S. turcica, which regulates the development of appressorium through interaction with the cyclin-dependent kinase CDK1.

Key words: Setosphaeria turcica, cell cycle regulation, StCks1, prokaryotic induced expression and purification, GST pull-down

Table 1

Primers used in this study"

引物<BOLD>P</BOLD>rimer 序列Sequence (5′-3′) 酶切位点Restriction site
oMYN1: GST-StCks1-F GCGGATCCATGTTTCCACTGCATCTTTT BamH I
oMYN2: GST-StCks1-R CACTCGAGTCAGTGCATAGGAGGCTGAT Xho I

Fig. 1

StCks1 structure analysis"

Fig. 2

Phylogenetic tree construction and conserved domain analysis of StCks1 protein"

Fig. 3

Amino acid sequence alignment and protein structure model of StCks1"

Fig. 4

Development morphology and expression level of StCks1 at different appressorium stages"

Fig. 5

StCks1 digestion validation and plasmid map"

Fig. 6

Induced expression of StCks1 protein"

Fig. 7

Purification of StCks1 protein"

Fig. 8

The interaction analysis between StCks1 and CDK1"

Fig. 9

Yeast two-hybrid verification of the interaction between CDK1 and StCks1"

[1]
VAN INGHELANDT D, MELCHINGER A E, MARTINANT J P, STICH B. Genome-wide association mapping of flowering time and northern corn leaf blight (Setosphaeria turcica) resistance in a vast commercial maize germplasm set. BMC Plant Biology, 2012, 12: 56.

doi: 10.1186/1471-2229-12-56 pmid: 22545925
[2]
HUMAN M P, BERGER D K, CRAMPTON B G. Time-course RNAseq reveals Exserohilum turcicum effectors and pathogenicity determinants. Frontiers in Microbiology, 2020, 11: 360.

doi: 10.3389/fmicb.2020.00360
[3]
MENG Y N, ZENG F L, HU J J, LI P, XIAO S L, ZHOU L H, GONG J G, LIU Y W, HAO Z M, CAO Z Y, DONG J G. Novel factors contributing to fungal pathogenicity at early stages of Setosphaeria turcica infection. Molecular Plant Pathology, 2022, 23(1): 32-44.

doi: 10.1111/mpp.13140
[4]
GONG X D, FENG S Z, ZHAO J, TANG C, TIAN L, FAN Y S, CAO Z Y, HAO Z M, JIA H, ZANG J P, ZHANG Y F, HAN J M, GU S Q, DONG J G. StPBS2, a MAPK kinase gene, is involved in determining hyphal morphology, cell wall development, hypertonic stress reaction as well as the production of secondary metabolites in northern corn leaf blight pathogen Setosphaeria turcica. Microbiological Research, 2017, 201: 30-38.

doi: 10.1016/j.micres.2017.04.009
[5]
EBBOLE D J. Magnaporthe as a model for understanding host-pathogen interactions. Annual Review of Phytopathology, 2007, 45: 437-456.

doi: 10.1146/phyto.2007.45.issue-1
[6]
DOHLMAN H G. G proteins and pheromone signaling. Annual Review of Physiology, 2002, 64: 129-152.

pmid: 11826266
[7]
ZHANG S R, HAO Z M, WANG L H, SHEN S, CAO Z Y, XIN Y Y, HOU M L, GU S Q, HAN J M, DONG J G. StRas2 regulates morphogenesis, conidiation and appressorium development in Setosphaeria turcica. Microbiological Research, 2012, 167(8): 478-486.

doi: 10.1016/j.micres.2012.02.009
[8]
SHEN S, HAO Z M, GU S Q, WANG J J, CAO Z Y, LI Z Y, WANG Q, LI P, HAO J, DONG J G. The catalytic subunit of cAMP-dependent protein kinase A StPKA-c contributes to conidiation and early invasion in the phytopathogenic fungus Setosphaeria turcica. FEMS Microbiology Letters, 2013, 343: 135-144.

doi: 10.1111/femsle.2013.343.issue-2
[9]
MA S X, CAO K K, LIU N, MENG C, CAO Z Y, DAI D Q, JIA H, ZANG J P, LI Z Y, HAO Z M, GU S Q, DONG J G. The StLAC 2 gene is required for cell wall integrity, DHN-melanin synthesis and the pathogenicity of Setosphaeria turcica. Fungal Biology, 2017, 121(6/7): 589-601.

doi: 10.1016/j.funbio.2017.04.003
[10]
ZHANG M M, ZHANG S Q. Mitogen-activated protein kinase cascades in plant signaling. Journal of Integrative Plant Biology, 2022, 64(2): 301-341.

doi: 10.1111/jipb.13215
[11]
ZENG F L, MENG Y N, HAO Z M, LI P, ZHAI W B, SHEN S, CAO Z Y, DONG J G. Setosphaeria turcica ATR turns off appressorium- mediated maize infection and triggers melanin-involved self- protection in response to genotoxic stress. Molecular Plant Pathology, 2020, 21(3): 401-414.

doi: 10.1111/mpp.v21.3
[12]
MENG Y N, ZHANG X J, ZENG F L, ZHAI W B, LI P, HU J J, XIAO S L, HAO Z M, CAO Z Y, CHEN C, DONG J G. Transcriptional regulation of secondary metabolism and autophagy genes in response to DNA replication stress in Setosphaeria turcica. Journal of Integrative Agriculture, 2023, 22(4): 1068-1081.

doi: 10.1016/j.jia.2022.07.002
[13]
OSÉS-RUIZ M, SAKULKOO W, LITTLEJOHN G R, MARTIN- URDIROZ M, TALBOT N J. Two independent S-phase checkpoints regulate appressorium-mediated plant infection by the rice blast fungus Magnaporthe oryzae. Proceedings of the National Academy of Sciences of the United States of America, 2017, 114(2): E237-E244.
[14]
SAUNDERS D G, AVES S J, TALBOT N J. Cell cycle-mediated regulation of plant infection by the rice blast fungus. The Plant Cell, 2010, 22(2): 497-507.

doi: 10.1105/tpc.109.072447 pmid: 20190078
[15]
KCIUK M, GIELECIŃSKA A, MUJWAR S, MOJZYCH M, KONTEK R. Cyclin-dependent kinase synthetic lethality partners in DNA damage response. International Journal of Molecular Sciences, 2022, 23(7): 3555.

doi: 10.3390/ijms23073555
[16]
KAISER P, MONCOLLIN V, CLARKE D J, WATSON M H, BERTOLAET B L, REED S I, BAILLY E. Cyclin-dependent kinase and Cks/Suc1 interact with the proteasome in yeast to control proteolysis of M-phase targets. Genes and Development, 1999, 13(9): 1190-1202.

doi: 10.1101/gad.13.9.1190
[17]
刘雪琴, 任凭, 张择, 曾凡力. 酿酒酵母Cdk1抑制蛋白的研究进展. 生物化学与生物物理进展, 2018, 45(5): 512-518.
LIU X Q, REN P, ZHANG Z, ZENG F L. The progress of cell cycle Cdk1 inhibitors in budding yeast. Progress in Biochemistry and Biophysics, 2018, 45(5): 512-518. (in Chinese)
[18]
COOLS T, DE VEYLDER L. DNA stress checkpoint control and plant development. Current Opinion in Plant Biology, 2009, 12(1): 23-28.

doi: 10.1016/j.pbi.2008.09.012 pmid: 19010080
[19]
CHEN N, GONG J, CHEN X, XU M, HUANG Y, WANG L, GENG N, ZHOU Q. Cytokeratin expression in malignant melanoma: Potential application of in situ hybridization analysis of mRNA. Melanoma Research, 2009, 19(2): 87-93.

doi: 10.1097/CMR.0b013e3283252feb
[20]
INUI N, KITAGAWA K, MIWA S, HATTORI T, CHIDA K, NAKAMURA H, KITAGAWA M. High expression of Cks1 in human non-small cell lung carcinomas. Biochemical and Biophysical Research Communications, 2003, 303(3): 978-984.

pmid: 12670508
[21]
SHAPIRA M, BEN-IZHAK O, LINN S, FUTERMAN B, MINKOV I, HERSHKO D D. The prognostic impact of the ubiquitin ligase subunits Skp2 and Cks1 in colorectal carcinoma. Cancer, 2005, 103(7): 1336-1346.

pmid: 15717322
[22]
HINDLEY J, PHEAR G, STEIN M, BEACH D. Suc1+ encodes a predicted 13-kilodalton protein that is essential for cell viability and is directly involved in the division cycle of Schizosaccharomyces pombe. Molecular and Cellular Biology, 1987, 7(1): 504-511.
[23]
YUE X, QUE Y, DENG S, XU L, OSES-RUIZ M, TALBOT N J, PENG Y, WANG Z. The cyclin dependent kinase subunit Cks1 is required for infection-associated development of the rice blast fungus Magnaporthe oryzae. Environmental Microbiology, 2017, 19: 3959-3981.

doi: 10.1111/emi.2017.19.issue-10
[24]
HAYLES J, AVES S, NURSE P. Suc1 is an essential gene involved in both the cell cycle and growth in fission yeast. The EMBO Journal, 1986, 5(12): 3373-3379.

doi: 10.1002/embj.1986.5.issue-12
[1] ZHANG ShuHong, GAO FengJu, WU QiuYing, JI JingXin, ZHANG YunFeng, XU Ke, GU ShouQin, FAN YongShan. Cloning and Expression Analysis of Heat Shock Protein HSP 9/12 Genes in Setosphaeria turcica [J]. Scientia Agricultura Sinica, 2025, 58(18): 3648-3663.
[2] WANG ChengZe, ZHANG Yan, FU Wei, JIA JingZhe, DONG JinGao, SHEN Shen, HAO ZhiMin. Bioinformatics and Expression Pattern Analysis of Maize ACO Gene Family [J]. Scientia Agricultura Sinica, 2024, 57(7): 1308-1318.
[3] ZHANG ShuHong, ZHANG YunFeng, GAO FengJu, WU QiuYing, XU Ke, LI YaZi, LI YanMei, GU ShouQin, FAN YongShan, GONG XiaoDong. Cloning and Expression Analysis of Genes of Small Heat Shock Protein in Setosphaeria turcica [J]. Scientia Agricultura Sinica, 2024, 57(17): 3384-3397.
[4] ZOU JinPeng, YUE HaoFeng, LI HaiXiao, LIU Zheng, LIU Ning, CAO ZhiYan, DONG JinGao. Mechanism of StLAC2 and StLAC6 Differentially Affecting Setosphaeria turcica Based on Non-Targeted Metabonomics Analysis [J]. Scientia Agricultura Sinica, 2023, 56(16): 3110-3223.
[5] HAO YuBin,LI HaiXiao,ZHANG Sai,LIU Ning,LIU YingZi,CAO ZhiYan,DONG JinGao. Identification and Functional Analysis of StSCD Family in Setosphaeria turcica [J]. Scientia Agricultura Sinica, 2022, 55(16): 3134-3143.
[6] LI TianCong,ZHU Hang,WEI Ning,LONG Feng,WU JianYing,ZHANG Yan,DONG JinGao,SHEN Shen,HAO ZhiMin. The Expression Pattern and Interaction Analysis of the Homologues of Splicing Factor SC35 in Setosphaeria turcica [J]. Scientia Agricultura Sinica, 2021, 54(4): 733-743.
[7] LONG Feng,WANG Qing,ZHU Hang,WANG JianXia,SHEN Shen,LIU Ning,HAO ZhiMin,DONG JinGao. Identification and Expression Pattern Analysis of Septin Gene Family of Setosphaeria turcica [J]. Scientia Agricultura Sinica, 2020, 53(24): 5017-5026.
[8] DOU WanFu,QI JingJing,HU AnHua,CHEN ShanChun,PENG AiHong,XU LanZhen,LEI TianGang,YAO LiXiao,HE YongRui,LI Qiang. Screening of Interacting Proteins of Anti-Canker Transcription Factor CsBZIP40 in Citrus by GST Pull-Down Combined with LC-MS/MS [J]. Scientia Agricultura Sinica, 2019, 52(13): 2243-2255.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!