Scientia Agricultura Sinica ›› 2021, Vol. 54 ›› Issue (20): 4466-4477.doi: 10.3864/j.issn.0578-1752.2021.20.019

• ANIMAL SCIENCE·VETERINARY SCIENCE·RESOURCE INSECT • Previous Articles     Next Articles

Alternative Splicing of TNNT3 and Its Effect on the Differentiation of MuSCs in Goat

CHEN Yuan(),CAI He,LI Li,WANG LinJie,ZHONG Tao,ZHANG HongPing()   

  1. Farm Animal Genetic Resources Exploration and Innovation Key Laboratory of Sichuan Province, Sichuan Agricultural University, Chengdu 611130
  • Received:2020-09-09 Accepted:2021-05-13 Online:2021-10-16 Published:2021-10-25
  • Contact: HongPing ZHANG E-mail:Chyuan201301@163.com;zhp@sicau.edu.cn

Abstract:

【Objective】As a member of the troponin (Tn) family, TNNT3 (Fast Skeletal Troponin T3) involves skeletal muscle contraction, growth, development, and even meat characteristics of domestic animals. This study initially aimed to identify the alternative splicing of goat (Capra hirus) TNNT3. 【Method】Based on goat TNNT3 (NM_001314210. 1) and cattle TNNT3 (XM_010821200) mRNA sequence from NCBI (National Center for Biotechnology Information), the primers were designed by using the Primer Premier 6.0 software, subsequently, TNNT3 was amplified from skeletal muscles of embryo Jianyang Bigear Goat. The obtained TNNT3 sequences were then bioinformatically analyzed by using ORF Finder, EditSeq, DNAMAN, ClustalW, and MEGA_X_10.1.8. Furthermore, the levels of TNNT3 isoforms were quantified by using real-time fluorescence quantitative PCR (RT-qPCR) and semi-quantitative PCR in longissimus dorsi (LD) muscle, semimembranosus (SM) muscle, heart, liver, spleen, lung, and kidney, at seven stages (E75, E90, E105, B3, B45, B150, and B300), respectively. Additionally, the coding ability of transcript TNNT3_3 in vitro and its effect on the differentiation of goat skeletal muscle satellite cells (MuSCs) were explored. 【Result】① A total of five isoforms (named TNNT3_1-5) of the TNNT3 gene were identified in pooled RNA extracted from goat muscles, and the complete coding sequence (CDS) sequence mainly contained 18 exons. ② Nucleotide sequence and amino acid sequence of the goat TNNT3 gene were highly consistent with sheep, cattle, pig, and other mammals, but low with that of fish and reptiles, indicating the high evolutionary conservation of the TNNT3 gene in mammals. ③ The TNNT3 mRNA was presented in all seven detected tissues but highly enriched in LD and SM muscles (P < 0.01), followed by cardiac muscle and lung. Furthermore, the levels of TNNT3 mRNA in SM muscles were higher than that in LD muscles in prenatal goats (P < 0.05), while the verse results were presented postnatal (P < 0.05). ④ The conserved exon 9-11 (138 bp) of goat TNNT3 was repeated in the transcript TNNT3_3. TNNT3_3 was amplified, and it was found out that which could encode protein, and the protein size was basically the same as expected (37 kDa) in TnT transcriptional translation system in vitro. Moreover, the transfection of TNNT3_3 into goat MuSCs induced mRNA levels of myogenic differentiation marker genes, including Myomaker, MyoG, and MyH4, comparing with the control (P < 0.01). 【Conclusion】Five isoforms with complete CDS region of the TNNT3 gene were obtained in goat muscles. The sequence and expression of TNNT3 were highly conserved in mammals and enriched in muscles, indicating that potentially TNNT3 gene functions critically in muscle growth and development.

Key words: goat, TNNT3, alternative splicing, quantitative PCR, TnT transcriptional translation in vitro, Western blotting, myogenic differentiation

Fig. 1

Molecular structure and interaction proteins of Troponin T (B) and alternative spliced exons of three TnT isoforms (A), (Adapted from literature[20-22]) A: Alternative spliced exons of three TnT isoforms: Red box indicated alternatively spliced exons; Blue box indicated embryonic specific exons; Green box indicated avian exons; B: Proteins interact with TnT"

Table 1

Information of primer sequence for the TNNT3 genes"

引物名称
Primer name
引物序列(5′— 3′)
Primer sequence (5′— 3′)
产物长度
Product length (bp)
退火温度
Annealing temperature (℃)
用途
Purpose
P1 TNNT3 F: ACCATGTCGGACGAGGAAGT
R: CACTCTACTTCCAGCACCC
835 58.0 克隆CDS区全长
Cloning the full length of CDS
P2 q-TNNT3 F:AGGAGGGCTGAGGACGAT
R:CGGTCTCCAGCTTGTAC
253 52.7 定量PCR
Quantitative PCR
P3 TNNT3_1-5 F: ACCATGTCGGACGAGGAAGT
R:CTCCTTGAGGGCGACCAGC
253 60.0 半定量PCR
Semi-quantitative PCR
P4 TNT- TNNT3_3 F:CCCAAGCTTATGTCGGACGAGGAAGTCGA
R:CCGCTCGAGCTTCCAGCGCCCGCCAACTT
957 58.9 TNT体外转录载体构建
Construction of TNT transcriptional vector in vitro
P5 pTNNT3_3 F:CCGCTCGAGATGTCGGACGAGGAAGTCGA
R:CCCAAGCTTCTTCCAGCGCCCGCCAACTT
957 59.2 过表达载体构建
Construction of overexpression vectors
P6 β-actin F:CCTGCGGCATTCACGAAACTAC
R:ACAGCACCGTGTTGGCGTAGAG
87 59.7 定量PCR
Quantitative PCR

Fig. 2

PCR amplification, cloning results of TNNT3 gene in goats and comparison results of different alternative transcripts sequences with the goat genome database A: PCR products of TNNT3 full-length CDS region (835bp); B: PCR products of TNNT3 isoforms from monoclonal bacteria solution; C: qPCR products with TNNT3 transcripts at alternative fragment (Exon4-8: 193bp-253bp ; M1: DNA Marker DL 2000 bp; M2: DNA Marker DL 5000 bp; D: Comparison results of different alternative transcripts sequences with the Goat genome database; The red box is an exon site that can be alternative splicing; E: Amino acid sequences of different alternative transcripts of TNNT3 in goats; Green box: The first degraded product in skeletal muscle[18]; Red box: the Exon 9-11 of TNNT3_3 is repeated with 46 amino acid; Blue box: Exon 16 and 17 coding amino acid are alternatively spliced in a mutually exclusive manner[25]; F: TNNT3 alternative transcripts domain prediction"

Table 2

Amino acid sequence information predicted of goat TNNT3 alternative transcripts"

序列名称
Sequence name
CDS区长度
Length of CDS (nt)
外显子数
Exon count
氨基酸长度
Amino acid length (AA)
蛋白质分子量
Protein molecular weight (kD)
等电点
Isoelectric point
TNNT3_1 783 15 260 30.64 8.61
TNNT3_2 753 15 250 29.73 8.30
TNNT3_3 954 20 317 37.40 6.77
TNNT3_4 801 16 266 31.39 6.72
TNNT3_5 741 14 246 29.17 9.15

Fig. 3

Phylogenetic tree and evolutionary analysis of the TNNT3 amino acid sequence"

Fig. 4

The different alternative transcripts of goat TNNT3 distribution and expression levels at different stages A: The mRNA level of TNNT3 in different tissues; B: The semi-quantitative result of goat TNNT3 alternative transcripts in different tissues; C: The mRNA level of TNNT3 in different development stages of LD and SM; D: The semi-quantitative result of TNNT3 alternative transcripts in different development stages of LD and SM; The different capital letter/ lowercase letter indicated extremely significant difference (P<0.01);During the same period, the significant of expression between the two tissues was expressed as * (P<0.05) ** (P<0.01)"

Fig. 5

Transcription in vitro and overexpression of TNNT3_3 and its effect on the differentiation in goat MuSCs A: Construction of TNNT3_3 transcriptional vector in vitro; B: Western blot results of TNNT3_3 transcriptional protein in vitro; C: mRNA levels of marker genes in the proliferative/ differentiation stage of MuSCs treated with TNNT3_3 vector; D: MyHC immunofluorescence results after differentiation for 7 days; M1:DNA marker DL 2000 bp;M2:DNA marker DL 5000 bp;M3:Protein marker"

[1] BARTON P J R, MULLEN A J, CULLEN M E, DHOOT G K, SIMON-CHAZOTTES D, GUÉNET J L. Genes encoding troponin I and troponin T are organized as three paralogous pairs in the mouse genome. Mammalian Genome, 2000, 11(10):926-929. doi: 10.1007/s003350010171.
doi: 10.1007/s003350010171
[2] GONG H Y, HATCH V, ALI L, LEHMAN W, CRAIG R, TOBACMAN L S. Mini-thin filaments regulated by troponin-tropomyosin. PNAS, 2005, 102(3):656-661. doi: 10.1073/pnas.0407225102.
doi: 10.1073/pnas.0407225102
[3] CHEN H, ZHANG J, YU B, LI L, SHANG Y. Molecular cloning, structural analysis, and tissue expression of the TNNT3 gene in Guizhou black goat. Gene, 2015. 573(1):123-128.
doi: 10.1016/j.gene.2015.07.038
[4] EBASHI S. Third component participating in the superprecipitation of ‘natural actomyosin’. Nature, 1963, 200:1010. doi: 10.1038/ 2001010a0.
doi: 10.1038/ 2001010a0
[5] OTSUKI I, MASAKI T, NONOMURA Y, EBASHI S. Periodic distribution of troponin along the thin filament. Journal of Biochemistry, 1967, 61(6):817-819. doi: 10.1093/oxfordjournals. jbchem.a128619.
doi: 10.1093/oxfordjournals. jbchem.a128619
[6] STEFANCSIK R, RANDALL J D, MAO C, SARKAR S. Structure and sequence of the human fast skeletal troponin T (TNNT3) gene: insight into the evolution of the gene and the origin of the developmentally regulated isoforms. Comparative and Functional Genomics, 2003, 4(6):609-625. doi: 10.1002/cfg.343.
doi: 10.1002/cfg.343
[7] FLICKER P F, PHILLIPS G N, Jr COHEN C. Troponin and its interactions with tropomyosin. An electron microscope study. Journal of Molecular Biology, 1982. 162(2):495-501.
doi: 10.1016/0022-2836(82)90540-X
[8] CHAUDHURI T, MUKHERJEA M, SACHDEV S, RANDALL J D, SARKAR S. Role of the fetal and alpha/beta exons in the function of fast skeletal troponin T isoforms: correlation with altered Ca2+ regulation associated with development. Journal of Molecular Biology, 2005, 352(1):58-71. doi: 10.1016/j.jmb.2005.06.066.
doi: 10.1016/j.jmb.2005.06.066
[9] BLACK A J, RAVI S, JEFFERSON L S, KIMBALL S R, SCHILDER R J. Dietary fat quantity and type induce transcriptome-wide effects on alternative splicing of pre-mRNA in rat skeletal muscle. The Journal of Nutrition, 2017, 147(9):1648-1657. doi: 10.3945/jn.117. 254482.
doi: 10.3945/jn.117. 254482
[10] JU Y, LI J, XIE C, RITCHLIN C T, XING L, HILTON M J, SCHWARZ E M. Troponin T3 expression in skeletal and smooth muscle is required for growth and postnatal survival: characterization of Tnnt3(tm2a(KOMP)Wtsi) mice. Genesis, 2013. 51(9):667-675.
[11] BLACK A J, SCHILDER R J, KIMBALL S R. Palmitate-and C6 ceramide-induced Tnnt3 pre-mRNA alternative splicing occurs in a PP2A dependent manner. Nutrition & Metabolism, 2018, 15:87. doi: 10.1186/s12986-018-0326-3.
doi: 10.1186/s12986-018-0326-3
[12] LEE Y, RIO D C. Mechanisms and regulation of alternative pre-mRNA splicing. Annual Review of Biochemistry, 2015, 84:291-323. doi: 10.1146/annurev-biochem-060614-034316.
doi: 10.1146/annurev-biochem-060614-034316
[13] NARO C, SETTE C. Phosphorylation-mediated regulation of alternative splicing in cancer. International Journal of Cell Biology, 2013, 2013:151839. doi: 10.1155/2013/151839.
doi: 10.1155/2013/151839
[14] LOPEZ A J. Alternative splicing of pre-mRNA: developmental consequences and mechanisms of regulation. Annual Review of Genetics, 1998, 32:279-305. doi: 10.1146/annurev.genet.32.1.279.
doi: 10.1146/annurev.genet.32.1.279
[15] GRAVELEY B R. Alternative splicing: increasing diversity in the proteomic world. Trends in Genetics, 2001, 17(2):100-107. doi: 10.1016/s0168-9525(00)02176-4.
doi: 10.1016/s0168-9525(00)02176-4
[16] BARALLE F E, GIUDICE J. Alternative splicing as a regulator of development and tissue identity. Nature Reviews Molecular Cell Biology, 2017, 18(7):437-451. doi: 10.1038/nrm.2017.27.
doi: 10.1038/nrm.2017.27
[17] SUNYAEV S, HANKE J, BRETT D, AYDIN A, ZASTROW I, LATHE W, BORK P, REICH J. Individual variation in protein-coding sequences of human genome. Advances in Protein Chemistry, 2000, 54:409-437. doi: 10.1016/s0065-3233(00)54012-1.
doi: 10.1016/s0065-3233(00)54012-1
[18] MUROYA S, NAKAJIMA I, CHIKUNI K. Amino acid sequences of multiple fast and slow troponin T isoforms expressed in adult bovine skeletal muscles. Journal of Animal Science, 2003, 81(5):1185-1192. doi: 10.2527/2003.8151185x.
doi: 10.2527/2003.8151185x
[19] MUROYA S, OHNISHI-KAMEYAMA M, OE M, NAKAJIMA I, CHIKUNI K. Postmortem changes in bovine troponin T isoforms on two-dimensional electrophoretic gel analyzed using mass spectrometry and western blotting: the limited fragmentation into basic polypeptides. Meat Science, 2007, 75(3):506-514. doi: 10.1016/j.meatsci.2006. 08.012.
doi: 10.1016/j.meatsci.2006. 08.012
[20] JIN J P, SAMANEZ R A. Evolution of a metal-binding cluster in the NH2-terminal variable region of avian fast skeletal muscle troponin T: functional divergence on the basis of tolerance to structural drifting. Journal of Molecular Evolution, 2001, 52(2):103-116. doi: 10.1007/ s002390010139.
doi: 10.1007/ s002390010139
[21] KLEIN P, OLOKO M, ROTH F, MONTEL V, MALERBA A, JARMIN S, GIDARO T, POPPLEWELL L, PERIE S, LACAU ST GUILY J, DE LA GRANGE P, ANTONIOU M N, DICKSON G, BUTLER-BROWNE G, BASTIDE B, MOULY V, TROLLET C. Nuclear poly(A)-binding protein aggregates misplace a pre-mRNA outside of SC35 speckle causing its abnormal splicing. Nucleic Acids Research, 2016. 44(22):10929-10945.
doi: 10.1093/nar/gkw703
[22] WEI B, JIN J P. TNNT1, TNNT2, and TNNT3: Isoform genes, regulation, and structure-function relationships. Gene, 2016, 582(1):1-13. doi: 10.1016/j.gene.2016.01.006.
doi: 10.1016/j.gene.2016.01.006
[23] SCHIAFFINO S, SANDRI M, MURGIA M. Activity-dependent signaling pathways controlling muscle diversity and plasticity. Physiology (Bethesda, Md), 2007, 22:269-278. doi: 10.1152/physiol. 00009.2007.
doi: 10.1152/physiol. 00009.2007
[24] LIVAK K J, SCHMITTGEN T D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods, 2001, 25(4):402-408.
doi: 10.1006/meth.2001.1262
[25] MEDFORD R M, NGUYEN H T, DESTREE A T, SUMMERS E, NADAL-GINARD B. A novel mechanism of alternative RNA splicing for the developmentally regulated generation of troponin T isoforms from a single gene. Medical Acupuncture, 1984, 38(2):409-421. doi: 10.1016/0092-8674(84)90496-3.
doi: 10.1016/0092-8674(84)90496-3
[26] JAYASINGHE R G, CAO S, GAO Q, WENDL M C, VO N S, REYNOLDS S M, ZHAO Y, CLIMENTE-GONZÁLEZ H, CHAI S, WANG F, VARGHESE R, HUANG M, LIANG W W, WYCZALKOWSKI M A, SENGUPTA S, LI Z, PAYNE S H, FENYÖ D, MINER J H, WALTER M J, CANCER GENOME ATLAS RESEARCH NETWORK, VINCENT B, EYRAS E, CHEN K, SHMULEVICH I, CHEN F, DING L. Systematic analysis of splice-site-creating mutations in cancer. Cell Reports, 2018, 23(1): 270-281.e3. doi: 10.1016/j.celrep. 2018.03.052.
doi: 10.1016/j.celrep. 2018.03.052
[27] BREITBART R E, NADAL-GINARD B. Complete nucleotide sequence of the fast skeletal troponin T gene. Alternatively spliced exons exhibit unusual inter species divergence. Journal of Molecular Biology, 1986, 188(3):313-324. doi: 10.1016/0022-2836(86)90157-9.
doi: 10.1016/0022-2836(86)90157-9
[28] WANG J, JIN J P. Primary structure and developmental acidic to basic transition of 13 alternatively spliced mouse fast skeletal muscle troponin T isoforms. Gene, 1997, 193(1):105-114. doi: 10.1016/ s0378-1119(97)00100-5.
doi: 10.1016/ s0378-1119(97)00100-5
[29] BRIGGS M M, SCHACHAT F. Origin of fetal troponin T: developmentally regulated splicing of a new exon in the fast troponin T gene. Developmental Biology, 1993, 158(2):503-509. doi: 10.1006/ dbio.1993.1208.
doi: 10.1006/ dbio.1993.1208
[30] WU Q L, JHA P K, DU Y, LEAVIS P C, SARKAR S. Overproduction and rapid purification of human fast skeletal beta troponin T using Escherichia coli expression vectors: functional differences between the alpha and beta isoforms. Cancer Biology & Medicine, 1995, 155(2):225-230. doi: 10.1016/0378-1119(94)00846-k.
doi: 10.1016/0378-1119(94)00846-k
[31] CHALFANT C E, RATHMAN K, PINKERMAN R L, WOOD R E, OBEID L M, OGRETMEN B, HANNUN Y A. De novo ceramide regulates the alternative splicing of caspase 9 and Bcl-x in A549 lung adenocarcinoma cells. Dependence on protein phosphatase-1. The Journal of Biological Chemistry, 2002, 277(15):12587-12595. doi: 10.1074/jbc.m112010200.
doi: 10.1074/jbc.m112010200
[32] BRANDIMARTI P, COSTA-JÚNIOR J M, FERREIRA S M, PROTZEK A O, SANTOS G J, CARNEIRO E M, BOSCHERO A C, REZENDE L F. Cafeteria diet inhibits insulin clearance by reduced insulin-degrading enzyme expression and mRNA splicing. The Journal of Endocrinology, 2013, 219(2):173-182. doi: 10.1530/joe- 13-0177.
doi: 10.1530/joe- 13-0177
[33] MARDEN J H, FESCEMYER H W, SAASTAMOINEN M, MACFARLAND S P, VERA J C, FRILANDER M J, HANSKI I. Weight and nutrition affect pre-mRNA splicing of a muscle gene associated with performance, energetics and life history. Journal of Experimental Biology, 2008. 211(Pt 23):3653-3660.
doi: 10.1242/jeb.023903
[34] SCHILDER R J, KIMBALL S R, MARDEN J H, JEFFERSON L S. Body weight-dependent troponin T alternative splicing is evolutionarily conserved from insects to mammals and is partially impaired in skeletal muscle of obese rats. The Journal of Experimental Biology, 2011, 214(pt 9):1523-1532. doi: 10.1242/jeb.051763.
doi: 10.1242/jeb.051763
[35] BENTZINGER C F, WANG Y X, RUDNICKI M A. Building muscle: molecular regulation of myogenesis. Cold Spring Harb Perspect Biology, 2012. 4(2).
[36] CHAL J, POURQUIÉ O. Making muscle: skeletal myogenesis in vivo and in vitro. Development (Cambridge, England), 2017, 144(12):2104-2122. doi: 10.1242/dev.151035.
doi: 10.1242/dev.151035
[37] DU M, WANG B, FU X, YANG Q, ZHU M J. Fetal programming in meat production. Meat Science, 2015, 109:40-47. doi: 10.1016/j. meatsci.2015.04.010.
doi: 10.1016/j. meatsci.2015.04.010
[38] WEI B, LU Y, JIN J P. Deficiency of slow skeletal muscle troponin T causes atrophy of type I slow fibres and decreases tolerance to fatigue. The Journal of Physiology, 2014, 592(6):1367-1380. doi: 10.1113/ jphysiol.2013.268177.
doi: 10.1113/ jphysiol.2013.268177
[39] DALY S B, SHAH H, O'SULLIVAN J, ANDERSON B, BHASKAR S, WILLIAMS S, AL-SHEQAIH N, MUEED BIDCHOL A, BANKA S, NEWMAN W G, GIRISHA K M. Exome Sequencing Identifies a Dominant TNNT3 Mutation in a Large Family with Distal Arthrogryposis. Molecular Syndromology, 2014. 5(5):218-228.
[40] SANDARADURA S A, BOURNAZOS A, MALLAWAARACHCHI A, CUMMINGS B B, WADDELL L B, JONES K J, TROEDSON C, SUDARSANAM A, NASH B M, PETERS G B, ALGAR E M, MACARTHUR D G, NORTH K N, BRAMMAH S, CHARLTON A, LAING N G, WILSON M J, DAVIS M R, COOPER S T. Nemaline myopathy and distal arthrogryposis associated with an autosomal recessive TNNT3 splice variant. Human Mutation, 2018, 39(3):383-388. doi: 10.1002/humu.23385.
doi: 10.1002/humu.23385
[41] BIESIADECKI B J, CHONG S M, NOSEK T M, JIN J P. Troponin T core structure and the regulatory NH2-terminal variable region. Biochemistry, 2007, 46(5):1368-1379. doi: 10.1021/bi061949m.
doi: 10.1021/bi061949m
[1] JIA ZiCheng, QIN BingYu, MA CaiYing, DU Yong, LIU TongGao, XUE RuiLin, WANG XiaoLong, ZHOU ShiWei. Effects of Diets with Different Nutritional Levels on Maternal-Infant Integrated Production Performance and Rumen Microorganisms of Double-Lamb Shanbei White Cashmere Goats [J]. Scientia Agricultura Sinica, 2026, 59(3): 668-686.
[2] WU Qiong, XIE XiangTing, WANG Lei, MOU Yong, LI JinWei. Development and Validation of Event-Specific PCR Method for the Quantification of Genetically Modified Soybean DBN8205 [J]. Scientia Agricultura Sinica, 2026, 59(1): 29-40.
[3] WANG Niu, SHI XinRan, ZHANG WeiDong, WANG Xin. Effect of FGF5 and FGF21 on Proliferation of Dermal Papilla Cells in Cashmere Goat [J]. Scientia Agricultura Sinica, 2025, 58(4): 819-830.
[4] ZHAO Jie, ZHAO LongYuan, PAN NingHui, GUAN LiRong, DU YunLong, LI ChengYun, WANG YunYue, XIE Yong. Hydrolase Gene BGIOSGA023826 Involved in Regulation of Resistance Process to Rice Blast [J]. Scientia Agricultura Sinica, 2024, 57(23): 4607-4618.
[5] ZHANG Ying, YUAN QingYun, REN Fang, HU GuoJun, FAN XuDong, DONG YaFeng. Establishment of RT-qPCR Detection Technology for GINV and Its Spatial and Temporal Distribution in Different Grape Rootstocks [J]. Scientia Agricultura Sinica, 2024, 57(14): 2771-2780.
[6] CHEN HengGuang, PEI XiaoMeng, XIA YuTing, LIU Jing, MAO DaGan. Effects of Adding Curcumin to Perinatal Diets on Production Performance, Blood Indexes and Gene Expression of Inflammatory Factors in Goats [J]. Scientia Agricultura Sinica, 2024, 57(12): 2483-2496.
[7] WANG Peng, LIU ZiYi, LIU YuFang, CHU MingXing. miR-535 Targets the GAB2 Gene to Promote Goat Granulosa Cell Proliferation Through Activation of the PI3K/AKT Signaling Pathway [J]. Scientia Agricultura Sinica, 2023, 56(23): 4757-4771.
[8] LI MeiXuan, ZHANG XiangKun, WANG Li, QIAO YueLian, SHI XiaoXin, DU GuoQiang. The Variation of GRSPaV in Different Parts of Shine Muscat Grapevines During Their Phenological Periods [J]. Scientia Agricultura Sinica, 2023, 56(21): 4234-4244.
[9] CAO Peng, XU JianJian, LI ChuXin, WANG XinLiang, WANG ChunQing, SONG ChenHu, SONG Zhen. Real-Time Quantitative PCR Detection of Citrus Yellow Mosaic Virus and Its Spatial and Temporal Distribution in Host Plants [J]. Scientia Agricultura Sinica, 2023, 56(18): 3574-3584.
[10] LI YunJing, XIAO Fang, WU YuHua, LI Jun, GAO HongFei, ZHAI ShanShan, LIANG JinGang, WU Gang. Establishment and Standardization of Event-Specific Real-Time Quantitative PCR Detection Method of Stress-Resistant Soybean IND-ØØ41Ø-5 [J]. Scientia Agricultura Sinica, 2023, 56(13): 2443-2460.
[11] LI Qi, YANG ChangHeng, WANG Yong, LIN YaQiu, XIANG Hua, ZHU JiangJiang. Role of FATP1 in Promoting Lipid Deposition in Goat Intramuscular Adipocytes [J]. Scientia Agricultura Sinica, 2023, 56(10): 2007-2020.
[12] LI Heng,ZI XiangDong,WANG Hui,XIONG Yan,LÜ MingJie,LIU Yu,JIANG XuDong. Screening of Key Regulatory Genes for Litter Size Trait Based on Whole Genome Re-Sequencing in Goats (Capra hircus) [J]. Scientia Agricultura Sinica, 2022, 55(23): 4753-4768.
[13] LI XiaoJing,ZHANG SiYu,LIU Di,YUAN XiaoWei,LI XingSheng,SHI YanXia,XIE XueWen,LI Lei,FAN TengFei,LI BaoJu,CHAI ALi. Establishment and Application of Rapid Quantitative Detection of Viable Plasmodiophora brassicae by PMAxx-qPCR Method [J]. Scientia Agricultura Sinica, 2022, 55(10): 1938-1948.
[14] DU Yu,WANG Yong,MENG QingYong,ZHU JiangJiang,LIN YaQiu. Knockdown Goat KLF12 to Promote Subcutaneous Adipocytes Differentiation [J]. Scientia Agricultura Sinica, 2022, 55(1): 184-196.
[15] ZHAO Le,YANG HaiLi,LI JiaLu,YANG YongHeng,ZHANG Rong,CHENG WenQiang,CHENG Lei,ZHAO YongJu. Expression Patterns of TETs and Programmed Cell Death Related Genes in Oviduct and Uterus of Early Pregnancy Goats [J]. Scientia Agricultura Sinica, 2021, 54(4): 845-854.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!