Scientia Agricultura Sinica ›› 2021, Vol. 54 ›› Issue (14): 3029-3042.doi: 10.3864/j.issn.0578-1752.2021.14.009

• PLANT PROTECTION • Previous Articles     Next Articles

Knockout of Single Allele of fl(2)d Significantly Decreases the Fecundity and Fertility inPlutella xylostella

LI FeiFei(),WANG BeiBei,LAI YingFang,YANG FeiYing,YOU MinSheng(),HE WeiYi()   

  1. State Key Laboratory of Ecological Pest Control for Fujian and Taiwan Crops/Institute of Applied Ecology, Fujian Agriculture and Forestry/International Joint Research Laboratory of Ecological Pest Control, Ministry of Education, Fujian Agriculture and Forestry University/Key Laboratory of Integrated Pest Management for Fujian-Taiwan Crops, Ministry of Agriculture and Rural Affairs, Fujian Agriculture and Forestry/Ministerial and Provincial Joint Innovation Centre for Safety Production of Cross-Strait Crops, Fuzhou 350002
  • Received:2020-11-06 Accepted:2021-01-15 Online:2021-07-16 Published:2021-07-26
  • Contact: MinSheng YOU,WeiYi HE E-mail:lff0371@163.com;msyou@fafu.edu.cn;wy.he@fafu.edu.cn

Abstract:

【Objective】 RNA methylation is the main form of epigenetic modification at post-transcriptional level, which is involved in many important cellular processes. The diamondback moth, Plutella xylostella, is an important oligophagous insect pest, causing serious loss on the production of cruciferous vegetables. However, the function of RNA methylation-related genes in P. xylostella is still unclear. The present study aims to identify and clone the homologous fl(2)d, one of the members of the RNA methylation protein complex (writers), to determine the expression pattern offl(2)d, and to knockout fl(2)d using CRISPR/Cas9 for the investigation of its biological functions in P. xylostella.【Method】The sequence of homologous fl(2)d was identified in the genome database ofP. xylostella, which was used for PCR amplification of the coding sequence (CDS). Quantitative real-time PCR (qRT-PCR) was used to study the relative expression levels of fl(2)d in different developmental stages and adult gonads of P. xylostella. The fl(2)d was edited using CRISPR/Cas9 combined with egg injection. Each of the adults that developed from the injected eggs was used to pair with a wild-type adult for reproduction. Offspring of the same population was forced to inbreed by single-pair mating to establish the mutant strains. The differences of genetic characters, biological parameters and phenotypes between mutants and wild-type individuals were recorded and compared to decipher the function offl(2)d.【Result】The CDS of fl(2)d with length of 912 bp was isolated, the expression of which was high in female pupa, adult and egg, moderate in male adult and pupa, the lowest in larva, and significantly higher in ovary than in testis of adult. The sgRNAs targeting fl(2)d and the Cas9 protein were mixed to inject eggs, and the offsprings carrying mutant alleles were screened for homozygous strains based on single-pair inbreeding for 10 generations. Three types of heterozygous mutant strains both predicted to cause frameshift of the CDS were obtained, with the deletion of 4 (Δfl(2)d213-4), 5 (Δfl(2)d213-5) and 7 (Δfl(2)d213-7) bases. During the screening process, six and two homozygous mutants from Δ fl(2)d213-4 and Δ fl(2)d213-5 strains were identified, respectively. The homozygous mutants of Δ fl(2)d213-4 successfully mated in two pairs, but no eggs were produced. Meanwhile, each two male adults of homozygous mutants of either Δ fl(2)d213-4 or Δ fl(2)d213-5 were mated with the same type of female heterozygous mutant, and also no eggs were produced. The results indicated that individuals with homozygousfl(2)d mutation may have extremely low survival rate and not be able to produce offspring. Through analyzing separation ratio of the genotypes of offspring from the inbreeding of heterozygous mutants and the hybridization between heterozygous mutants and wild-type, it was found that the ratio of heterozygous mutant individuals to wild-type was slightly less than 2 and 1, respectively, indicating that heterozygous mutation of fl(2)d would affect the normal growth and development of P. xylostella, and in some cases would lead to death. The offsprings of mutant individuals, which carry a mutant allele, showed a sex ratio close to 1﹕1 (P<0.05). It was speculated that thefl(2)d might not be involved in sex determination in P. xylostella. For the mating consists of mutant adults, the fecundity and hatchability were significantly lower (P<0.01) than the mating between wild-type adults. Most of the eggs produced from the mutant parents look abnormal, and could not hatch normally due to water loss and shrinkage. Based on the dissection of adult gonads, it was found that the number of attached eggs on the ovary of the mutant female adult and the wild-type female adult that has mated with mutant male adult was less than that of the wild-type virgin female adult, while no obvious abnormality was found for the testis of mutant male adult. Some of the hatched heterozygous mutants showed different degrees of distortion during the whole developmental process, resulting in the failure to complete life cycle. A small part of the heterozygous mutant individuals could develop normally, and thus transmit the mutant allele to their offspring. According to our findings, a model of genetic control ofP. xylostella based on fl(2)d was proposed.【Conclusion】The fl(2)d is involved in the reproductive process and embryonic development ofP. xylostella, mutation of which significantly affects the population size of the offspring, making it an ideal target for the genetic control of P. xylostella.

Key words: Plutella xylostella, fl(2)d, heterozygous mutant, fecundity, fertility

Table 1

Primer sequences used in this study"

引物名称Primer name 序列Sequence (5′-3′) 用途Usage
Fl(2)d-ORF-F CGAGGAGACAGAACGCCTT 克隆fl(2)d
Cloning offl(2)d
Fl(2)d-ORF-R GGTGACGGTGAGGGGTTC
qPCR-Fl(2)d-F CGGAGCTCAAATCATCACACGC fl(2)d定量表达
qRT-PCR of fl(2)d
qPCR-Fl(2)d-R GCCCAGGTCCTCATTCTCCT
RPL32-F CAATCAGGCCAATTTACCGC 内参基因RPL32定量表达
qRT-PCR of reference RPL32
RPL32-R CTGGGTTTACGCCAGTTACG
Fl(2)d-Mut-TF GTATAATCCAATGAAGGTATGACAG 突变检测
Mutation detection
Fl(2)d-Mut-TR CCTACAGTGAAACCCGCAA
CRISPR-F1 TAATACGACTCACTATAGGAAGCCTGGAAAAGGCGAAAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC 合成sgRNA
Synthesis of sgRNAs
CRISPR-F2 TAATACGACTCACTATAGGAAGGCTAGCAGCTAAAGAACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCC
CRISPR-R AAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCTCTAAAA

Fig. 1

Flow chart for screening mutant strains of fl(2)d in P. xylostella The circle denotes nucleus. The rectangle inside circle denotes the chromosome targeted for gene editing. The rectangle filled with blank indicates the wild-type, and the rectangles filled with different colors indicate different types of mutations"

Fig. 2

Cloning and expression profiling of fl(2)d in P. xylostella "

Fig. 3

Gene editing of fl(2)din P. xylostella "

Table 2

The segregation of fl(2)dgenotypes from G2 to G10 generation "

G2代至G10代不同基因型个体数
Numbers of different genotypes from G2 to G10
AA×Aa(亲本基因型Parental genotype) Aa×Aa(亲本基因型Parental genotype)
Δfl(2)d-4 Δfl(2)d-5 Δfl(2)d-7 P=0.05, df=1,
χ2=3.841
Δfl(2)d-4 Δfl(2)d-5 Δfl(2)d-7 P=0.05, df=1, χ2=3.841
AA Aa AA Aa AA Aa Aa/AA χ2 AA Aa aa AA Aa aa AA Aa aa Aa/AA χ2
G2 13 13 11 11 22 20 0.957 0.044 6 16 0 / / / 3 9 0 2.778 0.721
G3 19 19 / / 40 30 0.831 0.926 15 24 3 7 5 2 10 16 0 1.406 2.506
G4 / / / / 14 14 1.000 0 7 16 3 14 30 0 11 19 0 2.031 0.095
G5 20 14 25 37 1 3 1.174 0.640 / / / 11 17 0 13 23 0 1.667 0.500
G6 5 3 23 21 20 8 0.667 3.200 / / / 15 25 0 2 6 0 1.824 0.094
G7 17 7 18 12 19 15 0.630 4.545 / / / 2 10 0 / / / 5.000 2.063
G8 6 6 6 4 19 15 0.806 0.643 / / / 3 7 0 1 3 0 2.500 0.339
G9 / / 7 9 11 9 1.000 0 / / / / / / / / / / /
G10 / / / / 18 26 1.444 1.455 / / / 3 5 0 / / / 1.667 0.031
合计Total 80 62 90 94 164 140 0.886 0.292 28 56 6 55 99 2 40 76 0 1.878 0.488

Fig. 4

Effects of fl(2)dmutation on the fecundity, hatchability and sex ratio of P. xylostella "

Fig. 5

Comparison of reproductive phenotypes of fl(2)dmutant and wild-type female adults of P. xylostella "

Fig. 6

The model of genetic control of P. xylostella based on fl(2)d "

[1] FURLONG M J, WRIGHT D J, DOSDALL L M. Diamondback moth ecology and management: Problems, progress, and prospects. Annual Reviews of Entomology, 2013, 58:517-541.
doi: 10.1146/annurev-ento-120811-153605
[2] LI Z Y, FENG X, LIU S S, YOU M S, FURLONG M J. Biology, ecology, and management of the diamondback moth in China. Annual Review of Entomology, 2016, 61:277-296.
doi: 10.1146/annurev-ento-010715-023622
[3] GURR G M, REYNOLDS O L, JOHNSON A C, DESNEUX N, ZALUCKI M P, FURLONG M J, LI Z Y, AKUTSE K S, CHEN J H, GAO X W, YOU M S. Landscape ecology and expanding range of biocontrol agent taxa enhance prospects for diamondback moth management. A review. Agronomy for Sustainable Development, 2018, 38:23.
doi: 10.1007/s13593-018-0500-z
[4] 曾宝胜, 许军, 陈树清, 谭安江, 黄勇平. 昆虫种群的遗传调控. 中国科学: 生命科学, 2013, 43(12):1098-1104.
doi: 10.1360/052013-315
ZENG B S, XU J, CHEN S Q, TAN A J, HUANG Y P. Genetic regulation of insect populations. Scientia Sinica Vitae, 2013, 43(12):1098-1104. (in Chinese)
doi: 10.1360/052013-315
[5] 徐雪娇, 何玮毅, 杨婕, 陈玮, 尤民生. 害虫遗传防控技术的研究与运用. 中国科学: 生命科学, 2019, 49(8):938-950.
doi: 10.1360/N052018-00256
XU X J, HE W Y, YANG J, CHEN W, YOU M S. Research and applications of genetics-based methods for pest control. Scientia Sinica Vitae, 2019, 49(8):938-950. (in Chinese)
doi: 10.1360/N052018-00256
[6] CHEN W, YANG F Y, XU X J, KUMAR U, HE W Y, YOU M S. Genetic control of Plutella xylostella in omics era. Archives of Insect Biochemistry and Physiology, 2019, 102(3):e21621.
[7] SHELTON A M, LONG S J, WALKER A S, BOLTON M, COLLINS H L, REVUELTA L, JOHNSON L M, MORRISON N I. First field release of a genetically engineered, self-limiting agricultural pest insect: Evaluating its potential for future crop protection. Frontiers in Bioengineering and Biotechnology, 2020, 7:482.
doi: 10.3389/fbioe.2019.00482
[8] YOU M S, YUE Z, HE W Y, YANG X H, YANG G, XIE M, ZHAN D L, BAXTER S W, VASSEUR L, GURR G M, et al. A heterozygous moth genome provides insights into herbivory and detoxification. Nature Genetics, 2013, 45(2):220-225.
doi: 10.1038/ng.2524
[9] JIN L, WALKER A S, FU G L, HARVEY-SAMUEL T, DAFA’ALLA T, MILES A, MARUBBI T, GRANVILLE D, HUMPHREY-JONES N, O’CONNELL S, MORRISON N I, ALPHEY L. Engineered female-specific lethality for control of pest Lepidoptera. ACS Synthetic Biology, 2013, 2(3):160-166.
doi: 10.1021/sb300123m
[10] HARVEY-SAMUEL T, MORRISON N I, WALKER A S, MARUBBI T, YAO J, COLLINS H L, GORMAN K, DAVIES T G, ALPHEY N, WARNER S, SHELTON A M, ALPHEY L. Pest control and resistance management through release of insects carrying a male-selecting transgene. BMC Biology, 2015, 13:49.
doi: 10.1186/s12915-015-0161-1
[11] PAN T. N6-methyl-adenosine modification in messenger and long non-coding RNA. Trends in Biochemical Sciences, 2013, 38(4):204-209.
doi: 10.1016/j.tibs.2012.12.006
[12] ROUNDTREE I A, EVANS M E, PAN T, HE C. Dynamic RNA modifications in gene expression regulation. Cell, 2017, 169(7):1187-1200.
doi: 10.1016/j.cell.2017.05.045
[13] BATISTA P J, MOLINIE B, WANG J, QU K, ZHANG J J, LI L J, BOULEY D M, LUJAN E, HADDAD B, DANESHVAR K, et al. m6A RNA modification controls cell fate transition in mammalian embryonic stem cells. Cell Stem Cell, 2014, 15(6):707-719.
doi: 10.1016/j.stem.2014.09.019
[14] FU Y, DOMINISSINI D, RECHAVI G, HE C. Gene expression regulation mediated through reversible m6A RNA methylation. Nature Reviews. Genetics, 2014, 15(5):293-306.
doi: 10.1038/nrg3724
[15] DOMINISSINI D, MOSHITCH-MOSHKOVITZ S, SCHWARTZ S, SALMON-DIVON M, UNGAR L, OSENBERG S, CESARKAS K, JACOB-HIRSCH J, AMARIGLIO N, KUPIEC M, SOREK R, RECHAVI G. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature, 2012, 485(7397):201-206.
doi: 10.1038/nature11112
[16] MEYER K D, SALETORE Y, ZUMBO P, ELEMENTO O, MASON C E, JAFFREY S R. Comprehensive analysis of mRNA methylation reveals enrichment in 3′ UTRs and near stop codons. Cell, 2012, 149(7):1635-1646.
doi: 10.1016/j.cell.2012.05.003
[17] DOMINISSINI D, MOSHITCH-MOSHKOVITZ S, SALMON- DIVON M, AMARIGLIO N, RECHAVI G. Transcriptome-wide mapping of N6-methyladenosine by m6A-seq based on immunocapturing and massively parallel sequencing. Nature Protocols, 2013, 8(1):176-189.
doi: 10.1038/nprot.2012.148
[18] WU B X, LI L, HUANG Y, MA J, MIN J B, MIN J R. Readers, writers and erasers of N6-methylated adenosine modification. Current Opinion in Structural Biology, 2017, 47:67-76.
doi: 10.1016/j.sbi.2017.05.011
[19] ZHOU Z L, LICKLIDER L J, GYGI S P, REED R. Comprehensive proteomic analysis of the human spliceosome. Nature, 2002, 419(6903):182-185.
doi: 10.1038/nature01031
[20] HORIUCHI K, KAWAMURA T, IWANARI H, OHASHI R, NAITO M, KODAMA T, HAMAKUBO T. Identification of Wilms’ tumor 1-associating protein complex and its role in alternative splicing and the cell cycle. Journal of Biological Chemistry, 2013, 288(46):33292-33302.
doi: 10.1074/jbc.M113.500397
[21] LIU J Z, YUE Y N, HAN D L, WANG X, FU Y, ZHANG L, JIA G F, YU M, LU Z K, DENG X, DAI Q, CHEN W Z, HE C. A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. Nature Chemical Biology, 2014, 10(2):93-95.
doi: 10.1038/nchembio.1432
[22] BANSAL H, YIHUA Q, IYER S P, GANAPATHY S, PROIA D, PENALVA L O, UREN P J, SURESH U, CAREW J S, KARNAD A B, WEITMAN S, TOMLINSON G E, RAO M K, KORNBLAU S M, BANSAL S. WTAP is a novel oncogenic protein in acute myeloid leukemia. Leukemia, 2014, 28(5):1171-1174.
doi: 10.1038/leu.2014.16
[23] JIANG T, LI J S, QIAN P, XUE P, XU J, CHEN Y R, ZHU J, TANG S M, ZHAO Q L, QIAN H Y, SHEN X J. The role of N6- methyladenosine modification on diapause in silkworm (Bombyx mori) strains that exhibit different voltinism. Molecular Reproduction and Development, 2019, 86(12):1981-1992.
doi: 10.1002/mrd.v86.12
[24] LI B Q, WANG X Y, LI Z Q, LU C C, ZHANG Q, CHANG L, LI W S, CHENG T C, XIA Q Y, ZHAO P. Transcriptome-wide analysis of N6-methyladenosine uncovers its regulatory role in gene expression in the LepidopteranBombyx mori. Insect Molecular Biology, 2019, 28(5):703-715.
doi: 10.1111/imb.v28.5
[25] WANG M, XIAO Y, LI Y, WANG X Y, QI S Z, WANG Y, ZHAO L W, WANG K, PENG W J, LUO G Z, XUE X F, JIA G F, WU L M. RNA m6A modification functions in larval development and caste differentiation in honeybee (Apis mellifera). Cell Reports, 2021, 34(1):108580.
doi: 10.1016/j.celrep.2020.108580
[26] GUO J, TANG H W, LI J, PERRIMON N, YAN D. Xio is a component of theDrosophila sex determination pathway and RNA N6-methyladenosine methyltransferase complex. Proceedings of the National Academy of Sciences of the United States of America, 2018, 115(14):3674-3679.
[27] HAUSSMANN I U, BODI Z, SANCHEZ-MORAN E, MONGAN N P, ARCHER N, FRAY R G, SOLLER M. m6A potentiates Sxl alternative pre-mRNA splicing for robust Drosophilasex determination. Nature, 2016, 540(7632):301-304.
doi: 10.1038/nature20577
[28] LENCE T, AKHTAR J, BAYER M, SCHMID K, SPINDLER L, HO C H, KREIM N, ANDRADE-NAVARRO M A, POECK B, HELM M, ROIGNANT J Y. m6A modulates neuronal functions and sex determination in Drosophila. Nature, 2016, 540(7632):242-247.
doi: 10.1038/nature20568
[29] GRANADINO B, SAN JUAN A, SANTAMARIA P, SANCHEZ L. Evidence of a dual function infl(2)d, a gene needed forsex-lethal expression in Drosophila melanogaster. Genetics, 1992, 130(3):597-612.
doi: 10.1093/genetics/130.3.597
[30] ORTEGA A, NIKSIC M, BACHI A, WILM M, SANCHEZ L, HASTIE N, VALCARCEL J. Biochemical function of female-lethal (2)D/Wilms’ tumor suppressor-1-associated proteins in alternative pre-mRNA splicing. Journal of Biological Chemistry, 2003, 278(5):3040-3047.
doi: 10.1074/jbc.M210737200
[31] GRANADINO B, CAMPUZANO S, SANCHEZ L. The Drosophila melanogaster fl(2)dgene is needed for the female-specific splicing ofsex-lethal RNA. The EMBO Journal, 1990, 9(8):2597-2602.
doi: 10.1002/embj.1990.9.issue-8
[32] GRANADINO B, PENALVA L O, SANCHEZ L. The gene fl(2)d is needed for the sex-specific splicing of transformer pre-mRNA but not fordouble-sex pre-mRNA in Drosophila melanogaster. Molecular and General Genetics, 1996, 253(1/2):26-31.
doi: 10.1007/s004380050292
[33] BURNETTE J M, HATTON A R, LOPEZ A J. Trans-acting factors required for inclusion of regulated exons in the Ultrabithorax mRNAs of Drosophila melanogaster. Genetics, 1999, 151(4):1517-1529.
doi: 10.1093/genetics/151.4.1517
[34] ORTEGA A. Localization of the Drosophilaprotein fl(2)d in somatic cells and female gonads. Cell and Tissue Research, 2005, 320(2):361-367.
doi: 10.1007/s00441-004-1049-5
[35] TRAUT W, NIIMI T, IKEO K, SAHARA K. Phylogeny of the sex-determining gene sex-lethal in insects. Genome, 2006, 49(3):254-262.
doi: 10.1139/g05-107
[36] FUJII T, SHIMADA T. Sex determination in the silkworm, Bombyx mori: A female determinant on the W chromosome and the sex-determining gene cascade. Seminars in Cell and Developmental Biology, 2007, 18(3):379-388.
doi: 10.1016/j.semcdb.2007.02.008
[37] TANG W Q, YU L Y, HE W Y, YANG G, KE F S, BAXTER S W, YOU S J, DOUGLAS C J, YOU M S. DBM-DB: The diamondback moth genome database. Database, 2014, 2014: bat087.
doi: 10.1093/database/bat087
[38] CHEN W, DONG Y H, SAQIB H S A, VASSEUR L, ZHOU W W, ZHENG L, LAI Y F, MA X L, LIN L Y, XU X J, BAI J L, HE W Y, YOU M S. Functions of duplicated glucosinolate sulfatases in the development and host adaptation of Plutella xylostella. Insect Biochemistry and Molecular Biology, 2020, 119:103316.
doi: 10.1016/j.ibmb.2020.103316
[39] PING X L, SUN B F, WANG L, XIAO W, YANG X, WANG W J, ADHIKARI S, SHI Y, LV Y, CHEN Y S, et al. Mammalian WTAP is a regulatory subunit of the RNA N6-methyladenosine methyltransferase. Cell Research, 2014, 24(2):177-189.
doi: 10.1038/cr.2014.3
[40] FUKUSUMI Y, NARUSE C, ASANO M. WTAP is required for differentiation of endoderm and mesoderm in the mouse embryo. Developmental Dynamics, 2008, 237(3):618-629.
doi: 10.1002/dvdy.v237:3
[41] HORIUCHI K, UMETANI M, MINAMI T, OKAYAMA H, TAKADA S, YAMAMOTO M, ABURATANI H, REID P C, HOUSMAN D E, HAMAKUBO T, KODAMA T. Wilms’ tumor 1-associating protein regulates G2/M transition through stabilization of cyclin A2 mRNA. Proceedings of the National Academy of Sciences of the United States of America, 2006, 103(46):17278-17283.
[42] NARUSE C, FUKUSUMI Y, KAKIUCHI D, ASANO M. A novel gene trapping for identifying genes expressed under the control of specific transcription factors. Biochemical and Biophysical Research Communications, 2007, 361(1):109-115.
doi: 10.1016/j.bbrc.2007.06.161
[43] HONGAY C F, ORR-WEAVER T L. Drosophila inducer of MEiosis 4 (IME4) is required for Notch signaling during oogenesis. Proceedings of the National Academy of Sciences of the United States of America, 2011, 108(36):14855-14860.
[44] KAN L J, GROZHIK A V, VEDANAYAGAM J, PATIL D P, PANG N, LIM K S, HUANG Y C, JOSEPH B, LIN C J, DESPIC V, et al. The m6A pathway facilitates sex determination in Drosophila. Nature Communications, 2017, 8:15737.
doi: 10.1038/ncomms15737
[45] SINGH A, BUEHNER N A, LIN H, BARANOWSKI K J, FINDLAY G D, WOLFNER M F. Long-term interaction betweenDrosophila sperm and sex peptide is mediated by other seminal proteins that bind only transiently to sperm. Insect Biochemistry and Molecular Biology, 2018, 102:43-51.
doi: 10.1016/j.ibmb.2018.09.004
[46] SLOAN N S, LOVEGROVE M, SIMMONS L W. Social manipulation of sperm competition intensity reduces seminal fluid gene expression. Biology Letters, 2018, 14(1):20170659.
doi: 10.1098/rsbl.2017.0659
[47] WIGBY S, SIROT L K, LINKLATER J R, BUEHNER N, CALBOLI F C F, BRETMAN A, WOLFNER M F, CHAPMAN T. Seminal fluid protein allocation and male reproductive success. Current Biology, 2009, 19(9):751-757.
doi: 10.1016/j.cub.2009.03.036
[48] SIMMONS L W, LOVEGROVE M. Socially cued seminal fluid gene expression mediates responses in ejaculate quality to sperm competition risk. Proceedings of the Royal Society B: Biological Sciences, 2017, 284(1861):20171486.
[49] NEUBAUM D M, WOLFNER M F. Mated Drosophila melanogaster females require a seminal fluid protein, Acp36DE, to store sperm efficiently. Genetics, 1999, 153(2):845-857.
doi: 10.1093/genetics/153.2.845
[50] SIROT L K, BUEHNER N A, FIUMERA A C, WOLFNER M F. Seminal fluid protein depletion and replenishment in the fruit fly, Drosophila melanogaster: An ELISA-based method for tracking individual ejaculates. Behavioral Ecology and Sociobiology, 2009, 63(10):1505-1513.
doi: 10.1007/s00265-009-0806-6
[51] GRANADINO B, SAN JUÁN A B, SÁNCHEZ L. The gene fl(2)d is required for various Sxl-controlled processes in Drosophila females. Roux’s Archives of Developmental Biology, 1991, 200(3):172-176.
doi: 10.1007/BF00190237
[52] BOURTZIS K, LEES R S, HENDRICHS J, VREYSEN M J B. More than one rabbit out of the hat: Radiation, transgenic and symbiont- based approaches for sustainable management of mosquito and tsetse fly populations. Acta Tropica, 2016, 157:115-130.
doi: 10.1016/j.actatropica.2016.01.009
[53] FLORES H A, O’NEILL S L. Controlling vector-borne diseases by releasing modified mosquitoes. Nature Reviews. Microbiology, 2018, 16(8):508-518.
doi: 10.1038/s41579-018-0025-0
[54] MEZA J S, UL HAQ I, VREYSEN M J B, BOURTZIS K, KYRITSIS G A, CÁCERES C. Comparison of classical and transgenic genetic sexing strains of Mediterranean fruit fly (Diptera: Tephritidae) for application of the sterile insect technique. PLoS ONE, 2018, 13(12):e0208880.
doi: 10.1371/journal.pone.0208880
[55] ZHANG Z J, NIU B L, JI D F, LI M W, LI K, JAMES A A, TAN A J, HUANG Y P. Silkworm genetic sexing through W chromosome- linked, targeted gene integration. Proceedings of the National Academy of Sciences of the United States of America, 2018, 115(35):8752-8756.
[56] GANTZ V M, JASINSKIENE N, TATARENKOVA O, FAZEKAS A, MACIAS V M, BIER E, JAMES A A. Highly efficient Cas9-mediated gene drive for population modification of the malaria vector mosquito Anopheles stephensi. Proceedings of the National Academy of Sciences of the United States of America, 2015, 112(49):E6736-6743.
[57] HAMMOND A, GALIZI R, KYROU K, SIMONI A, SINISCALCHI C, KATSANOS D, GRIBBLE M, BAKER D, MAROIS E, RUSSELL S, BURT A, WINDBICHLER N, CRISANTI A, NOLAN T. A CRISPR-Cas9 gene drive system targeting female reproduction in the malaria mosquito vector Anopheles gambiae. Nature Biotechnology, 2016, 34(1):78-83.
doi: 10.1038/nbt.3439
[1] YAN WenYing, ZHANG YuanZhen, WU HongXin, PANG Rui, CHEN ZePeng, JIN FengLiang, XU XiaoXia. Construction of an RNAi-Enhanced Metarhizium anisopliae Targeting PxGNBP3 and Its Immunoregulatory Mechanism in Plutella xylostella [J]. Scientia Agricultura Sinica, 2026, 59(3): 556-574.
[2] LI Lin, ZHANG YuanZhen, YAN WenYing, ZENG Lu, PANG Rui, XU XiaoXia, JIN FengLiang. The Role of miR-6497-x in Regulating the Reaction of Plutella xylostella to Fungal Infection [J]. Scientia Agricultura Sinica, 2025, 58(8): 1550-1563.
[3] LI ShaoXing, SONG WenFeng, WEI ZeYu, ZHOU YuLing, SONG LiXia, REN Ke, MA Qun, WANG LongChang. Effects of Straw and Milk Vetch Mulching on Soil Fertility and Sweet Potato Yield [J]. Scientia Agricultura Sinica, 2025, 58(8): 1591-1603.
[4] CHEN JunQuan, MA ChiYuan, HU Xin, LI Duo, GUO YanQi, LIU Can, ZHOU Kai, ZHENG TaiHui. Effects of Incorporation of Inorganic-Organic Fertilizers on Soil Fertility, Ecological Stoichiometric Characteristics, and Yields of Rice Cropping System in the Red Soil Region of China [J]. Scientia Agricultura Sinica, 2025, 58(23): 4952-4966.
[5] WU WenQi, JIAO Yang, XI JiaZhen, WANG XuFeng, GUO BoSen, SHEN YuFang. Effects of Different Organic Materials Combined with Chemical Fertilizer on Soil Fertility and Maize Grain Yield [J]. Scientia Agricultura Sinica, 2025, 58(23): 4966-4978.
[6] LIU HaoKai, FENG YouNa, LI Jing, LIANG Qian. Insecticidal Active Components and Mechanisms of Essential Oils from Illicium verum and Curcuma phaeocaulis Against Plutella xylostella [J]. Scientia Agricultura Sinica, 2025, 58(19): 3905-3918.
[7] WU Yong, WEN Xue, WANG TianShu, HUANG YanYan, MENG YiLi, JIANG HongYu, BI LiDong, WU HuiJun, YAO ShuiHong. The Influence of Topographic Factors and Ridge Tillage Methods on Soil Nutrients and Fertility Index of Sloping Arable Land in the Black Soil Region [J]. Scientia Agricultura Sinica, 2025, 58(18): 3676-3689.
[8] DONG YunQi, HUANG Jian, CHAI YiXiao, YANG ShiChao, WANG Min, MENG XuSheng, GUO ShiWei. Changes in Annual Yield and Soil Fertility of Rice-Rapeseed Rotation Under Different Fertilization Modes [J]. Scientia Agricultura Sinica, 2025, 58(16): 3201-3219.
[9] HUO RunXia, FANG YaTing, ZHANG YanKe, WU HaiYa, LIU GuiSheng, LI XiaoKun, REN Tao, LU ZhiFeng, CONG RiHuan, LU JianWei. Effects of Fertilizer Reduction on Crop Yield and Soil Fertility Under Long-Term Straw-Return Conditions in Rice-Rice-Rapeseed Rotations [J]. Scientia Agricultura Sinica, 2025, 58(16): 3267-3279.
[10] YANG MingLu, ZHANG HaiLiang, LUO HanPeng, HUANG XiXia, ZHANG HanLin, ZHANG ShiShi, WANG Yan, LIU Lin, GUO Gang, WANG YaChun. Estimation of Genetic Parameters and Genome-Wide Association Study of Heat Indicators in Holstein Cattle Based on Collar-Mounted Device [J]. Scientia Agricultura Sinica, 2023, 56(5): 995-1006.
[11] GE TianCheng, YIN Fei, HU QiongBo, PENG ZhengKe, LI ZhenYu. Function of MBF2 Transcriptionally Regulating Glutathione S-transferase Metabolizing Chlorantraniliprole in Plutella xylostella [J]. Scientia Agricultura Sinica, 2023, 56(4): 665-673.
[12] HUO RunXia, ZHANG Zhe, LI WenPing, ZHANG YangYang, LIAO ShiPeng, REN Tao, LI XiaoKun, LU ZhiFeng, CONG RiHuan, LU JianWei. 40 Years’ Change Characteristics of Soil Basic Properties in the Main Planting Area of Winter Oilseed Rape [J]. Scientia Agricultura Sinica, 2023, 56(23): 4696-4705.
[13] SHEN Tong, WANG HengFei, DU WenBo, ZHOU HuaiPing, WANG Rui, ZHANG JianJie, JIN DongSheng, XU MingGang. Spatial-Temporal Variability Characteristics and Main Controlling Factors of Soil Fertility in Shouyang County of Cinnamon Soil Area [J]. Scientia Agricultura Sinica, 2023, 56(21): 4259-4271.
[14] WU ZhiJie, ZHANG LiLi, SHI YuanLiang, WEI ZhanBo, LI DongPo, GONG Ping, LI Jie, ZHANG Lei, WANG LingLi, WU KaiKuo, XUE Yan, SONG YuChao, CUI Lei. Origin, Present Situation and Development Trend of Green Fertilizer [J]. Scientia Agricultura Sinica, 2023, 56(13): 2530-2546.
[15] LI JiaYan,SUN LiangJie,MA Nan,WANG Feng,WANG JingKuan. Carbon and Nitrogen Fixation Characteristics of Maize Root and Straw Residues in Brown Soil Under High and Low Fertility [J]. Scientia Agricultura Sinica, 2022, 55(23): 4664-4677.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!