Scientia Agricultura Sinica ›› 2020, Vol. 53 ›› Issue (17): 3597-3605.doi: 10.3864/j.issn.0578-1752.2020.17.016

• ANIMAL SCIENCE·VETERINARY SCIENCE·RESOURCE INSECT • Previous Articles     Next Articles

Screening and Analysis of Follicular Development Related Genes in Goat

ZHAO YuanYuan1(),LI PengFei2,XU QinZhi1,AN QingMing1,MENG JinZhu1()   

  1. 1Tongren University, Tongren 554300, Guizhou
    2College of Life Science, Shanxi Agricultural University, Taigu 030801, Shanxi
  • Received:2019-06-24 Accepted:2020-07-10 Online:2020-09-01 Published:2020-09-11
  • Contact: JinZhu MENG E-mail:84840293@163.com;mjz122021@126.com

RichHTML

25

PDF

490

Abstract:

【Background】 Dominant follicles (DF) and subordinate follicles (SF) were the most important two stages in the follicle development in the first follicle wave of goat. With further development of follicles, DF may eventually develop into mature follicles until ovulation, and SF will move towards atresia, while apoptosis of granulosa cells is the key factor leading to follicular atresia. However, the molecular mechanisms of promoting follicle dominance or causing its atresia are still unclear. 【Objective】This study was aimed to screen the key genes affecting follicular development and provide a theoretical basis for further exploring the regulation mechanism of follicular development by high-throughput sequencing of DF and SF granulosa cells in the first follicular wave of goat.【Method】Ten healthy Guizhou white goats were selected (1 year old), and the prostaglandin F2α were injected respectively for estrus synchronization. B-type ultrasonography was used to detect the follicle growth situation, and then all of the goats were slaughtered when estrus had appeared for three days. DF (4.5-6 mm in diameter) and SF (3-4.5 mm in diameter) were obtained, granulosa cells were separated in the first follicle wave, respectively. Total RNA were extracted, and libraries were constructed and sequenced by Illumina Hiseq 2500 platform. FastQC was used to evaluate the quality of raw reads sequenced and filter them to obtain clean reads with high quality. Trinity was used to assemble clean reads from scratch to obtain unigenes. mRNA was obtained by comparing unigenes with goat RefSeq database using CLC Genomics Workbench. DESeq2 software was used to analyze the differential expression of the obtained mRNA. The goseq and kobas software were used for GO analysis and KEGG signal pathway analysis. Finally, qRT-PCR was used to verify the selected key genes that might affect the follicle development. 【Result】After the raw reads which obtained by sequencing were filtered, 43 217 934 clean reads were obtained from DF granulosa cells, accounting for 95.19% of raw reads. 40 766 348 clean reads were obtained from SF granulosa cells, accounting for 95.35% of raw reads. When the unigenes were compared with the RefSeq database of goat, a total of 33 896 annotated transcripts were obtained. Setting FPKM>1 and q value<0.05, a total of 13 644 genes were obtained in two types of follicle granulosa cells. By setting parameters: FPKM≥1, SF-FPKM/DF-FPKM>1, P<0.05, 695 differentially expressed mRNAs were obtained, of which 233 were significantly up-regulated and 462 were down-regulated in SF granulosa cells. GO functional enrichment analysis was performed on 695 differentially expressed mRNAs and concentrated in 42 groups of three major categories: biological processes accounted for 47.6%, cellular components 47.6%, and molecular functions 4.8%. KEGG signaling pathway analysis revealed 20 pathways, among which ribosome pathway related genes were most significantly enriched. Six genes that might be closely related to follicle development in goats were screened out, among which PRLR, PTX3 and RGN were up-regulated in subordinate follicles granulosa cells. DKK3, ALDH1A2 and RARRES1 were down-regulated. qRT-PCR showed that the expression trend of PRLR, RGN, DKK3, ALDH1A2 and RARRES1 was consistent with high-throughput sequencing results, and the expression level of RGN in SF granulosa cells was significantly higher than that of dominant follicles (P<0.01). The expression levels of DKK3, ALDH1A2 and RARRES1 in dominant follicles granulosa cells were significantly higher than subordinate follicles (P<0.01).【Conclusion】DKK3, ALDH1A2, RARRES1 and RGN had extremely significant differences in the expression levels of dominant follicles and subordinate follicles. It was speculated that those genes might promote the predominance of follicles or lead to atresia during the follicle development of goat, which was of great significance to further explore the regulation mechanism of follicular development.

Key words: goat, high-throughput sequencing, follicle development, granulosa cells

Table 1

The list of gene primers of qRT-PCR"

基因名称
Gene name		 引物（5′→3′）
Primer sequences (5′→3′)		 产物大小
Size (bp)
PRLR F：ACCAGTTCCAGGGCCAAAAA
R：GCATCAGGTGTTGGTCCTCA		 173
PTX3 F：CTCTCTGGTCTGCAGTGTCG
R：TGAAGAGCTTGTCCCACTCG		 153
RGN F：GGGTCCCTGTACTCCCTCTT
R：TGCGGTTGGAGATCTTTCCC		 178
DKK3 F：GTGGCCTCTTCCCAGTACAC
R：GACCAGTTTAGCAGCCCTGT		 160
ALDH1A2 F：TGGAATCCCTCAATGGTGGC
R：AGCCCAGCCTGCATAATACC		 95
RARRES1 F：TAAAAGCCCCTTGAACGCAG
R：ACGTAAGAGCTGCCCAGAAA		 102
18S rRNA F：CCCACGGAATCGAGAAAGAG
R：TTGACGGAAGGGCACCA		 117

Fig. 1

Classification of raw reads in DF and SF granulosa cells"

Table 2

Top 20 highly expressed genes in SF and DF follicle granulosa cells"

基因名称Gene name SF-FPKM DF-FPKM
Eukaryotic Translation Elongation Factor 1 Alpha 1(EEF1A1) 7 110.13 8 928.81
Tumor Protein, Translationally-Controlled 1(TPT1) 3 655.98 4 714.90
TIMP Metallopeptidase Inhibitor 1(TIMP1) 3 412.45 859.27
Ribosomal Protein L37(RPL37) 3 144.41 3 930.05
Cytochrome C Oxidase Assembly Factor COX1(COX1) 2 528.75 1 340.44
Ribosomal Protein S14(RPS14) 2 440.53 2 907.19
Ribosomal Protein S18(RPS18) 2 304.26 2 709.49
Ribosomal Protein S11(RPS11) 2 132.58 2 437.76
Ribosomal Protein Lateral Stalk Subunit P0(RPLP0) 2 129.79 2 196.60
Ribosomal Protein L21(RPL21) 2 054.80 2 740.17
Ribosomal Protein S19(RPS19) 2 054.79 2 494.83
Ribosomal Protein L19(RPL19) 2 045.15 2 609.62
Ribosomal Protein S23(RPS23) 2 005.29 2 171.69
Oxytocin/Neurophysin I Prepropeptide (OXT) 1 907.67 559.09
Ribosomal Protein Lateral Stalk Subunit P2(RPLP2) 1 869.02 2 217.82
Ribosomal Protein S27a (RPS27A) 1 862.11 2 363.39
Ribosomal Protein S17(RPS17) 1 841.97 2 247.31
Receptor For Activated C Kinase 1(RACK1) 1 805.27 1 950.70
Ribosomal Protein L26(RPL26) 1 738.19 2 382.36
Ribosomal Protein S16(RPS16) 1 737.56 2 035.36

Fig. 2

Volcano plot of differentially expressed genes in DF and SF granulosa cells"

Fig. 3

GO analysis of differentially expressed genes in DF and SF granulosa cells 1: RNA processing; 2: RNA splicing; 3: nucleic acid metabolic process; 4: nucleobase-containing compound metabolic process; 5: ribonucleoprotein complex biogenesis; 6: cellular macromolecule metabolic process; 7: ribosome biogenesis; 8: heterocycle metabolic process; 9: cellular aromatic compound metabolic process; 10: cellular nitrogen compound metabolic process; 11: gene expression; 12: RNA metabolic process; 13: ribosomal small subunit biogenesis; 14: rRNA processing; 15: macromolecule metabolic process; 16: nitrogen compound metabolic process; 17: ncRNA processing; 18: ncRNA metabolic process; 19: organic cyclic compound metabolic process; 20: rRNA metabolic process; 21: nuclear lumen; 22: nuclear part; 23: nucleus; 24: intracellular organelle; 25: organelle; 26: membrane-enclosed lumen; 27: intracellular organelle lumen; 28: organelle lumen; 29: intracellular organelle part; 30: intracellular; 31: intracellular part; 32: organelle part; 33: intracellular membrane-bounded organelle; 34: membrane-bounded organelle; 35: nucleoplasm; 36: ribonucleoprotein complex; 37: cytosolic small ribosomal subunit; 38: cytosolic ribosome; 39: nucleoplasm part; 40: macromolecular complex; 41: RNA binding; 42: mRNA binding"

Fig. 4

Scatter plot of enriched KEGG pathway in DF and SF granulosa cells"

Table 3

Candidate genes may associate with follicular development of goat"

基因名
Gene name		 SF-FPKM DF-FPKM log2差异倍数
log2 fold change		 基因功能
Gene function
Prolactin receptor (PRLR) 37.46 4.11 3.19 刺激卵泡LH受体生成
Stimulate the production of LH receptors in the follicle
Pentraxin 3 (PTX3) 39.92 6.16 2.70 影响雌性动物生殖能力
Affecting females’ reproductive ability
Regucalcin (RGN) 49.39 8.13 2.60 调节Ca2+信号传导,以及Ca2+依赖的细胞过程和酶活性
Regulates Ca2+ signaling, and Ca2+ dependent cellular processes and enzyme activity
Dickkopf WNT Signaling Pathway Inhibitor 3 (DKK3) 15.92 74.57 -2.23 影响胚胎发育
Affect embryonic development
Aldehyde Dehydrogenase 1 Family Member A2 (ALDH1A2) 3.80 34.23 -3.17 建立局部胚胎视黄酸水平
Establishing local embryonic retinoic acid levels
Retinoic Acid Receptor Responder 1 (RARRES1) 110.41 527.73 -2.26 调节管状酪氨酸循环
Regulating tubular tyrosine cycle

Fig. 5

Relative expression of candidate genes in DF and SF granulosa cells of goat (** indicates P<0.01)"

[1] QUAN Q, ZHENG Q, LING Y H, FANG F G, CHU M X, ZHANG X R, LIU Y, LI W Y. Comparative analysis of differentially expressed genes between the ovaries from pregnant and nonpregnant goats using RNA-Seq. Journal of Biological Research Thessaloniki, 2019,26(3):1-12.
doi: 10.1186/s40709-019-0093-y
[2] RO S, SONG R, PARK C, ZHENG H, SANDERS K M, YAN W. Cloning and expression profiling of small RNAs expressed in the mouse ovary. RNA, 2007,13(12):2366-2380.
doi: 10.1261/rna.754207 pmid: 17951331
[3] LI P F, MENG J Z, ZHU Z W, FOLGER J K, LYU L H. Detection of genes associated with follicle development through transcriptome analysis of bovine ovarian follicles GCs. Current Bioinformatics, 2018,13:127-140.
doi: 10.2174/1574893612666170403165746
[4] BAO B, GARVERICK H A, SMITH G W, SMITH M F, SALFEN B E, YOUNGQUIST R S. Changes in messenger ribonucleic acid encoding luteinizing hormone receptor, cytochrome P450-side chain cleavage, and aromatase are associated with recruitment and selection of bovine ovarian follicles. Biology of Reproduction, 1997,56(5):1158-1168.
doi: 10.1095/biolreprod56.5.1158 pmid: 9160714
[5] REVERCHON M, CORNUAU M, RAMÉ C, GUERIF F, ROYÈRE D, DUPONT J. Resistin decreases insulin-like growth factor I-induced steroid production and insulin-like growth factor I receptor signaling in human granulosa cells. Fertility and Sterility, 2013,100(1):247-255.
doi: 10.1016/j.fertnstert.2013.03.008 pmid: 23548939
[6] KHARITONENKOV A, DIMARCHI R. Fibroblast growth factor 21 night watch: advances and uncertainties in the field. Journal of Internal Medicine, 2016,281(3):233-246.
doi: 10.1111/joim.12580 pmid: 27878865
[7] DE CASTRO T, RUBIANES E, MENCHACA A, RIVERO A. Ovarian dynamics, serum estradiol and progesterone concentrations during the interovulatory interval in goats. Theriogenology, 1999,52(3):399-411.
doi: 10.1016/S0093-691X(99)00138-7 pmid: 10734375
[8] LI J, LI Z, LIU S, ZIA R, LIANG A, YANG L. Transcriptome studies of granulosa cells at different stages of ovarian follicular development in buffalo. Animal Reproduction Science, 2017,187:181-192.
doi: 10.1016/j.anireprosci.2017.11.004 pmid: 29126830
[9] TERENINA E, FABRE S, BONNET A, MONNIAUX D, ROBERT- GRANIÉ C, SANCRISTOBAL M, TOSSER-KLOPP G. Differentially expressed genes and gene networks involved in pig ovarian follicular atresia. Physiological Genomics, 2017,49(2):67-80.
doi: 10.1152/physiolgenomics.00069.2016 pmid: 27940565
[10] HUSSEIN M R. Apoptosis in the ovary: Molecular mechanisms. Human Reproduction Update, 2005,11(2):162-178.
doi: 10.1093/humupd/dmi001 pmid: 15705959
[11] FOLGER J K, JIMENEZ-KRASSEL F, IRELAND J J, LV L L, SMITH G W. Regulation of granulosa cell cocaine and amphetamine regulated transcript (CART) binding and effect of CART signaling inhibitor on granulosa cell estradiol production during dominant follicle selection in cattle. Biology of Reproduction, 2013,137:1-8.
[12] BROMFIELD J J, IACOVIDES S M. Evaluating lipopolysaccharide- induced oxidative stress in bovine granulosa cells. Journal of Assisted Reproduction and Genetics, 2017,34(12):1619-1626.
doi: 10.1007/s10815-017-1031-2 pmid: 28866821
[13] HAN P, XIN H Y, PENG J X, ZHANG L, SONG Y X, LI G, CAO B Y, AN X P. Identification and expression of X-linked inhibitor of apoptosis protein during follicular development in goat ovary. Theriogenology, 2017,98:30-35.
doi: 10.1016/j.theriogenology.2017.04.048 pmid: 28601152
[14] LI P F, MENG J Z, LIU W Z, SMITH G W, YAO J B, LYU L H. Transcriptome analysis of bovine ovarian follicles at predeviation and onset of deviation stages of a follicular wave. International Journal of Genomics, 2016,2016:1-9.
[15] ZI X D, CHEN D W, WANG H M. Molecular characterization, mRNA expression of prolactin receptor ( PRLR) gene during pregnancy, nonpregnancy in the yak( Bos grunniens). General and Comparative Endocrinology, 2012,175(3):384-388.
[16] RUAN W, CATANESE V, WIECZOREK R, FELDMAN M, KLEINBERG D L. Estradiol enhances the stimulatory effect of insulin-like growth factor-I (IGF-I) on mammary development and growth hormone-induced IGF-I messenger ribonucleic acid. Endocrinology, 1995,136(3):1296-1302.
doi: 10.1210/endo.136.3.7867584 pmid: 7867584
[17] PERKS C M, NEWCOMB P V, GROHMANN M, WRIGHT R J, MASON H D, HOLLY J M. Prolactin acts as a potent survival factor against C2-ceramide-induced apoptosis in human granulosa cells. Human Reproduction, 2003,18(12):2672-2677.
pmid: 14645190
[18] TISSIER P R, HODSON D J, MARTIN A O, ROMANÒ N, MOLLARD P. Plasticity of the prolactin (PRL) axis: Mechanisms underlying regulation of output in female mice. Advances in Experimental Medicine & Biology, 2015,846:139-162.
doi: 10.1007/978-3-319-12114-7_6 pmid: 25472537
[19] LI S H, LIN M H, HWU Y M, LU C H, YEH L Y, CHEN Y J, LEE R K. Correlation of cumulus gene expression of GJA1, PRSS35, PTX3, and SERPINE2 with oocyte maturation, fertilization, and embryo development. Reproductive Biology Endocrinology, 2015,13(1):93.
doi: 10.1186/s12958-015-0091-3
[20] ZHANG X Q, JAFARI N, BARNES R B, CONFINO E, MILAD M, KAZER R R. Studies of gene expression in human cumulus cells indicate pentraxin 3 as a possible marker for oocyte quality. Fertillty and Sterility, 2005,83(4):1169-1179.
[21] GARLANDA C, BOTTAZZI B, BASTONE A, MANTOVANI A. Pentraxins at the crossroads between innate immunity, inflammation, matrix deposition, and female fertility. Annual Review of Immunology, 2005,23(1):337-366.
[22] HATZIRODOS N, IRVING-RODGERS H F, HUMMITZSCH K, HARLAND M L, MORRIS S E, RODGERS R J. Transcriptome profiling of granulosa cells of bovine ovarian follicles during growth from small to large antral sizes. BMC Genomics, 2014,15(1):24.
[23] VOORHAM Q J, JANSSEN J, TIJSSEN M, SNELLENBERG S, MONGERA S, GRIEKEN N C, GRABSCH H, KLIMENT M, REMBACKEN B J, MULDER C J, ENGELAND M V, MEIJER G A, STEENBERGEN R D, CARVALHO B. Promoter methylation of Wnt-antagonists in polypoid and nonpolypoid colorectal adenomas. BMC Cancer, 2013,13(1):603.
doi: 10.1186/1471-2407-13-603
[24] BHATTACHARYYA S, FEFERMAN L, TOBACMAN J K. Chondroitin sulfatases differentially regulate Wnt signaling in prostate stem cells through effects on SHP2, phospho-ERK1/2, and Dickkopf Wnt signaling pathway inhibitor (DKK3). Oncotarget, 2017,59(8):100242-100260.
[25] WANG X S, SPERKOVA Z, NAPOLI J L. Analysis of mouse retinal dehydrogenase type 2 promoter and expression. Genomics, 2001,74(2):245-250.
doi: 10.1006/geno.2001.6546 pmid: 11386761
[26] LI X H, KAKKAD B, ONG D E. Estrogen directly induces expression of retinoic acid biosynthetic enzymes, compartmentalized between the epithelium and underlying stromal cells in rat uterus. Endocrinology, 2004,145(10):4756-4762.
doi: 10.1210/en.2004-0514 pmid: 15205379
[27] KUMAR S, CUNNINGHAM T J, DUESTER G. Resolving molecular events in the regulation of meiosis in male and female germ cells. Science Signaling, 2013,6(288): pe25.
[28] KRENTZ A D, MURPHY M W, SARVER A L, GRISWOLD M D, BARDWELL V J, ZARKOWER D. DMRT1 promotes oogenesis by transcriptional activation of Stra8 in the mammalian fetal ovary. Developmental Biology, 2011,356(1):63-70.
doi: 10.1016/j.ydbio.2011.05.658 pmid: 21621532
[29] NAILLAT F, PRUNSKAITE-HYYRYLAINEN R, PIETILA I, SORMUNEN R, JOKELA T, SHAN J D, VAINIO S J. Wnt4/5a signalling coordinates cell adhesion and entry into meiosis during presumptive ovarian follicle development. Human Molecular Genetics, 2010,19(8):1539-1550.
doi: 10.1093/hmg/ddq027 pmid: 20106871
[30] BOWLES J, FENG C W, SPILLER C, DAVIDSON T L, JACKSON A, KOOPMAN P. FGF9 suppresses meiosis and promotes male germ cell fate in mice. Developmental Cell, 2010,19(3):440-449.
doi: 10.1016/j.devcel.2010.08.010 pmid: 20833365
[1] YUE XiaoYu, ZHAO ShiChen, WANG Qin. The miR-362-3p Regulates the Proliferation and Steroid Hormone Synthesis of Mare Follicular Granulosa Cells by Targeting BMPR2 [J]. Scientia Agricultura Sinica, 2026, 59(7): 1564-1575.
[2] CHEN YaRu, WANG Lei, FU Ming, HUANG Tao, ZHANG Hao, LIANG ZhenHua, PI JinSong, WU Yan. Molecular Mechanism of USP18 Facilitating Ferroptosis by Suppressing GPX4 Ubiquitination and Degradation in Duck Granulosa Cells [J]. Scientia Agricultura Sinica, 2026, 59(5): 1128-1140.
[3] JIA ZiCheng, QIN BingYu, MA CaiYing, DU Yong, LIU TongGao, XUE RuiLin, WANG XiaoLong, ZHOU ShiWei. Effects of Diets with Different Nutritional Levels on Maternal-Infant Integrated Production Performance and Rumen Microorganisms of Double-Lamb Shanbei White Cashmere Goats [J]. Scientia Agricultura Sinica, 2026, 59(3): 668-686.
[4] WANG Niu, SHI XinRan, ZHANG WeiDong, WANG Xin. Effect of FGF5 and FGF21 on Proliferation of Dermal Papilla Cells in Cashmere Goat [J]. Scientia Agricultura Sinica, 2025, 58(4): 819-830.
[5] XU YuanYuan, HUANG LiQing, LU XingRong, FENG Chao, SHANG JiangHua. Effects of β-mercaptoethanol on Rapamycin Induced Autophagy, Apoptosis and Steroid Hormone Synthesis in Buffalo Granulosa Cells [J]. Scientia Agricultura Sinica, 2025, 58(11): 2265-2274.
[6] ZHANG HuaPeng, ZHANG QingZe, HE Fan, QI MengFan, FU BinBin, LI QingChun, LI MengXun, MA LiPeng, LIU Yi, HUANG Tao. Cloning and Identification of Differentially Expressed lncRNAs in Follicles of Meishan Pigs and Duroc Pigs with Their Correlation Analysis with miRNAs [J]. Scientia Agricultura Sinica, 2024, 57(9): 1807-1819.
[7] MENG ZhaoYi, WANG YunLu, YAO YiLong, XI GuangYin, NIU JiaQiang, SOLANGSIZHU, GUO Min, XU YeFen. lncRNA-MSTRG.7889.1 Competitively Binds to bta-miR-146a Targeting Smad4 to Regulate Apoptosis of Yak Granulosa Cells [J]. Scientia Agricultura Sinica, 2024, 57(4): 797-809.
[8] ZHOU XinYan, CHEN SiYu, WEI YuFei, ZHU Yu, FENG JunQian, DING DianCao, LU GuiFeng, YANG ShangDong. Characteristics of Endophytic Microbial Community Structures in Stems Between Hylocereus undatus and H. polyrhizus [J]. Scientia Agricultura Sinica, 2024, 57(2): 416-428.
[9] HE JunMin, MAO JingYi, WEI Chen, REN YiFan, ZHANG GuoPing, TIAN KeChuan, LIU GuiFen. Analyzing the Molecular Mechanism of Hair Follicle Development in Subo Merino Based on miRNA Sequencing Data [J]. Scientia Agricultura Sinica, 2024, 57(19): 3917-3935.
[10] CHEN HengGuang, PEI XiaoMeng, XIA YuTing, LIU Jing, MAO DaGan. Effects of Adding Curcumin to Perinatal Diets on Production Performance, Blood Indexes and Gene Expression of Inflammatory Factors in Goats [J]. Scientia Agricultura Sinica, 2024, 57(12): 2483-2496.
[11] WANG Peng, LIU ZiYi, LIU YuFang, CHU MingXing. miR-535 Targets the GAB2 Gene to Promote Goat Granulosa Cell Proliferation Through Activation of the PI3K/AKT Signaling Pathway [J]. Scientia Agricultura Sinica, 2023, 56(23): 4757-4771.
[12] GUO ZeYuan, DU ZhangSheng, ZHANG YaQi, CHEN ChunLu, MA XiaoYan, CHENG Ying, WANG Kai, LÜ LiHua. Effects of Smad7-Mediated TGF-β Signaling Pathway on Proliferation of Sheep Granulosa Cells [J]. Scientia Agricultura Sinica, 2023, 56(13): 2597-2608.
[13] LI Qi, YANG ChangHeng, WANG Yong, LIN YaQiu, XIANG Hua, ZHU JiangJiang. Role of FATP1 in Promoting Lipid Deposition in Goat Intramuscular Adipocytes [J]. Scientia Agricultura Sinica, 2023, 56(10): 2007-2020.
[14] LIU YuFang,CHEN YuLin,ZHOU ZuYang,CHU MingXing. miR-221-3p Regulates Ovarian Granulosa Cells Apoptosis by Targeting BCL2L11 in Small-Tail Han Sheep [J]. Scientia Agricultura Sinica, 2022, 55(9): 1868-1876.
[15] WU Yan,ZHANG Hao,LIANG ZhenHua,PAN AiLuan,SHEN Jie,PU YueJin,HUANG Tao,PI JinSong,DU JinPing. circ-13267 Regulates Egg Duck Granulosa Cells Apoptosis Through Let-7-19/ERBB4 Pathway [J]. Scientia Agricultura Sinica, 2022, 55(8): 1657-1666.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
京ICP备09089781号-30
Copyright 2018 © Editorial office of Scientia Agricultura Sinica
Tel: 86-010-82106279    E-mail: zgnykx@mail.caas.net.cn
Supported by Beijing Magtech Co.Ltd