Scientia Agricultura Sinica ›› 2024, Vol. 57 ›› Issue (3): 429-441.doi: 10.3864/j.issn.0578-1752.2024.03.001

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

Identification and Candidate Gene Analysis of the ABNORMAL HULL 1 (ah1) Mutant in Rice (Oryza sativa L.)

ZHANG BiDong1,2(), LIN Hong1, ZHU SiYing1, LI ZhongCheng1, ZHUANG Hui1, LI YunFeng1()   

  1. 1 Rice Research Institute, Southwest University/Academy of Agricultural Sciences, Southwest University/Chongqing Key Laboratory of Application and Safety Control of Genetically Modified Crops, Chongqing 400715
    2 Institute of Innovation and Entrepreneurship, Southwest University/Hanhong College, Chongqing 400715
  • Received:2023-07-05 Accepted:2023-08-28 Online:2024-02-01 Published:2024-02-05

Abstract:

【Objective】Rice is the staple grain crop worldwide, and the morphology of its grains directly influences its ultimate yield, nutritional excellence, and economic significance. Moreover, the intricate interplay between floral development and grain morphology adds further significance to this relationship. Thus, exploring novel rice floral development regulatory genes and molecular regulatory mechanisms lays the foundation for larger and more plump grains rice varieties. 【Method】Ethyl methyl sulfonate (EMS) was used to mutate XD1B (xian-type maintainer line), and a dwarf mutant abnormal hull 1 (ah1) with abnormal formation of glume and lodicule was identified. The agronomic traits of both the wild-type and mutant were observed and recorded. Spikelets from various flowering stage were collected to histological and morphological analysis. The F2 segregating population was established by ah1 and 56S (xian-type thermo-sensitive sterility line), and utlized for genetic analysis and gene mapping. RNA was isolated from young panicles of both the wild-type and mutant, then reverse transcribed into cDNA. The RT-qPCR analysis was performed to analyze the relative expression levels of the genes regulating floral development and the key genes in the ABA synthesis pathway. 【Result】The observation of agronomic traits revealed that the dwarfed plant was caused by the dramatic shortening of the internodes. At the same time, the mutant is also accompanied by severe spikelet abnormalities and low fruit setting rate. Histological and morphological analysis revealed that the ah1 mutant spikelets exhibited varying degrees of degeneration in floral organs such as palea, lemma, lodicules, and stamens. Some severely affected spikelets displayed altered floral organ characteristics and determinacy of floral meristems, often accompanied by extensive whitening. Based on the extent of degeneration, these spikelets could be classified as slight or severe mutant phenotypes. Genetic analysis showed a segregation ratio of 3﹕1 for the wild-type and mutant within the segregating population, indicating that the mutant traits of ah1 were controlled by a single recessive locus. The AH1 was mapped between the molecular markers RM6716 and RM128 on the chromosome 1, with a physical distance of approximately 8 Mb. Resequencing analysis of the mutant revealed that the LOC_Os01g53450 and LOC_Os01g51860 within this interval showed variation between wild-type and mutant, thus these two genes were provisionally identified as candidate genes. RT-qPCR analysis revealed significant alterations in the relative expression levels of floral organ development regulatory genes during the early developmental stages of mutant panicles; meanwhile, the relative expression levels of OsNCED1/OsNCED2/ OsNCED3/OsNCED4/OsNCED5, the ABA synthesis pathway key genes, were severe inhibited.【Conclusion】AH1 plays a crucial role in the morphological formation of floral organs, such as palea and lemma in rice. LOC_Os01g53450 and LOC_Os01g51860 were provisionally identified as candidate genes in this work.

Key words: rice (Oryza sativa L.), glume, floral development, candidate genes

Table 1

Primer sequences"

引物
Primer
正向序列
Forward sequence (5′-3′)
反向序列
Reverse sequence (5′-3′)
用途
Purpose
RM6716 CCTATGCGATCTCCTATTTGG CGAGTCAGACACGTACTACTGC 定位
Mapping
RM128 TGATTTCTTGGAAGCGAAGAGTGAGG CCTCCTTGTGCTCAGCCATGC
RM1268 GCTGTCACTGACCGAGCGTAGG TCGAGAGATCCAATCCAGTTTGC
ACTIN GACCCAGATCATGTTTGAGACCT CAGTGTGGCTGACACCATCAC RT-qPCR
OsMADS14 CTCATCATCCTCCTTCAT GCTACATCCTCTATCCTT
OsMADS15 GCTGAATCCGAGAGTGAG TGAGGTGTTTGTGACATTTG
OsMADS18 GGTGATGAATATGGAATT CTTATATGCTTCAGAGAAT
OsMADS2 ATGATTGAGGAGGCACTT TCGTCTTCCAGCATCTTAT
OsMADS4 CCAATCTGCGGGACAAGA AGCCAAATTGGCAGTGCTC
OsMADS16 TTCGCCACAGGAAGTATCA CCTCGTAGGAGTGCTTCA
OsMADS3 CGATCATATGGTTAATAACCCA AGACGAGTTGCCAAAGTTCGA
OsMADS58 ATATCACCACCATGAACCA TTCTTCCGTGCTCTAATCT
OsMADS13 AGAGCCAGGAAGAATGAA ATGTTGTCGTTCTGAAGC
OsMADS1 GCTGCAACTACAACTCACAGG TGATGGTGAGCATGAGGGTG
OsMADS5 ACTGAACTAAGCAATTACCAAGA CAAGTCCTCGCCAAGAAG
OsMADS7 ATCTTGATTCATTAGGCATAA TTGTCCTTGTAGTTCTGA
OsMADS8 GCACATTAGATCCACAAG TTCTTCTGAGGCACTTAT
OsMADS34 AGGAATATGTGAACTTGAA TTCTGACTACTTGACTCT
DL CCCATCTGCTTACAACCGCTT GTTGGAGGTGGAAACCGTCG
OsMADS6 TGATGATGGAACAAGTGGAG TTGTGCTTGAGTTGCCTAT
OsMADS32 GGAGTTTGTCGAGAGGTACGA CTGAACGTCAAGCGTCCATC
SL1 AAGCATCCAGGGTTACTAA GCAGAACCTACACTCGTA
FON1 TGCGTGAAGGAGGACAACATCATC AGCAGCAGGTTCGTCTCCCTGTT
OsNCED1 AAGCAGACCGAGCAAGAG ATTCGTCGTAGCAATAACAGTTC
OsNCED2 AGCCAATGTTATGACTCT TCTGTAGATTACGGTGAG
OsNCED3 AGGATATGCTCACATACAG AGAATCTCACCGAATTGG
OsNCED4 ACGATGATCCACGACTTC ATCTCCTGGAGCTTGAAC
OsNCED5 ATCAAGAAGCCATACCTGAA CTGCTCAAGCTCGATCTC
LOC_Os01g51860 TGAAGGAATCTGCTGAAGT AGTATCTGAGGACCACAATT
LOC_Os01g53450 ACGGAATGGCACAGTGGGAC GGTCCCATGCCGTACTCTTGAG

Fig. 1

Phenotype analysis of spikelets in wild-type (WT) and ah1 mutant A1: WT spikelet; A2: WT spikelet from which the palea and lemma have been removed; A3: WT floral primordium in stag Sp6; A4: WT floral primordium in stag Sp8; A5: Transverse section of WT spikelet; B1: Spikelet of ah1 with slight mutant phenotype; B2: Spikelet of ah1 in B1 from which the palea and lemma have been removed; B3: Floral primordium of ah1(with slight mutant phenotype) in stag Sp6; B4: Floral primordium of ah1(with slight mutant phenotype) in stag Sp8 ; B5: Transverse section of spikelet of ah1 with slight mutant phenotype; C1: Spikelet of ah1 with severe mutant phenotype; C2: Spikelet of ah1 in C1 from which the palea and lemma have been removed; C3: Floral primordium of ah1(with severe mutant phenotype)in stag Sp6; C4: Floral primordium of ah1(with severe mutant phenotype) in stag Sp8; C5: Transverse section of spikelet of ah1 with severe mutant phenotype; D1 and D2: Spikelets of ah1 with elongated palea, degraded lemma, and abnormal lodicule (Type Ⅰ); D3: The degraded palea, the detail of red frame in D2; D4: Abnormal development of lodicule of spikelet in D2; D5: Transverse section of vestigial palea of spikelet in D1; D6: Transverse section of the abormal lodicule of the spikelet in D1; E1 and E2: Spikelets of ah1 with pistilloid-stamens, degraded palea and lemma, and elongated lodicule (Type Ⅱ); E3: The vestigial lemma, the detail of red frame in E2; E4: The elongated lodicule of spikelets in E2; E5: Double-flowered spikelet of ah1 (Type Ⅲ). Abbreviation: le: Lemma; pa: Palea; lo: Lodicule; st: Stamen; pi: Pistil; sl: Sterile lemma; rg: Rudimentary glume; mrp: Marginal region of palea; dl: Degraded lemma; ele: Elongated lemma; alo: Abnormal lodicule; elo: Elongated lodicule; ex-floret: Extra floret; *: Stamen. Bars: 5 000 µm in A1, and A2; 1 000 µm in B1, B2, C1, C2, D1, E1, and E5; 500 µm in A4, A5, B4, B5, C4, C5, D4, D5, and D6; 2 000 µm in D2, and E2; 100 µm in A3, B3, C3, D3, E3, and E4"

Fig. 2

Plant characters and agronomic traits of the wild-type (WT) and ah1 mutant A: The plants of wild-type and mutant at maturity stage; B and C: The spikes of wild-type and mutant (Ⅰ, Ⅱ, Ⅲ and Ⅳ indicate the corresponding internodes length, respectively), Bars: 5 cm; D: The statistics of plant height; E: The statistics of internodes length; F: The statistics of seed-setting; G: The statistics of 1000-grain weight. **: Extremely significant difference at P<0.01 by t-test. The same as below"

Table 2

Test of Chi-square on segregation rate of F2 population between wild-type (WT) and ah1 mutant"

父本
Male parent
母本
Female parent
野生型
Wild-type
突变型
Mutant type
卡方值
Chi-square value (χ20.05,1=3.84)
ah1 56S 303 97 0.083

Fig. 3

Gene mapping and relative expression levels of AH1 candidate genes A: Primary mapping and identification of AH1 on chromosome 1; B, C: The relative expression of LOC_Os01g53450 and LOC_Os01g51860 in young spikes less than 3 mm; D, E: The relative expression of LOC_Os01g53450 and LOC_Os01g51860 in young spikes less than 1 cm; F: The ABA content in wild-type and mutant"

Table 3

Mutant genes"

序号
Number
基因名称
Gene name
注释
Annotation
位置
Position (Mb)
1 LOC_Os01g51860 紫黄素脱环氧化酶,推测,表达
Violaxanthin de-epoxidase, putative, expressed
28.44
2 LOC_Os01g53450 转氨酶,Ⅰ类和Ⅱ类,结构域蛋白,表达
Aminotransferase, classesⅠandⅡ, domain containing protein, expressed
29.29

Fig. 4

The relative expression levels of floral organ regulatory genes and ABA synthesis genes in wild-type and ah1 mutant A: The relative expression of floral organ regulatory genes and ABA synthesis genes in young spikes less than 3 mm (OsNCED2/OsNCED3 hardly expressed, data not shown); B: The relative expression of floral organ regulatory genes and ABA synthesis genes in young spikes less than 1 cm (OsMADS18 and OsNCED2/OsNCED3 hardly expressed, data not shown). *: Significant difference at P<0.05 by t-test"

[1]
COEN E S, MEYEROWITZ E M. The war of the whorls: Genetic interactions controlling flower development. Nature, 1991, 353(6339): 31-37.

doi: 10.1038/353031a0
[2]
KYOZUKA J, SHIMAMOTO K. Ectopic expression of OsMADS3, a rice ortholog of AGAMOUS, caused a homeotic transformation of lodicules to stamens in transgenic rice plants. Plant and Cell Physiology, 2002, 43(1): 130-135.

doi: 10.1093/pcp/pcf010
[3]
LOHMANN J U, WEIGEL D. Building beauty: The genetic control of floral patterning. Developmental Cell, 2002, 2(2): 135-142.

pmid: 11832239
[4]
THEISSEN G, MELZER R. Molecular mechanisms underlying origin and diversification of the angiosperm flower. Annals of Botany, 2007, 100(3): 603-619.

doi: 10.1093/aob/mcm143 pmid: 17670752
[5]
SOLTIS D E, CHANDERBALI A S, KIM S, BUZGO M, SOLTIS P S. The ABC model and its applicability to basal angiosperms. Annals of Botany, 2007, 100(2): 155-163.

pmid: 17616563
[6]
IRISH V F. The evolution of floral homeotic gene function. BioEssays, 2003, 25(7): 637-646.

pmid: 12815719
[7]
PELUCCHI N, FORNARA F, FAVALLI C, MASIERO S, LAGO C, E M, COLOMBO L, KATER M M. Comparative analysis of rice MADS-box genes expressed during flower development. Sexual Plant Reproduction, 2002, 15(3): 113-122.

doi: 10.1007/s00497-002-0151-7
[8]
WANG K J, TANG D, HONG L L, XU W Y, HUANG J, LI M, GU M H, XUE Y B, CHENG Z K. DEP and AFO regulate reproductive habit in rice. PLoS Genetics, 2010, 6(1): e1000818.

doi: 10.1371/journal.pgen.1000818
[9]
FORNARA F, PARENICOVÁ L, FALASCA G, PELUCCHI N, MASIERO S, CIANNAMEA S, LOPEZ-DEE Z, ALTAMURA M M, COLOMBO L, KATER M M. Functional characterization of OsMADS18, a member of the AP1/SQUA subfamily of MADS box genes. Plant Physiology, 2004, 135(4): 2207-2219.

doi: 10.1104/pp.104.045039
[10]
KOBAYASHI K, YASUNO N, SATO Y, YODA M, YAMAZAKI R, KIMIZU M, YOSHIDA H, NAGAMURA Y, KYOZUKA J. Inflorescence meristem identity in rice is specified by overlapping functions of three AP1/FUL-like MADS box genes and PAP2, a SEPALLATA MADS box gene. The Plant Cell, 2012, 24(5): 1848-1859.

doi: 10.1105/tpc.112.097105
[11]
NAGASAWA N, MIYOSHI M, SANO Y, SATOH H, HIRANO H, SAKAI H, NAGATO Y. SUPERWOMAN1 and DROOPING LEAF genes control floral organ identity in rice. Development, 2003, 130(4): 705-718.

doi: 10.1242/dev.00294
[12]
XIAO H, WANG Y, LIU D F, WANG W, LI X B, ZHAO X F, XU J C, ZHAI W X, ZHU L H. Functional analysis of the rice AP3 homologue OsMADS16 by RNA interference. Plant Molecular Biology, 2003, 52(5): 957-966.

doi: 10.1023/A:1025401611354
[13]
LEE S, JEON J S, AN K, MOON Y H, LEE S, CHUNG Y Y, AN G. Alteration of floral organ identity in rice through ectopic expression of OsMADS16. Planta, 2003, 217(6): 904-911.

doi: 10.1007/s00425-003-1066-8
[14]
YADAV S R, PRASAD K, VIJAYRAGHAVAN U. Divergent regulatory OsMADS2 functions control size, shape and differentiation of the highly derived rice floret second-whorl organ. Genetics, 2007, 176(1): 283-294.

doi: 10.1534/genetics.107.071746
[15]
YAO S G, OHMORI S, KIMIZU M, YOSHIDA H. Unequal genetic redundancy of rice PISTILLATA orthologs, OsMADS2 and OsMADS4, in lodicule and stamen development. Plant and Cell Physiology, 2008, 49(5): 853-857.

doi: 10.1093/pcp/pcn050
[16]
PRASAD K, VIJAYRAGHAVAN U. Double-stranded RNA interference of a rice PI/GLO paralog, OsMADS2, uncovers its second-whorl- specific function in floral organ patterning. Genetics, 2003, 165(4): 2301-2305.

doi: 10.1093/genetics/165.4.2301
[17]
KANG H G, JEON J S, LEE S, AN G. Identification of class B and class C floral organ identity genes from rice plants. Plant Molecular Biology, 1998, 38(6): 1021-1029.

doi: 10.1023/a:1006051911291 pmid: 9869408
[18]
YAMAGUCHI T, LEE D Y, MIYAO A, HIROCHIKA H, AN G, HIRANO H Y. Functional diversification of the two C-class MADS box genes OSMADS3 and OSMADS58 in Oryza sativa. The Plant Cell, 2006, 18(1): 15-28.

doi: 10.1105/tpc.105.037200
[19]
DRENI L, PILATONE A, YUN D P, ERRENI S, PAJORO A, CAPORALI E, ZHANG D B, KATER M M. Functional analysis of all AGAMOUS subfamily members in rice reveals their roles in reproductive organ identity determination and meristem determinacy. The Plant Cell, 2011, 23(8): 2850-2863.

doi: 10.1105/tpc.111.087007 pmid: 21810995
[20]
YUN D P, LIANG W Q, DRENI L, YIN C S, ZHOU Z G, KATER M M, ZHANG D B. OsMADS16 genetically interacts with OsMADS3and OsMADS58 in specifying floral patterning in rice. Molecular Plant, 2013, 6(3): 743-756.

doi: 10.1093/mp/sst003
[21]
YAMAGUCHI T, NAGASAWA N, KAWASAKI S, MATSUOKA M, NAGATO Y, HIRANO H Y. The YABBY gene DROOPING LEAF regulates carpel specification and midrib development in Oryza sativa. The Plant Cell, 2004, 16(2): 500-509.

doi: 10.1105/tpc.018044
[22]
DRENI L, JACCHIA S, FORNARA F, FORNARI M, OUWERKERK P B F, AN G, COLOMBO L, KATER M M. The D-lineage MADS- box gene OsMADS13 controls ovule identity in rice. The Plant Journal, 2007, 52(4): 690-699.

doi: 10.1111/tpj.2007.52.issue-4
[23]
ANGENENT G C, FRANKEN J, BUSSCHER M, VAN DIJKEN A, VAN WENT J L, DONS H J, VAN TUNEN A J. A novel class of MADS box genes is involved in ovule development in petunia. The Plant Cell, 1995, 7(10): 1569-1582.
[24]
ROUNSLEY S D, DITTA G S, YANOFSKY M F. Diverse roles for MADS box genes in Arabidopsis development. The Plant Cell, 1995, 7(8): 1259-1269.
[25]
PRASAD K, PARAMESWARAN S, VIJAYRAGHAVAN U. OsMADS1, a rice MADS-box factor, controls differentiation of specific cell types in the lemma and palea and is an early-acting regulator of inner floral organs. The Plant Journal, 2005, 43(6): 915-928.

doi: 10.1111/tpj.2005.43.issue-6
[26]
JEON J S, JANG S, LEE S, NAM J, KIM C, LEE S H, CHUNG Y Y, KIM S R, LEE Y H, CHO Y G, AN G. leafy hull sterile1 is a homeotic mutation in a rice MADS box gene affecting rice flower development. The Plant Cell, 2000, 12(6): 871-884.
[27]
CHEN Z X, WU J G, DING W N, CHEN H M, WU P, SHI C H. Morphogenesis and molecular basis on naked seed rice, a novel homeotic mutation of OsMADS1 regulating transcript level of AP3 homologue in rice. Planta, 2006, 223(5): 882-890.

doi: 10.1007/s00425-005-0141-8
[28]
AGRAWAL G K, ABE K, YAMAZAKI M, MIYAO A, HIROCHIKA H. Conservation of the E-function for floral organ identity in rice revealed by the analysis of tissue culture-induced loss-of-function mutants of the OsMADS1 gene. Plant Molecular Biology, 2005, 59(1): 125-135.

doi: 10.1007/s11103-005-2161-y
[29]
KANG H G, AN G. Isolation and characterization of a rice MADS box gene belonging to the AGL2 gene family. Molecules and Cells, 1997, 7(1): 45-51.

doi: 10.1016/S1016-8478(23)13260-2
[30]
CUI R F, HAN J K, ZHAO S Z, SU K M, WU F, DU X Q, XU Q J, CHONG K, THEISSEN G, MENG Z. Functional conservation and diversification of class E floral homeotic genes in rice (Oryza sativa). The Plant Journal, 2010, 61(5): 767-781.

doi: 10.1111/j.1365-313X.2009.04101.x pmid: 20003164
[31]
GAO X C, LIANG W Q, YIN C S, JI S M, WANG H M, SU X, GUO C C, KONG H Z, XUE H W, ZHANG D B. The SEPALLATA-like gene OsMADS34 is required for rice inflorescence and spikelet development. Plant Physiology, 2010, 153(2): 728-740.

doi: 10.1104/pp.110.156711
[32]
DUAN Y L, XING Z, DIAO Z J, XU W Y, LI S P, DU X Q, WU G H, WANG C L, LAN T, MENG Z, LIU H Q, WANG F, WU W R, XUE Y B. Characterization of Osmads6-5, a null allele, reveals that OsMADS6 is a critical regulator for early flower development in rice (Oryza sativa L.). Plant Molecular Biology, 2012, 80(4/5): 429-442.

doi: 10.1007/s11103-012-9958-2
[33]
OHMORI S, KIMIZU M, SUGITA M, MIYAO A, HIROCHIKA H, UCHIDA E, NAGATO Y, YOSHIDA H. MOSAIC FLORAL ORGANS1, an AGL6-like MADS box gene, regulates floral organ identity and meristem fate in rice. The Plant Cell, 2009, 21(10): 3008-3025.

doi: 10.1105/tpc.109.068742
[34]
SANG X C, LI Y F, LUO Z K, REN D Y, FANG L K, WANG N, ZHAO F M, LING Y H, YANG Z L, LIU Y S, HE G H. CHIMERIC FLORAL ORGANS1, encoding a monocot-specific MADS box protein, regulates floral organ identity in rice. Plant Physiology, 2012, 160(2): 788-807.

doi: 10.1104/pp.112.200980 pmid: 22891238
[35]
IKEDA K, NAGASAWA N, NAGATO Y. ABERRANT PANICLE ORGANIZATION 1 temporally regulates meristem identity in rice. Developmental Biology, 2005, 282(2): 349-360.

doi: 10.1016/j.ydbio.2005.03.016
[36]
XIAO H, TANG J F, LI Y F, WANG W M, LI X B, JIN L, XIE R, LUO H F, ZHAO X F, MENG Z, HE G H, ZHU L H. STAMENLESS 1, encoding a single C2H2 zinc finger protein, regulates floral organ identity in rice. The Plant Journal, 2009, 59(5): 789-801.

doi: 10.1111/j.1365-313X.2009.03913.x pmid: 19453444
[37]
HUANG H, MA H. FON1, an Arabidopsis gene that terminates floral meristem activity and controls flower organ number. The Plant Cell, 1997, 9(2): 115-134.
[38]
GUAN C F, JI J, ZHANG X Q, LI X Z, JIN C, GUAN W Z, WANG G. Positive feedback regulation of a Lycium chinense-derived VDE gene by drought-induced endogenous ABA, and over-expression of this VDE gene improve drought-induced photo-damage in Arabidopsis. Journal of Plant Physiology, 2015, 175: 26-36.

doi: 10.1016/j.jplph.2014.06.022
[39]
MOON S, JUNG K H, LEE D E, LEE D Y, LEE J, AN K, KANG H G, AN G. The rice FON1 gene controls vegetative and reproductive development by regulating shoot apical meristem size. Molecules and Cells, 2006, 21(1): 147-152.

pmid: 16511358
[40]
WANG X C, REN P X, JI L X, ZHU B H, XIE G S. OsVDE, a xanthophyll cycle key enzyme, mediates abscisic acid biosynthesis and negatively regulates salinity tolerance in rice. Planta, 2021, 255(1): 6.

doi: 10.1007/s00425-021-03802-1 pmid: 34842977
[41]
HAHN H G, CHOI J S, LIM H K, LEE K I, HWANG I T. Triazolyl phenyl disulfides: 8-Amino-7-oxononanoate synthase inhibitors as potential herbicides. Pesticide Biochemistry Physiology, 2015, 125: 78-83.

doi: 10.1016/j.pestbp.2015.05.006
[42]
PINON V, RAVANEL S, DOUCE R, ALBAN C. Biotin synthesis in plants. The first committed step of the pathway is catalyzed by a cytosolic 7-keto-8-aminopelargonic acid synthase. Plant Physiology, 2005, 139(4): 1666-1676.

pmid: 16299174
[43]
LI J, BRADER G, HELENIUS E, KARIOLA T, PALVA E T. Biotin deficiency causes spontaneous cell death and activation of defense signaling. The Plant Journal, 2012, 70(2): 315-326.

doi: 10.1111/j.1365-313X.2011.04871.x pmid: 22126457
[1] YE MeJin, WU Lei, MD NAHIBUZZAMAN Lohani, YIN Li, HU XinRong, LIU YaXi, JIANG YunFeng, CHEN GuoYue, PU ZhiEn, LI Yang, LI Ting, ZOU YaYa, WU JiaYi, MA Jian. Genome-Wide Association Study-Based Identification of Loci Controlling Mature Embryo Size in Chinese Wheat Landraces and Their Genetic Effects Analysis [J]. Scientia Agricultura Sinica, 2026, 59(6): 1157-1171.
[2] WANG YongSheng, NIU Li, WANG ChangJie, MA LiHua, LIAN XiaoXiao, MENG YaXiong, MA XiaoLe, YAO LiRong, ZHANG Hong, YANG Ke, LI BaoChun, WANG HuaJun, SI ErJing, WANG JunCheng. Genome-Wide Association Study and Candidate Gene Identification for Thousand Grain Weight in Winter Wheat [J]. Scientia Agricultura Sinica, 2026, 59(3): 499-514.
[3] LI YunLi, DIAO DengChao, LIU YaRui, SUN YuChen, MENG XiangYu, WU ChenFang, WANG Yu, WU JianHui, LI ChunLian, ZENG QingDong, HAN DeJun, ZHENG WeiJun. Genome-Wide Association Study of Heat Tolerance at Seedling Stage in A Wheat Natural Population [J]. Scientia Agricultura Sinica, 2025, 58(9): 1663-1683.
[4] ZHUANG LiHua, LUO Lei, ZHAO ChunFang, WANG JiZhong, ZHANG YaDong, HE Lei. Identification and Gene Mapping of Rice Grain Shape Mutant sgd13 [J]. Scientia Agricultura Sinica, 2025, 58(24): 5097-5109.
[5] ZENG YueHui, ZOU WenGuang, ZHAO FuMing, XIAO ChangChun, HUANG JianHong, MA BinLin, YANG WangXing, WEI XinYu, XU XuMing. Map-Based Cloning and Functional Verification of A Novel Split Glume Gene OsSG2 in Rice (Oryza sativa L.) [J]. Scientia Agricultura Sinica, 2025, 58(11): 2062-2080.
[6] ZHANG Ying, SHI TingRui, CAO Rui, PAN WenQiu, SONG WeiNing, WANG Li, NIE XiaoJun. Genome-Wide Association Study of Drought Tolerance at Seedling Stage in ICARDA-Introduced Wheat [J]. Scientia Agricultura Sinica, 2024, 57(9): 1658-1673.
[7] XU Na, TANG Ying, XU ZhengJin, SUN Jian, XU Quan. Genetic Analysis and Candidate Gene Identification on Fertility and Inheritance of Hybrid Sterility of XI and GJ Cross [J]. Scientia Agricultura Sinica, 2024, 57(8): 1417-1429.
[8] HAN XuDong, YANG ChuanQi, ZHANG Qing, LI YaWei, YANG XiaXia, HE JiaTian, XUE JiQuan, ZHANG XingHua, XU ShuTu, LIU JianChao. QTL Mapping and Candidate Gene Screening for Nitrogen Use Efficiency in Maize [J]. Scientia Agricultura Sinica, 2024, 57(21): 4175-4191.
[9] LIU DeLong, LI ShiRu, WANG ChuanXing, GUO ShuQing, MA ZhiXiu, WU YongJiang, HAN HuiBing, LI YuJie, ZHANG PanPan, YANG Pu. Phenotypical Variation and Dynamic QTL Mapping of Plant Height in Foxtail Millet at Different Developmental Stages [J]. Scientia Agricultura Sinica, 2024, 57(18): 3533-3550.
[10] SHANG Hang, CHENG YuKun, REN Yi, GENG HongWei. Genome-Wide Association Analysis of Starch Gelatinization Traits in Winter Wheat [J]. Scientia Agricultura Sinica, 2024, 57(18): 3507-3521.
[11] BAI BingNan, QIAO Dan, GE Qun, LUAN YuJuan, LIU XiaoFang, LU QuanWei, NIU Hao, GONG JuWu, GONG WanKui, ELAMEER ELSAMMAN, YAN HaoLiang, LI JunWen, LIU AiYing, SHI YuZhen, WANG HaiZe, YUAN YouLu. QTN Mining and Candidate Gene Screening of Upland Cotton (Gossypium hirsutum L.) Seed-Related Traits [J]. Scientia Agricultura Sinica, 2024, 57(15): 2901-2913.
[12] YAN LiuHui, ZHONG Qi, MA ZengFeng, WEI MinYi, LIU Chi, QIN YuanYuan, ZHOU XiaoLong, HUANG DaHui, LU YingPing, QIN Gang, ZHANG YueXiong. Identification and Evolutionary Analysis of the Early Heading Gene OsEHD8 in Common Wild Rice (Oryza rufipogon Giff.) [J]. Scientia Agricultura Sinica, 2024, 57(14): 2703-2716.
[13] ZHANG YuMei, DING WenTao, LAN XinLong, LI QingHua, HU RunFang, GUO Na, LIN GuoQiang, ZHAO JinMing. Genome Wide Association Analysis of Soluble Sugar Content in Fresh Seeds of Soybean Landraces [J]. Scientia Agricultura Sinica, 2024, 57(11): 2079-2091.
[14] LI ShengYou, WANG ChangLing, YAN ChunJuan, ZHANG LiJun, SUN XuGang, CAO YongQiang, WANG WenBin, SONG ShuHong. Evaluation of Drought Resistance in Soybean Germplasm and Identification of Candidate Drought-Resistant Genes [J]. Scientia Agricultura Sinica, 2024, 57(10): 1857-1869.
[15] ZHU HongHui, LI YingZi, GAO YuanZhuo, LIN Hong, WANG ChengYang, YAN ZiYi, PENG HanPing, LI TianYe, XIONG Mao, LI YunFeng. Map-Based Cloning of the SHORT AND WIDEN GRAIN 1 Gene in Rice (Oryza sativa L.) [J]. Scientia Agricultura Sinica, 2023, 56(7): 1260-1274.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!