Scientia Agricultura Sinica ›› 2023, Vol. 56 ›› Issue (19): 3747-3758.doi: 10.3864/j.issn.0578-1752.2023.19.004

• SPECIAL FOCUS: GENE FUNCTION AND BREEDING IN COTTON • Previous Articles     Next Articles

Cloning and Functional Characterization of GhCPR5 in Disease Resistance of Gossypium hirsutum

XU FuChun1,2(), ZHAO JingRuo2(), ZHANG ZhenNan2, HU GaiYuan2, LONG Lu2()   

  1. 1 Changzhi Medical College, Changzhi 046000, Shanxi
    2 School of Life Sciences, Henan University/National Key Laboratory of Cotton Bio-Breeding and Integrated Utilization, Kaifeng 475000, Henan
  • Received:2023-05-05 Accepted:2023-06-12 Online:2023-10-01 Published:2023-10-08
  • Contact: LONG Lu

RichHTML

31

PDF

576

Abstract:

【Objective】This study on the function and mechanism of GhCPR5 in response to Verticillium dahliae (V. dahliae) and Botrytis cinerea (B. cinerea) in cotton analysed nucleotide sequence, protein structure, expression pattern, and biological function to provide a theoretical basis and genetic resources for cotton disease resistance and breeding mechanism research. 【Method】GhCPR5 was identified from the unpublished transcriptome data of cotton responses to V. dahliae infection. The full-length coding sequence of GhCPR5 was amplified from upland cotton TM-1. The conserved domain, protein structure, and phylogenetic relationship of GhCPR5 and homologous genes were analysed using bioinformatics techniques. Real-time fluorescence quantitative PCR (qPCR) was used to analyse the GhCPR5 expression patterns in cotton roots, stems, leaves, ovules, fibres, and petals, and the induced expression of GhCPR5 by V. dahliae infection. The silencing fragments of GhCPR5 were amplified and inserted into the VIGS vector to generate the gene silencing construct TRV:CPR5. GhCPR5-silencing plants were created via Agrobacterium-mediated transformation methods. RT-PCR and qPCR were used to analyse the silencing efficiency of GhCPR5 in TRV:CPR5 plants. TRV:00 and TRV:CPR5 plants were inoculated with V. dahliae and B. cinerea, respectively, to analyse the difference in resistance in TRV:00 and TRV:CPR5 plants in response to pathogens. To analyse defence signal pathways involving GhCPR5, the expression levels of defence-related genes in TRV:00 and TRV:CPR5 plants were detected by qPCR. 【Result】The GhCPR5 cloned from G. hirsutum TM-1 is 1 683 bp long and encodes a 560 amino acid protein. The relative molecular weight and isoelectric point of GhCPR5 are 62.883 kDa and 9.01, respectively. Multiple-sequence alignment and phylogenetic analysis showed that GhCPR5 is highly homologous with the CPR5 of Durio zibethinus and Theobroma cacao. Furthermore, the C-terminals of GhCPR5 and CPR5 of other species are highly conserved and contain 4-5 transmembrane domains. The GhCPR5 expression level was induced by V. dahliae infection and is highest in leaves and lowest in stems. Under normal conditions, no significant developmental differences were observed between the GhCPR5-silencing plants, TRV:CPR5, and the TRV:00 control plants. After inoculation with V. dahliae, the rate of disease and the disease index of TRV:CPR5 plants were significantly higher than those of the control plants. Analysis of detached leaves inoculated with V. dahliae and B. cinerea and lactophenol-trypan blue staining showed that the lesions on the leaves of TRV:CPR5 plants were much bigger than those of TRV:00 plants, indicating that silencing GhCPR5 made cotton less resistant to V. dahliae and B. cinerea. In addition, the JAZ1 expression levels in TRV:CPR5 plants were significantly higher than in TRV:00 plants, whereas the PR3, PR4, and PR5 expression levels were markedly lower in TRV:CPR5 plants. 【Conclusion】GhCPR5 positively regulates cotton disease resistance; the downregulated expression of GhCPR5 significantly reduced cotton resistance to V. dahliae and B. cinerea.

Key words: cotton, disease resistance protein, Verticillium dahliae, Botrytis cinerea, gene expression

Table 1

Primers used in this study"

引物名称Primer name 引物序列Primer sequence (5′-3′)
VIGS-GhCPR5-F CGGGGTACCGATGTTGATCGGCCTTCTGT
VIGS-GhCPR5-R CGCGGATCCGCAACTCAGCCTGTCCTGT
qRT-GhCPR5-F TCTGTGGTTTGGCTGGGAAGT
qRT-GhCPR5-R GGCATAAGACCGCACAATAAGG
qRT-JAZ1-F AGCCTCAAAAAGGAAGACCTCAAAC
qRT-JAZ1-R TGGCTGCTCAATCACCATAGTAATC
qRT-JAZ3-F TGATTTTGCTCAAGGAGATAACGCT
qRT-JAZ3-R TGATTGCCTACTCGTTGCCTGT
qRT-NPR1-F CTAGCTTGCGGAGGGATTGATACC
qRT-NPR1-R GAGATGGCTGACCTGTCAAACTGC
qRT-PR3-F ACTCCACAATCACCGAAGCCAT
qRT-PR3-R GCATTCCAACCCTTACCACATTC
qRT-PR4-F CAGGAGAAGGAGCGACTGTGA
qRT-PR4-R TCCCACATCCAAATCTAACCC
qRT-PR5-F AAGGAGTCCACCACAATCACCG
qRT-PR5-R CTGGCACTGCTATGGCTCGTAT

Fig. 1

Protein sequence analysis of GhCPR5 in cotton A: Alignment of the amino acids of GhCPR5 with homologous in Arabidopsis thaliana. AT5G64930: AtCPR5, Gh_A02G1287/Gh_D03G0427: GhCPR5 on A and D genomes in upland cotton; CPR5: amplified sequence of GhCPR5. B: Phylogenetic tree of GhCPR5 and CPR5 of other plant species. Dz: Durio zibethinus, XP_022739926, Tc: Theobroma cacao, XP_007048101, Me: Manihot esculenta, XP_021633464, Cs: Camellia sinensis, XP_028102180, At: Arabidopsis thaliana, AT5G64930, Sb: Sorghum bicolor, XP_002454622, Zm: Zea mays, NP_001146273, Os: Oryza sativa, XP_015643035, Vv: Vitis vinifera, XP_002280314, Pt: Populus trichocarpa, XP_006380467, Hs: Hibiscus syriacus, XP_039044948, Gm: Glycine max, XP_006581733. C: Prediction of the transmembrane domains (TMs) of GhCPR5 protein"

Fig. 2

Expression pattern of GhCPR5 in cotton A: Expression patterns of GhCPR5 in different tissues of cotton; B: The expression level of GhCPR5 after V. dahliae inoculation. * and **: Significant differences and extremely significant differences at P<0.05 and P<0.01. The same as below"

Fig. 3

Creating GhCPR5 silencing plants by VIGS technique in cotton A: Albino phenotype of TRV:CLA plants; B: Phenotypic analysis of control plants TRV:00 and GhCPR5 gene silencing plants TRV:CPR5; C: RT-PCR and qRT-PCR analysis of the silencing efficiency of GhCPR5"

Fig. 4

The analysis disease resistance of TRV:00 and TRV:CPR5 plants A: The disease symptoms of TRV:00 and TRV:CPR5 plants on day 9 after infected by V. dahliae; B: Photos of the cross section of stems of TRV:00 and TRV:CPR5 plants after infected for 9 days by V. dahliae; C: Fungal recovery assays of TRV:00 and TRV:CPR5 plants on day 9 after infected by V. dahliae; D: The calculation of diseased plant percentage of TRV:00 and TRV:CPR5 plants in different days following V. dahliae inoculation; E: Disease index statistics of TRV:00 and TRV:CPR5 plants after V. dahliae inoculation"

Fig. 5

The resistance assay of TRV:00 and TRV:CPR5 leaves to different pathogens A: The lesion expansion of V. dahliae on TRV:00 and TRV:CPR5 leaves at 3 d; B: The calculation of the lesion size on detached leaves of TRV:00 and TRV:CPR5 generated by V. dahliae infection; C: Trypan blue staining of the hyphae and dead cells on TRV:00 and TRV:CPR5 leaves after inoculation of V. dahliae; D: Phenotypic analysis of TRV:00 and TRV:CPR5 detached leaves after inoculation with B. cinerea; E: The calculation of lesion size on TRV:00 and TRV:CPR5 detached leaves after inoculation with B. cinerea for 4 d; F: Trypan blue staining of the hyphae and dead cells on TRV:00 and TRV:CPR5 leaves after inoculation of B. cinerea"

Fig. 6

Expression analyze of defense-related genes in TRV:00 and TRV:CPR5 plants by qRT-PCR"

[1]
SHABAN M, MIAO Y H, ULLAH A, KHAN A Q, MENGHWAR H, KHAN A H, AHMED M M, TABASSUM M A, ZHU L F. Physiological and molecular mechanism of defense in cotton against Verticillium dahliae. Plant Physiology and Biochemistry, 2018, 125: 193-204.

doi: 10.1016/j.plaphy.2018.02.011
[2]
ZHANG J, HU H L, WANG X N, YANG Y H, ZHANG C J, ZHU H Q, SHI L, TANG C M, ZHAO M W. Dynamic infection of Verticillium dahliae in upland cotton. Plant Biology, 2020, 22(1): 90-105.

doi: 10.1111/plb.v22.1
[3]
LUO X M, XIE C J, DONG J Y, YANG X Y, SUI A P. Interactions between Verticillium dahliae and its host: Vegetative growth, pathogenicity, plant immunity. Applied Microbiology and Biotechnology, 2014, 98(16): 6921-6932.

doi: 10.1007/s00253-014-5863-8
[4]
ZHANG X Y, CHENG W H, FENG Z D, ZHU Q H, SUN Y Q, LI Y J, SUN J. Transcriptomic analysis of gene expression of Verticillium dahliae upon treatment of the cotton root exudates. BMC Genomics, 2020, 21(1): 155.

doi: 10.1186/s12864-020-6448-9
[5]
XU L, ZHU L F, TU L L, LIU L L, YUAN D J, JIN L, LONG L, ZHANG X L. Lignin metabolism has a central role in the resistance of cotton to the wilt fungus Verticillium dahliae as revealed by RNA-Seq-dependent transcriptional analysis and histochemistry. Journal of Experimental Botany, 2011, 62(15): 5607-5621.

doi: 10.1093/jxb/err245 pmid: 21862479
[6]
GAO W, LONG L, ZHU L F, XU L, GAO W H, SUN L Q, LIU L L, ZHANG X L. Proteomic and virus-induced gene silencing (VIGS) analyses reveal that gossypol, brassinosteroids, and jasmonic acid contribute to the resistance of cotton to Verticillium dahliae. Molecular & Cellular Proteomics, 2013, 12(12): 3690-3703.

doi: 10.1074/mcp.M113.031013
[7]
HU Q, MIN L, YANG X Y, JIN S X, ZHANG L, LI Y Y, MA Y Z, QI X W, LI D Q, LIU H B, LINDSEY K, ZHU L F, ZHANG X L. Laccase GhLac1 modulates broad spectrum biotic stress tolerance via manipulating phenylpropanoid pathway and jasmonic acid synthesis. Plant Physiology, 2018, 176(2): 1808-1823.

doi: 10.1104/pp.17.01628
[8]
ZHANG Y, WU L Z, WANG X F, CHEN B, ZHAO J, CUI J, LI Z K, YANG J, WU L Q, WU J H, ZHANG G Y, MA Z Y. The cotton laccase gene GhLAC15 enhances Verticillium wilt resistance via an increase in defence induced lignification and lignin components in the cell walls of plants. Molecular Plant Pathology, 2019, 20(3): 309-322.

doi: 10.1111/mpp.2019.20.issue-3
[9]
MA Q, WANG N H, MA L, LU J H, WANG H T, WANG C C, YU S X, WEI H L. The cotton BEL1-like transcription factor GhBLH7-D06 negatively regulates the defense response against Verticillium dahliae. International Journal of Molecular Sciences, 2020, 21(19): 7126.

doi: 10.3390/ijms21197126
[10]
XIAO S H, HU Q, SHEN J L, LIU S M, YANG Z G, CHEN K, KLOSTERMAN S J, JAVORNIK B, ZHANG X L, ZHU L F. GhMYB4 downregulates lignin biosynthesis and enhances cotton resistance to Verticillium dahliae. Plant Cell Reports, 2021, 40(4): 735-751.

doi: 10.1007/s00299-021-02672-x
[11]
HU Q, XIAO S H, WANG X R, AO C W, ZHANG X L, ZHU L F. GhWRKY1-like enhances cotton resistance to Verticillium dahliae via an increase in defense induced lignification and S monolignol content. Plant Science, 2021, 305: 110833.

doi: 10.1016/j.plantsci.2021.110833
[12]
SONG Y, LIU L L, WANG Y D, VALKENBURG D J, ZHANG X L, ZHU L F, THOMMA B P H J. Transfer of tomato immune receptor Ve1 confers Ave1 dependent Verticillium resistance in tobacco and cotton. Plant Biotechnology Journal, 2018, 16(2): 638-648.

doi: 10.1111/pbi.2018.16.issue-2
[13]
SONG R R, LI J P, XIE C J, JIAN W, YANG X Y. An overview of the molecular genetics of plant resistance to the Verticillium wilt pathogen Verticillium dahliae. International Journal of Molecular Sciences, 2020, 21(3): 1120.

doi: 10.3390/ijms21031120
[14]
SHABAN M, KHAN A H, NOOR E, MALIK W, ALI H M W, SHEHZAD M, AKRAM U, QAYYUM A. A 13-lipoxygenase, GhLOX2, positively regulates cotton tolerance against Verticillium dahliae through JA-mediated pathway. Gene, 2021, 796/797: 145797.

doi: 10.1016/j.gene.2021.145797
[15]
LIU S C, SUN R B, ZHANG X J, FENG Z L, WEI F, ZHAO L H, ZHANG Y L, ZHU L F, FENG H J, ZHU H Q. Genome wide analysis of OPR family genes in cotton identified a role for GhOPR9 in Verticillium dahliae resistance. Genes, 2020, 11(10): 1134.

doi: 10.3390/genes11101134
[16]
WANG G N, WANG X F, ZHANG Y, YANG J, LI Z K, WU L Z, WU J H, WU N, LIU L X, LIU Z W, ZHANG M, WU L Q, ZHANG G Y, MA Z Y. Dynamic characteristics and functional analysis provide new insights into long non-coding RNA responsive to Verticillium dahliae infection in Gossypium hirsutum. BMC Plant Biology, 2021, 21(1): 68.

doi: 10.1186/s12870-021-02835-8
[17]
LONG L, XU F C, ZHAO J R, LI B, XU L, GAO W. GbMPK3 overexpression increases cotton sensitivity to Verticillium dahliae by regulating salicylic acid signaling. Plant Science, 2020, 292: 110374.

doi: 10.1016/j.plantsci.2019.110374
[18]
YOSHIDA S, ITO M, NISHIDA I, WATANABE A. Identification of a novel gene HYS1/CPR5 that has a repressive role in the induction of leaf senescence and pathogen-defence responses in Arabidopsis thaliana. The Plant Journal, 2002, 29(4): 427-437.

doi: 10.1046/j.0960-7412.2001.01228.x
[19]
VAN D J. CPR5 modulates plant immunity via RNA processing. The Plant Cell, 2022, 34(5): 1437-1438.

doi: 10.1093/plcell/koac060 pmid: 35226104
[20]
BOWLING S A, CLARKE J D, LIU Y, KLESSIG D F, DONG X. The cpr5 mutant of Arabidopsis expresses both NPR1-dependent and NPR1-independent resistance. The Plant Cell, 1997, 9(9): 1573-1584.
[21]
BOCH J, VERBSKY M L, ROBERTSON T L, LARKIN J C, KUNKEL B N. Analysis of resistance gene-mediated defense responses in Arabidopsis thaliana plants carrying a mutation in CPR5. Molecular Plant-Microbe Interactions, 1998, 11(12): 1196-1206.

doi: 10.1094/MPMI.1998.11.12.1196
[22]
JING H C, ANDERSON L, STURRE M J G, HILLE J, DIJKWEL P P. Arabidopsis CPR5 is a senescence-regulatory gene with pleiotropic functions as predicted by the evolutionary theory of senescence. Journal of Experimental Botany, 2007, 58(14): 3885-3894.

doi: 10.1093/jxb/erm237
[23]
GAO G L, ZHANG S C, WANG C F, YANG X, WANG Y Q, SU X J, DU J J, YANG C W. Arabidopsis CPR5 independently regulates seed germination and postgermination arrest of development through LOX pathway and ABA signaling. PLoS ONE, 2011, 6(4): e19406.

doi: 10.1371/journal.pone.0019406
[24]
MENG Z, RUBERTI C, GONG Z Z, BRANDIZZI F. CPR5 modulates salicylic acid and the unfolded protein response to manage tradeoffs between plant growth and stress responses. The Plant Journal, 2017, 89(3): 486-501.

doi: 10.1111/tpj.13397 pmid: 27747970
[25]
PENG S, GUO D B, GUO Y, ZHAO H Y, MEI J, HAN Y K, GUAN R, WANG T H, SONG T, SUN K K, LIU Y H, MAO T, CHANG H, XUE J S, CAI Y F, CHEN D, WANG S. Constitutive expresser of pathogenesis-related genes 5 is an RNA-binding protein controlling plant immunity via an RNA processing complex. The Plant Cell, 2022, 34(5): 1724-1744.

doi: 10.1093/plcell/koac037 pmid: 35137215
[26]
CHEN J C, SUI X Y, MA B R, LI Y T, LI N, QIAO L F, YU Y C, DONG C H. Arabidopsis CPR5 plays a role in regulating nucleocytoplasmic transport of mRNAs in ethylene signaling pathway. Plant Cell Reports, 2022, 41(4): 1075-1085.

doi: 10.1007/s00299-022-02838-1 pmid: 35201411
[27]
WANG H, UMER M J, LIU F, CAI X Y, ZHENG J, XU Y C, HOU Y Q, ZHOU Z L. Genome-wide identification and characterization of CPR5 genes in Gossypium reveals their potential role in trichome development. Frontiers in Genetics, 2022, 13: 921096.

doi: 10.3389/fgene.2022.921096
[28]
TAMURA K, STECHER G, PETERSON D, FILIPSKI A, KUMAR S. MEGA6: Molecular evolutionary genetics analysis version 6.0. Molecular Biology and Evolution, 2013, 30(12): 2725-2729.

doi: 10.1093/molbev/mst197 pmid: 24132122
[29]
LONG L, LIU J, GAO Y, XU F C, ZHAO J R, LI B, GAO W. Flavonoid accumulation in spontaneous cotton mutant results in red coloration and enhanced disease resistance. Plant Physiology and Biochemistry, 2019, 143: 40-49.

doi: S0981-9428(19)30327-4 pmid: 31479881
[30]
FRADIN E F, ZHANG Z, JUAREZ AYALA J C, CASTROVERDE C D M, NAZAR R N, ROBB J, LIU C M, THOMMA B P H J. Genetic dissection of Verticillium wilt resistance mediated by tomato Ve1. Plant Physiology, 2009, 150(1): 320-332.

doi: 10.1104/pp.109.136762
[31]
GAO W, LONG L, XU L, LINDSEY K, ZHANG X L, ZHU L F. Suppression of the homeobox gene HDTF1 enhances resistance to Verticillium dahliae and Botrytis cinerea in cotton. Journal of Integrative Plant Biology, 2016, 58(5): 503-513.

doi: 10.1111/jipb.v58.5
[32]
KIRIK V, BOUYER D, SCHÖBINGER U, BECHTOLD N, HERZOG M, BONNEVILLE J M, HÜLSKAMP M. CPR5 is involved in cell proliferation and cell death control and encodes a novel transmembrane protein. Current Biology, 2001, 11(23): 1891-1895.

pmid: 11728314
[33]
刘锋, 舒曦, 郑艳华, 黎梓君, 阳成伟, 王亚琴. 水稻CPR5基因参与氧化胁迫响应. 热带亚热带植物学报, 2013, 21(4): 305-314.
LIU F, SHU X, ZHENG Y H, LI Z J, YANG C W, WANG Y Q. Involvement of rice CPR5 in response to oxidative stress. Journal of Tropical and Subtropical Botany, 2013, 21(4): 305-314. (in Chinese)
[34]
MA M M, LI M, ZHOU R F, YU J B, WU Y, ZHANG X L, WANG J L, ZHOU J M, LIANG X X. CPR5 positively regulates pattern- triggered immunity via a mediator protein. Journal of Integrative Plant Biology, 2023, 65(7): 1613-1619.

doi: 10.1111/jipb.v65.7
[35]
WANG Y, MOSTAFA S, ZENG W, JIN B. Function and mechanism of jasmonic acid in plant responses to abiotic and biotic stresses. International Journal of Molecular Sciences, 2021, 22(16): 8568.

doi: 10.3390/ijms22168568
[36]
AMEYE M, AUDENAERT K, DE ZUTTER N, STEPPE K, VAN MEULEBROEK L, VANHAECKE L, DE VLEESSCHAUWER D, HAESAERT G, SMAGGHE G. Priming of wheat with the green leaf volatile Z-3-hexenyl acetate enhances defense against Fusarium graminearum but boosts deoxynivalenol production. Plant Physiology, 2015, 167(4): 1671-1684.

doi: 10.1104/pp.15.00107
[37]
LIU D, ZHAO Q, CUI X, CHEN R, LI X, QIU B, GE F. A transcriptome analysis uncovers Panax notoginseng resistance to Fusarium solani induced by methyl jasmonate. Genes Genomics, 2019, 41(12): 1383-1396.

doi: 10.1007/s13258-019-00865-z
[38]
HE X, ZHU L F, WASSAN G M, WANG Y J, MIAO Y H, SHABAN M, HU H Y, SUN H, ZHANG X L. GhJAZ2 attenuates cotton resistance to biotic stresses via the inhibition of the transcriptional activity of GhbHLH171. Molecular Plant Pathology, 2018, 19(4): 896-908.

doi: 10.1111/mpp.12575 pmid: 28665036
[1] KAN JiaQiang, LIU Yu, ZHOU ZhiGuo, CHEN BingLin, ZHAO WenQing, HU Wei, HU ShaoHong, CHEN Yang, WANG YouHua. Effects of Squares and Bolls Abscission on Photosynthate Accumulation and Its Strength as an Auxiliary Source of Cotton Sympodial Leaves [J]. Scientia Agricultura Sinica, 2023, 56(9): 1658-1669.
[2] XING YuTong, TENG YongKang, WU TianFan, LIU YuanYuan, CHEN Yuan, CHEN Yuan, CHEN DeHua, ZHANG Xiang. Mepiquat Chloride Increases the Cry1Ac Protein Content Through Regulating Carbon and Amino Acid Metabolism of Bt Cotton Under High Temperature and Drought Stress [J]. Scientia Agricultura Sinica, 2023, 56(8): 1471-1483.
[3] WANG Ning, FENG KeYun, NAN HongYu, CONG AnQi, ZHANG TongHui. Effects of Combined Application of Organic Manure and Chemical Fertilizer Ratio on Water and Nitrogen Use Efficiency of Cotton Under Water Deficit [J]. Scientia Agricultura Sinica, 2023, 56(8): 1531-1546.
[4] QU Qing, LIU Ning, ZOU JinPeng, ZHANG YaXuan, JIA Hui, SUN ManLi, CAO ZhiYan, DONG JinGao. Screening of Differential Genes and Analysis of Metabolic Pathways in the Interaction Between Fusarium verticillioides and Maize Kernels [J]. Scientia Agricultura Sinica, 2023, 56(6): 1086-1101.
[5] JIA XiaoYun, WANG ShiJie, ZHU JiJie, ZHAO HongXia, LI Miao, WANG GuoYin. Construction of A High-Density Genetic Map and QTL Mapping for Yield Related Traits in Upland Cotton [J]. Scientia Agricultura Sinica, 2023, 56(4): 587-598.
[6] LUO WanZhen, WANG Dan, QI HongYue, WANG Tong, LIU Zheng, TIAN Li, DAI XiaoFeng, CHEN JinYin, MIJITI Maihemuti. Identification of Antagonistic Bacterium Strain KRS022 and Its Inhibition Effect on Verticillium dahliae [J]. Scientia Agricultura Sinica, 2023, 56(4): 649-664.
[7] ZOU Ting, LIU LiLi, XIANG JianHua, ZHOU DingGang, WU JinFeng, LI Mei, LI Bao, ZHANG DaWei, YAN MingLi. Cloning of MYBL2 Gene from Brassica and Its PCR Identification in Genomes A, B and C [J]. Scientia Agricultura Sinica, 2023, 56(3): 416-429.
[8] LIU Fang, XU MengBei, WANG QiaoLing, MENG Qian, LI GuiMing, ZHANG HongJu, TIAN HuiDan, XU Fan, LUO Ming. Cloning and Functional Characterization of the Promoter of GhSLD1 Gene That Predominantly Expressed in Cotton Fiber [J]. Scientia Agricultura Sinica, 2023, 56(19): 3712-3722.
[9] DING GuoHua, XIAO GuangHui, ZHU LiPing. Genome-Wide Identification and Expression Analysis of NLP (NIN- Like Protein) Transcription Factor Gene Family in Cotton [J]. Scientia Agricultura Sinica, 2023, 56(19): 3723-3746.
[10] ZHANG YuJia, CUI KaiWen, DUAN LiSheng, CAO AiPing, XIE QuanLiang, SHEN HaiTao, WANG Fei, LI HongBin. Identification and Expression of CAD and CAD-Like Gene Families from Gossypium barbadense and Their Response to Verticillium dahliae [J]. Scientia Agricultura Sinica, 2023, 56(19): 3759-3771.
[11] LIANG ChengZhen, ZANG YouYi, MENG ZhiGang, WANG Yuan, MUBASHIR Abbas, HE HaiYan, ZHOU Qi, WEI YunXiao, ZHANG Rui, GUO SanDui. Identification of Target Traits and Genetic Stability of Transgenic Cotton GGK2 [J]. Scientia Agricultura Sinica, 2023, 56(17): 3251-3260.
[12] WANG WanRu, CAO YueFen, SHENG Kuang, CHEN JinHong, ZHAO TianLun, ZHU ShuiJin. The Creation and Characteristics of Cotton Germplasm Lines Transgenic 1174AALdico-2+CTP Gene with Excellent Glyphosate Tolerance [J]. Scientia Agricultura Sinica, 2023, 56(17): 3261-3276.
[13] MA YanBin, LI HuanLi, WEN Jin, ZHOU XianTing, QIN Xin, WANG Xia, WANG XinSheng, LI YanE. Identification of Molecular Characterizations for Transgenic Cotton R1-3 Line of Glyphosate Tolerance [J]. Scientia Agricultura Sinica, 2023, 56(17): 3277-3284.
[14] DANG WenWen, LIU Bing, CHU Dong, LU YanHui. Dominated Species and the Predation Assessment of Natural Enemies on Thrips in Cotton Fields in Xinjiang [J]. Scientia Agricultura Sinica, 2023, 56(17): 3347-3357.
[15] HE Dan, YOU XiaoLong, HE SongLin, ZHANG MingXing, ZHANG JiaoRui, HUA Chao, WANG Zheng, LIU YiPing. Identification of Callose Synthetase Gene Family and Functional Analysis of PlCalS5 in Paeonia lactiflora [J]. Scientia Agricultura Sinica, 2023, 56(16): 3183-3198.
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
京ICP备09089781号-30
Copyright 2018 © Editorial office of Scientia Agricultura Sinica
Tel: 86-010-82106279    E-mail: zgnykx@mail.caas.net.cn
Supported by Beijing Magtech Co.Ltd