Loading...

Table of Content

    01 March 2020, Volume 53 Issue 5
    CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS
    ABA Metabolism and Signaling and Their Molecular Mechanism Regulating Seed Dormancy and Germination
    SONG SongQuan,LIU Jun,XU HengHeng,LIU Xu,HUANG Hui
    Scientia Agricultura Sinica. 2020, 53(5):  857-873.  doi:10.3864/j.issn.0578-1752.2020.05.001
    Abstract ( 1584 )   HTML ( 107 )   PDF (1356KB) ( 2753 )   Save
    Figures and Tables | References | Related Articles | Metrics

    Seed dormancy is an adaptive characteristic to environmental changes acquired by many plants during long-term phylogenetic development, and is an effective way regulating the optimal spatiotemporal distribution of seed germination and seedling formation, and is also a selective strategy for the successful reproduction and propagation in species. Phytohormonal regulation of seed dormancy and germination may be a highly conserved mechanism, of which abscisic acid (ABA) plays a master role in dormancy release and germination, and gibberellin (GA) functions as stimulating seed germination after dormancy is released. The role of ABA in seed dormancy and germination is mainly regulated by its metabolism (biosynthesis and catabolism) and signaling pathways. Therefore, in this paper, we mainly summarize the research progresses of ABA metabolism and signaling, the effects of ABA on seed development, dormancy and germination as well as the relationships between DOG1 (DELAY OF GERMINATION1, a specific gene involved in seed dormancy) and ABA signaling components. The researches showed that C40 epoxycarotenoid is a precursor, and zeaxanthin epoxidase and 9-cis-epoxycarotenoid dioxygenase are the principal regulatory enzymes in ABA biosynthesis. The ABA catabolism includes hydroxylation and conjugation with glucose. The hydroxylation of ABA at C-8' position is catalyzed by the CYP707A, which is an important step for ABA catabolism. In the core ABA signaling pathway, ABA binds to PYR/PYL/RCAR receptors and triggers a conformational change that allows receptor-ABA complex to bind to and inhibit type 2C protein phosphatase (PP2C) activity, which results in de-repression and activation of kinases such as sucrose non-fermenting1-related protein kinase 2 (SnRK2). These kinases then phosphorylate and activate transcription factors (TF), which bind to the target promoters and induce the expression of ABA response gene downstream. ABA accumulates in seeds during mid- and late-maturation stages, and ABA synthesized in zygotic tissues induces primary dormancy and promotes seed maturation. ABA content accumulated during development and preserved in dry seeds declines at the early stage of seed imbibition. ABA is a positive regulator of seed dormancy induction and maintenance, and is a negative regulator of seed germination. DOG1 expresses and functions during seed maturation, and its expression is regulated by alternative splicing and alternative polyadenylation. Antisense DOG1 is a repressor of seed dormancy, which negatively regulates DOG1 expression and seed dormancy by causing transcriptional interference and affecting transcription extension. Seed dormancy and germination are regulated not only by core ABA signaling pathway, but also by DOG1-AHG1 (ABA HYPERSENSITIVE GERMINATION1)/AHG3 pathway. DOG1 can bind to AHG1/AHG3 and cause seed dormancy by sequestrating those negative regulators of ABA signaling and increasing ABA sensitivity in seeds. Finally, we propose some scientific issues required for investigation further in the future. How do ABA 8'-hydroxylase, ABA glucosyltransferase and β-glucosidase and their genes respond to developmental and environmental changes to maintain the normal ABA levels in ABA catabolism? How do the important regulators in ABA physiology such as Ca 2+ or reactive oxygen species influence the core ABA signaling pathway? Which pathway is preferentially responded by PP2C, a downstream overlapping component of core ABA signaling pathway and DOG1-AHG1/AHG3 pathway, when it integrates physiological conditions or environmental signals, and how are these two pathways coordinated, and what new target components does PP2C have? This paper will provide a basis to further investigate the molecular mechanism regulating seed dormancy and germination by ABA.

    Transcriptome Analysis of Maize pTAC2 Effects on Chlorophyll Synthesis in Seedling Leaves
    ZHANG Wen,MENG ShuJun,WANG QiYue,WAN Jiong,MA ShuanHong,LIN Yuan,DING Dong,TANG JiHua
    Scientia Agricultura Sinica. 2020, 53(5):  874-889.  doi:10.3864/j.issn.0578-1752.2020.05.002
    Abstract ( 887 )   HTML ( 43 )   PDF (4009KB) ( 734 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】Chlorophyll is the most important photosynthetic pigment involved in plant photosynthesis. The development of chloroplasts and the synthesis of chlorophyll depend on the bi-directional signaling between the plastid and the nuclear genome. Plastid transcriptionally active chromosome proteins (pTACs) are essential for maintaining the transcriptional activity of PEP (plastid-encoded RNA polymerase) genes, whereas the function of pTACs in maize is still poorly understood. 【Method】The CRISPR/Cas9-ZmpTAC2 maize transgenic editing homozygous mutants were supplied. Transmission electron microscope were used to observe the ultrastructure of the chloroplast, with spectrophotometer to measure the chlorophyll content in maize leaves, respectively. Transcriptome sequencing of the negative material (CK) and CRISPR/Cas9-ZmpTAC2 transgenic homozygous (zmptac2) seedling leaves was performed. Bioinformatics toolbox was performed to identify the differently expressed genes between CK and zmptac2 leaves. Relative quantification of expression of selected differently expressed genes were verified using qRT-PCR. The interacting proteins of ZmpTAC2 were screened by yeast two-hybrid system. 【Result】 A total of 15 T0 transgenic seedlings were obtained, including 7 with green leaves and 8 with white ones. Among the seven green-leaf seedlings, 3 were transgenic negative together with 4 transgenic positive including 2 seedlings were edited. On the other hand, all 8 white-leaf seedlings were transgenic positive with homozygous editing. Compared with CK, zmptac2 chloroplast was abnormal with significantly reduced chlorophyll content. The results of RNA-seq showed that 1 367 genes were differentially expressed between CK and zmptac2, of which 618 genes were up-regulated (zmptac2/CK) and 749 genes down-regulated (zmptac2/CK). GO enrichment analysis revealed that the down-regulated genes were significantly enriched in chloroplasts and plastids. KEGG analysis indicated that down-regulated genes were abundant in the pathways of phenylalanine, tyrosine, and iso-quinoline alkaloid metabolism. Relative expression values of 15 selected differently expressed genes showed similar expression patterns and are consistent with sequencing data, which indicated that the sequencing results were reliable. The expression of PEP (plastid-encoded RNA polymerase) dependent genes in zmptac2 was significantly decreased, while the expression of NEP (nuclear gene-encoded RNA polymerase) genes increased. ZmpTAC3 was identified to be interacted with ZmpTAC2 by cDNA screening and verified by interaction assay. 【Conclusion】 This study first reported that mutations in the ZmpTAC2 gene cause early chloroplast biosynthesis to be hindered, indicating that this gene is involved in chloroplast development and chlorophyll synthesis, which is achieved by ZmpTAC2 regulated PEP-related gene expression.

    TILLAGE & CULTIVATION·PHYSIOLOGY & BIOCHEMISTRY·AGRICULTURE INFORMATION TECHNOLOGY
    Differences in Yield and Growth Traits of Different Japonica Varieties in the Double Cropping Late Season in the Lower Reaches of the Yangtze River
    YIN Min,LIU ShaoWen,CHU Guang,XU ChunMei,WANG DanYing,ZHANG XiuFu,CHEN Song
    Scientia Agricultura Sinica. 2020, 53(5):  890-903.  doi:10.3864/j.issn.0578-1752.2020.05.003
    Abstract ( 876 )   HTML ( 25 )   PDF (1243KB) ( 1047 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】The aim of the study was to evaluate the yield and growth traits of different types of japonica rice in the late season in the lower reaches of the Yangtze River, so as to provide a theoretical basis for selecting the proper varieties in the double cropping late season in this area. 【Method】 Field experiment was carried out at the China National Rice Research Institute in Hangzhou, Zhejiang province from 2017 to 2018, with four rice types, including the late indica rice (IR) as a control, inbred japonica (IJR), hybrid japonica (HJR) and indica/japonica hybrid rice (IJHR). 【Result】(1) The yield of IJHR (8.3-10.0 t·hm -2) was significantly higher than that of other rice types, increasing by 2.9%-29.3%, 30.9%-35.3% , and 13.4%-14.0% than IR, IJR, and HJR, respectively; The average yield of IJR was the lowest, which was 24.0% (2017) and 1.2% (2018) lower than control (IR), while the yield difference between HJR and IR was varied within years. The IJHR had higher spikelets per panicle and greater sink, and similar panicles per unit area, grain weight, and grain setting as compared to IR. In contrast, the IJR/HJR had higher grain weight and lower spikelets per panicle than IR. The growth duration was ranked in the order of IJHR>HJR>IJR>IR. Compared with IR, the japonica rice (IJR, HJR, and IJHR) had similar vegetative stage (about 56-59 d), slightly reduced reproductive stage (1-6 d), and prolonged the grain filling stage (12-22 d), which leading to an improved accumulation of temperature and solar radiation of the growth duration. (2) The yield component and phenological traits were dimensional reduced by principal component analysis (PCA) as principal component one (panicle size factor, 37.7%) and the principal component two (the growth factor, 24.7%), of which the IJHR was classified as variety with few panicles, large grains, and long grain filling stage, and the IR was medium panicles numbers and size, and short grain filling stage. There was no difference between IJR and HJR based on PCA, being multiple panicles, small panicle size, and long grain filling stage. (3) Correlation analysis showed that the yields of late japonica rice were significantly positively correlated with spikelets per panicle (R 2=0.607,P<0.001), sink size (R 2=0.779,P<0.001) and grain filling stage (R 2=0.505,P<0.001). Compared with the late indica rice, the yield of the double cropping late japonica rice was obvious sensitive to the change of environment, which was characterized by large coefficient of variation between varieties and years. Therefore, it was necessary to localize the variety and cultivate it by species. 【Conclusion】 Applying japonica variety in the late season would prolong the grain filling stage, and increase the temperature and solar radiation accumulation for the late-season rice as compared with IR. The IJHR with large panicle size, high sink size and long grain filling stage maintained the great yield superiors and being suitable for growing the late season in the lower reaches of the Yangtze River, which would help to improve the yield, temperature and light resources utilization and safety of the late-season rice.

    Simulation of Spring Wheat Yield Response to Temperature Changes of Different Growth Stages in Drylands
    WANG Jun,LI Guang,YAN LiJuan,LIU Qiang,NIE ZhiGang
    Scientia Agricultura Sinica. 2020, 53(5):  904-916.  doi:10.3864/j.issn.0578-1752.2020.05.004
    Abstract ( 622 )   HTML ( 30 )   PDF (548KB) ( 840 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】This research quantitatively analyzed the effects of temperature changes in different growth stages on the yield of spring wheat in the Loess Plateau Gully Region of Central Gansu, so as to provide theoretical guidance and decision- making basis for making reasonable cropping pattern in the Loess Plateau Gully Region of Central Gansu 【Method】Specifically, it investigated the relationship between temperature changes in different growth stages and the yield of spring wheat in dryland based on grey relational analysis, so as to identify the key growth stages of spring wheat. The yield of spring wheat was simulated using the APSIM (Agricultural Production System Simulator) model under different temperature conditions in different growth stages. The mechanism of yield response to temperature changes in different growth stages was studied through quadratic polynomial regression analysis and single factor marginal effect analysis. 【Result】(1) The results showed that the APSIM model had good applicability in simulating yield and growth stages of spring wheat in the Loess Plateau Gully Region of Central Gansu. The values of the average root mean square error (RMSE), normalized root mean square error (NRMSE), and model effectiveness index (ME) of the yield of the simulation model were 39.95 kg?hm -1, 1.55% and 0.73, respectively. The values of the RMSE, NRMSE, and ME of the simulated model phenology dates were 2.78 d, 1.87% and 0.83, respectively. (2)The average temperature increased steadily during all growth stages of spring wheat in the Loess Plateau Gully Region of Central Gansu, and the average temperatures of the different growth stages showed an increasing trend. The increase of average annual temperature were 0.44℃?(10a) -1, 0.34℃?(10a) -1, 0.17℃?(10a) -1, 0.41℃?(10a) -1, 0.49℃?(10a) -1, 0.52℃?(10a) -1 and 0.35℃?(10a) -1 in sowing-emergence, emergence-tillering, tillering-jointing, jointing-booting, booting-flowering, flowering-grain filling, grain filling-maturity, respectively. (3) The importance of temperature changes in different growth stages on the yield of spring wheat were ranked as follows: grain filling-maturity, flowering-grain filling, sowing-emergence, booting- flowering, jointing-booting, emergence- tillering, fallow, and the tillering-jointing stage. (4) Under constant temperatures at the other growth stages, a temperature increase of 0.5℃ during the sowing-emergence stage could increase the wheat yield by 0.45%; A temperature increase of 0.5℃ during the booting-flowering stage could reduce the wheat yield by 0.34%; a temperature increase of 0.5℃ during the flowering-filling stage could reduce the wheat yield by 0.65%; A temperature increase of 0.5℃ during the filling-maturity stage could reduce the wheat yield by 1.09%. When temperature changes during the sowing-emergence and booting-flowering stages were the same, the effects of the temperature changes on the yield of spring wheat were similar. 【Conclusion】APSIM model has achiedved good simulation results on the yield and growth stages of spring wheat of different sowing dates in the Loess Plateau Gully Region of Central Gansu. The trend of temperature increase obviously existed in the study area during the whole growth stages of spring wheat, but temperature increment was different in different growth stages.The effects of temperature changes in different growth stages on the yield of spring wheat were different. Warming was beneficial to increasing yield during sowing to emergence, but warming led to yield reduction during other growth stages.

    Physiological Response of Millet Callus with Different Herbicide-Resistance to Sethoxydim Stress
    ZHAO Juan,YIN YiZhen,WANG XiaoLu,MA ChunYing,YIN MeiQiang,WEN YinYuan,SONG XiE,DONG ShuQi,YANG XueFang,YUAN XiangYang
    Scientia Agricultura Sinica. 2020, 53(5):  917-928.  doi:10.3864/j.issn.0578-1752.2020.05.005
    Abstract ( 742 )   HTML ( 42 )   PDF (1392KB) ( 1116 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】One aims of this study were to study the effects of sethoxydim stress on the physiological characteristics of millet callus of different herbicide-resistance varieties. The other aims were to analyze the physiological response of millet different varieties under sethoxydim stress and to explore the physiological mechanism of millet herbicide resistance at the cellular level, thus providing a theoretical reference for the studies of millet herbicide-resistance and its improvement. 【Method】 The sethoxydim sensitive variety Jingu 21 and the resistant variety Yugu 35, Jigu 42 were used as experimental materials in this study. Different concentrations of Sethoxydim were added to the culture medium for stress treatment, and no sethoxydim was added as control (CK). The physiological response mechanism between three millet varieties under sethoxydim stress were analyzed. The contents of malondialdehyde (MDA), membrane permeability, superoxide anion (O2 -), proline (Pro), soluble protein (SP), soluble sugar(SS), superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT) activities in millet callus were determined. 【Result】 Increasing sethoxydim stress concentration had different effects on callus growth of three millet varieties, and the effect on Jingu 21 was greater than Yugu 35 and Jigu 42. The physiological indices of the callus of three millet varieties were significantly effected by sethoxydim stress, but the trend and degree of influence were different. The MDA content, relative permeability of cell membrane and O2 - content in callus of Yugu 35 and Jigu 42 were significantly lower than those of Jingu 21, while SOD and POD activities were significantly higher than those of Jingu 21 at higher concentrations. The contents of SP, SS and Pro are constantly changing. 【Conclusion】 Under sethoxydim stress, the variation trend of relative physiological and biochemical indexes of three millet cultivars were significantly different and the differences in response showed that the cell protective enzyme system and osmotic adjustment substance were involved in the regulation of herbicide resistance. There was different trend between the two resistant varieties, indicating that the herbicide-resistance of millet callus showed comprehensively defense mechanism on physiological and biochemical traits.

    Physiological and Biochemical Characteristics of Low Temperature Vernalization of Germinating Seeds of Brassica rapa
    XU ChunMei,ZOU Ya,LIU ZiGang,MI WenBo,XU MingXia,DONG XiaoYun,CAO XiaoDong,ZHENG GuoQiang,FANG XinLing
    Scientia Agricultura Sinica. 2020, 53(5):  929-941.  doi:10.3864/j.issn.0578-1752.2020.05.006
    Abstract ( 834 )   HTML ( 22 )   PDF (1115KB) ( 1463 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】 To explore the possibility of low temperature through vernalization to the germination of Brassica rapa, and the phenotypic changes of seed physiology and biochemistry and plant set during vernalization, so as to provide theoretical basis for artificial breeding and accelerating breeding process of B. rapa. 【Method】 Three different temperature-sensitive of B. rapa were used as materials, the germinated seeds were placed in 4℃ of low temperature for vernalization treatment. During the vernalization process (0 d, 20 d, 30 d, 40 d, 50 d, 60 d) the physiological and biochemical indexes such as nitrate reductase, antioxidant enzyme activity, osmotic regulator and malondialdehyde content of the germinated seeds were measured. Simultaneously germinated seeds of each vernalization treatment, the growth period of the seed formation plant was observed, and the seed-setting performance of the plants were measured. 【Result】 With the increase of vernalization time, the vernalization rate (V), plant height (FPH), mature plant height (MPH) and primary branch number (PB), the number of pods per plant (SP), the length of pods (LS), the number of pods (SS) and the yield per plant (YP) of germinated seeds of B. rapa showed an increasing trend; the early stage of vernalization (0-40 d), the plant's seed-setting performance showed significant differences among different varieties. After the vernalization time increased (50-60 d), the seed-setting ability of different varieties was slightly difference, but they were not significantly difference. The results of regression analysis showed that the germination seeds of strong winter rapa Longyou 7 at 4℃ were completely vernalized (springing rate >95%) and need to be treated 76.9 d, Longyou 9 and Tianyou 4 were 54.0 d, 39.4 d, respectively. Correlation analysis showed that the vernalization rate was extremely significant positive correlated with plant height and seed-setting performance and other phenotypic traits. The correlation coefficient between vernalization rate with average first flower plant height and average mature plant height was 0.947 and 0.985, which indicated that vernalization degree of winter B. rapa significantly affected plant height and seed-setting performance. With the increase of low temperature vernalization time, the germinated seeds of winter B. rapa with nitrate reductase (NR), superoxide dismutase (SOD), peroxidase (POD), malondialdehyde (MDA), soluble protein (SP), Soluble sugar (SS) were increased first and then decreased, and the activity of catalase (CAT) decreased continuously. Compared with the control (the germinated seeds not treated at low temperature), the content of GA3 in the germinated seeds of Longyou 7 and Longyou 9 decreased significantly at the low temperature vernalization treatment, and the content of GA3 in the germinated seeds of Tianyou 4 was significantly higher than that of the control at 30 days. Compared with the control, the content of IAA in the winter rapeseed germinated in vernalization increased significantly (except for the treatment 40 days of Longyou9). Among them, the content of IAA in the seeds treated with vernalization for 50 days of Tianyou 4 increased by 197.0% compared with the control. The ABA content of the Longyou 7 was significantly increased compared with the control. 【Conclusion】 The germination seeds of winter Brassica rapa can be perceived the low temperature to complete the vernalization. The low temperature time required for vernalization of the variety depends on the winter strength. During the process vernalization of low temperature, the physiological and biochemical status is occurring some changes of the seed of winter B. rapa, and ultimately affect the growth and development of the plant and its seed setting performance.

    PLANT PROTECTION
    Effect of Wilt-Resistant and Wilt-Susceptible Cotton on Soil Bacterial Community Structure at Flowering and Boll Stage
    ZHAO WeiSong,GUO QingGang,LI SheZeng,WANG PeiPei,LU XiuYun,SU ZhenHe,ZHANG XiaoYun,MA Ping
    Scientia Agricultura Sinica. 2020, 53(5):  942-954.  doi:10.3864/j.issn.0578-1752.2020.05.007
    Abstract ( 894 )   HTML ( 24 )   PDF (1808KB) ( 645 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】The objective of this study is to research soil bacterial community structure of cotton verticillium wilt resistant and susceptible varieties at flowering and boll stage, understand the relationship between soil bacterial community structure and soil physicochemical properties, and to provide a theoretical basis for monitoring of cotton verticillium wilt and green ecological control. 【Method】The susceptible (EJ) and resistant (J863) varieties were used in field plot experiments. The ITS gene copy number of Verticillium dahliae and soil bacterial community structure at different flowering and boll stages (flowering, late flowering, and boll-forming stages) were studied by real-time fluorescence quantitative PCR (real-time PCR) and high throughput sequencing (Illumina MiSeq), respectively. The redundancy analysis (RDA) was used to determine the correlation between bacterial community structure and soil physicochemical properties. 【Result】There were different degrees of relevance between the occurrence of verticillium wilt and the ITS gene copy number of V. dahliae in soil. The incidence and disease index of susceptible variety EJ were positively correlated with the ITS gene copy number of V. dahliae, while those of resistant variety J863 were not significantly correlated with the ITS gene copy number of V. dahliae. The ITS gene copy number of V. dahliae in soil of resistant variety J863 was lower than that of susceptible variety EJ at late flowering and boll-forming stages. The high throughput sequencing analysis showed that the bacterial richness indices (Chao1 and ACE) of resistant variety J863 were higher than those of susceptible variety EJ at flowering and boll-forming stages. The principal component analysis showed that there were differences in soil bacterial community structure between resistant and susceptible varieties and at different flowering and boll stages. At phylum level, the average relative abundance of some dominant bacteria in susceptible variety EJ was lower than that of resistant variety J863, such as Actinobacteria, Gemmatimonadetes, Chloroflexi, Bacteroidetes, Nitrospirae, Patescibacteria, and Armatimonadetes, which was decreased by 16.38%, 4.05%, 2.25%, 6.58%, 7.10%, 20.60%, and 35.78%, respectively. At genus level, the average relative abundance of some dominant bacteria of susceptible variety EJ was lower than that of resistant variety J863, including Sphingomonas, Gemmatimonas, Bryobacter, Iamia, Pseudarthrobacter, Blastococcus, Rubrobacter, Nocardioides, Pontibacter, Streptomyces, Gemmatirosa, Micromonospora, and Solirubrobacter, which was decreased by 5.09%, 19.41%, 13.79%, 2.36%, 10.78%, 34.47%, 46.76%, 61.84%, 52.75%, 48.61%, 74.79%, 9.13%, and 26.42%, respectively. The redundancy analysis (RDA) showed that the bacterial community structure was affected by nitrate nitrogen (NO3 --N), available phosphorus (AP), ammonium nitrogen (NH4 +-N), inorganic phosphorus (IP), pH and organic matter (OM). 【Conclusion】The correlation between the ITS gene copy number of V. dahliae in soil and the occurrence of cotton verticillium wilt of susceptible and resistant varieties is different, and the incidence of verticillium wilt in susceptible variety is positively correlated with the ITS gene copy number of V. dahliae in soil. The bacterial community structure of resistant variety is better than susceptible variety at flowering, late flowering, and boll-forming stages. There are some differences in the dominant bacterial community at different growth stages. The diversity, relative abundance and composition of bacteria in soil are affected by organic matter, pH, nitrogen type and available phosphorus. Meanwhile, the growth stage of cotton had a significant influence on the bacterial community structure in soil.

    Molecular Characteristic and Pathogenicity Analyses of Cucumber green mottle mosaic virus (CGMMV) Infecting Bottle Gourd in Lianzhou, Guangdong
    LI ZhengGang,NONG Yuan,TANG YaFei,SHE XiaoMan,YU Lin,LAN GuoBing,DENG MingGuang,HE ZiFu
    Scientia Agricultura Sinica. 2020, 53(5):  955-964.  doi:10.3864/j.issn.0578-1752.2020.05.008
    Abstract ( 824 )   HTML ( 18 )   PDF (3715KB) ( 453 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】Cucumber green mottle mosaic virus (CGMMV) is one of the main viruses that infect melon crops, which causes great harm to the melon industry. The objective of this study is to identify the molecular characteristic and phylogenetic status of CGMMV-GDLZ isolate, analyze the pathogenicity of CGMMV-GDLZ isolate on cucumber, bottle gourd, and watermelon, and to provide a theoretical basis for the prevention and control of CGMMV. 【Method】Two symptomatic samples and one asymptomatic sample were collected from a farm located in Lianzhou City of Guangdong Province and were subjected to total RNA extraction. RT-PCR detection was performed using primer pair F: CCACGAGTTGTTTCCTAATGCTG/R: TTTGCTAGGCGTGATCGGATTGT, which was designed according to CGMMV reference genome (GenBank accession number KX883801). The annealing temperature is 53℃, and the product is 890 bp in length. To construct pCB301-CGMMV infectious cDNA clones, two primer pairs were designed to amplify the first half (1-3 511 nt) and the second half (3 301-6 423 nt) of the nucleotide sequence of CGMMV-GDLZ isolate. The primer pair used to amplify the first half is F: AAGTTCATTTCATTTGGA GAGGGTTTTAATTTTTATAATTAAACAAA/R: AGTTCTGCATTAATTGCTATTTGGTAGGCACAGTGGTAG, and the primer pair used to amplify the second half is F: GTGCGTGCTACCCCGACTCCAATAGGTTTGATTGCCCGTG/R: GGTGGAGATGC CATGCCGACCCTGGGCCCCTACCCGGGGAAAGG. Then the acquired products were cloned into pCB301 by homologous recombination, followed by Sanger DNA sequencing. Blast analysis was performed in NCBI using the full-length sequence of CGMMV-GDLZ isolate, then the phylogenetic tree was constructed by MEGA7 software using the sequences of CGMMV-GDLZ and other reported CGMMV isolates. Agrobacterium containing pCB301-CGMMV was infiltrated into Nicotiana benthamiana leaves to verify the infectivity of CGMMV-GDLZ isolate. Subsequently, pCB301-CGMMV was agroinfiltrated into the cotyledon of cucumber, bottle gourd, and watermelon to analyze the pathogenicity of CGMMV. 【Result】RT-PCR detection verified that the two symptomatic samples were infected by CGMMV. Sanger sequencing reveals that CGMMV-GDLZ isolate contains 6 423 nt and encodes four proteins, 129K replicase (61-3 495 nt), 186K replication-associated protein (61-5 007 nt), movement protein (4 994-5 788 nt), and coat protein (5 763-6 248 nt). CGMMV-GDLZ isolate has the highest nucleotide similarity (99.97%) with CGMMV-eWT isolate (GenBank accession number KY753928). Phylogenetic analysis showed that CGMMV-GDLZ and other CGMMV isolates from Japan and Korea were clustered into Group 1, and CGMMV-GDLZ was closest to isolates from Shandong, Zhejiang, and Henan. In addition, the pCB301-CGMMV infectious cDNA clones could successfully infect N. benthamiana, causing crinkle, mottle, and mosaic symptoms in the upper leaves. RT-PCR and Western blot detection further verified the infection of the infectious cDNA clones. Moreover, CGMMV-GDLZ isolate could also infect bottle gourd and watermelon, causing mottle, mosaic, and growth retardation at 15 days post-infiltration (dpi), and showed more severe symptoms at 24 dpi. However, the upper leaves of cucumber agro-infiltrated with pCB301-CGMMV did not show obvious symptoms compared with control plants. Further studies found the agro-infiltrated plants began to appear mottle and mosaic symptoms at 30 dpi after transferred from the greenhouse to artificial net-room without temperature control. The symptoms were more obvious at 40 dpi. RT-PCR and Western blot detection further verified the above results. 【Conclusion】CGMMV-GDLZ isolate from Lianzhou City of Guangdong Province may have the same infection source with CGMMV isolates from Shandong, Zhejiang, and Henan provinces. CGMMV-GDLZ isolate can infect N. benthamiana, cucumber, bottle gourd, and watermelon, but the pathogenicity varies in different crops.

    SOIL & FERTILIZER·WATER-SAVING IRRIGATION·AGROECOLOGY & ENVIRONMENT
    A Comparative Study Between China and Germany on the Control System for Agricultural Source Pollution
    ZHANG WeiLi,ZHANG RenLian,JI HongJie,KOLBE H,CHEN YinJun
    Scientia Agricultura Sinica. 2020, 53(5):  965-976.  doi:10.3864/j.issn.0578-1752.2020.05.009
    Abstract ( 585 )   HTML ( 23 )   PDF (466KB) ( 684 )   Save
    References | Related Articles | Metrics

    A lot of studies has demonstrated that preventing nitrogen and phosphorus from agricultural production into water and atmospheric environments has become one of the largest challenges facing modern agriculture. In order to understand status and problems existing in pollution control from agricultural sources in China, a comparative study between China and Germany on the control systems for agricultural source pollution was carried out. The relevant laws, regulations and technical standards issued by China and Germany were reviewed and summarized, and implementation effects of these regulations in recent years were compared. Study showed that similar to China, because of the short of per capita arable land resources in Germany, the family farm has been the main management form for agriculture in Germany. Farmers in Germany had always to face several problems, such as relatively small management scale, scattered fields, high risks and low profits, due to meteorological and marketing uncertainties. Financial subsidy by government has been essential to farmer’s surviving and agricultural development in Germany. Thus, attentions should always be paid not only on environmental objectives, but also on farmer’s interests, agricultural surviving and food security. In such conditions, main approach for agricultural source pollution control was to establish and running the control system and mechanisms with institutional guarantee, instead of simply adopting administrative punitive measures to farmers, such as closing, stopping, merging and turning over. For improving farmer’s knowledge and techniques of fertilization with the purpose to cut down fertilizer application amount, the most effective way was to design a complete quantitative criterions for best farmer’s fertilization practices with differentiated regions and classes’ specifications. These simple quantitative criterions were easy to be understood by farmers and applicable to soil and climate conditions in different regions. Subsequently, these quantitative criterions were easy to be disseminated and have contributed greatly in improving crop yield by decreased fertilizer application. For prevention of nitrogen and phosphorus releasing from agriculture into water and atmosphere, main measures in Germany were establishing and implementing a series of technical specifications with legal restriction and punishments, in which nitrogen input, nitrogen and phosphorus surplus of crop land, fertilizing seasons, fertilizing approach as well as crop rotations were clearly regulated. At the same time, new and more effective monitoring and management methods have been studied continuously in the purpose to enhance economic leverage’s role, to encourage and to help farmers for accepting more accurate and environmentally friendly technique alternatives. Through implementing agricultural source pollution control strategies, the fertilizer input of Germany has been reduced by 50% since the 1980s. The average fertilizer application amount in terms of farmland area (arable land area and long-term crop area) has been reduced from 404 kg·hm -2 to 192 kg·hm -2, which was 53% of the current value of China. In the same period, the average grain yield in Germany increased by 56%, from 4 779 kg·hm -2 to 7 464 kg·hm -2, which was about 37% higher than the current value of China. For improving farmer’s knowledge and techniques of fertilization with the purpose to cut down fertilizer application amount, the most effective approach was to design and complete a set of quantitative criterions for best farmer’s fertilization practices with differentiated regions and classes’ specifications. These simple quantitative criterions were easy to be understand by the farmers and applicable to soil and climate conditions in different regions. Subsequently, these quantitative criterions were easy to be disseminated and played important role in improving farmers' fertilization techniques and increasing crop yield continuously by decreased fertilizer amount. Up to now, there has been a lack of quantitative criterions for best fertilization practices designed for farmers in China, which were suitable for farmers' cognition and direct use. Also, there has been no technical specifications related to the national and local government's reward and punishment policies issued. Whether in nationwide or in a watershed case, it was still difficult to operate agricultural source pollution control with institutional guarantee. The area of vegetable, fruit, flowers and other cash crops accounted for 23.6% of the total cropping area in China, which was very common for farmers to apply fertilizer blindly or excessively. In such crop field, the nitrogen and phosphorus nutrient surplus far exceeds the environmental safety limit (50 kg N·hm -2, 10 kg P2O5·hm -2) given by German fertilizer regulations. Up to now, there has been a lack of quantitative criterions for the best fertilization practices designed for farmers in China, which were suitable for farmers' cognition and direct use. Also, there has been no technical specifications issued, which was related to the state or local government's reward and punishment policies for environment protection. Whether in nationwide or in a watershed case, it was still difficult to operate agricultural source pollution control with institutional guarantee. Analysis showed that the core for agricultural source pollution control was to issue and implement relevant laws, regulations, technical standards and monitoring methods by innovative research works. In recent years, however, the concerning research work has been weakened up due to homogenization and fragmentation of the research institutions, who are originally specialized for applied research works for soil and fertilization. Also, the quantitative evaluation system for scientific contribution and the excessive dependence on papers with high SCI-index has negative influences on the researches for practical use. This needs to be improved urgently.

    Effects of Different Straw Returning Depths on Soil Greenhouse Gas Emission and Maize Yield
    ZHU XiaoQing,AN Jing,MA Ling,CHEN SongLing,LI JiaQi,ZOU HongTao,ZHANG YuLong
    Scientia Agricultura Sinica. 2020, 53(5):  977-989.  doi:10.3864/j.issn.0578-1752.2020.05.010
    Abstract ( 1429 )   HTML ( 47 )   PDF (526KB) ( 823 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】 Straw returning is an important technical means to improve soil fertility, increase soil organic matter and improve soil structure. However, previous studies have shown that straw returning can accelerate the emission of greenhouse gases in soil and increase greenhouse effect. Through the study of greenhouse gas emission characteristics and maize yield of farmland soil under different straw returning depths, the optimum returning depths were determined in this study, in order to provide scientific basis for rational utilization of straw, increase crop yield and realize sustainable agricultural development. 【Method】 In the field micro-plot experiment, maize was used as the test crop, and four returning depths were set up, which were 0-10 cm (T1), 10-20 cm (T2), 20-30 cm (T3) and 30-40 cm (T4), respectively. At the same time, the non-returning treatment was used as the control (CK), with a total of five treatments. Static box-gas chromatography was used to determine the greenhouse gases (CO2, CH4, N2O) emission characteristics under different returning depths in whole maize growing season, and yield and yield components at maturity were measured. 【Result】 (1) During the whole maize growing season, both CO2 and N2O showed emission, but CH4 showed absorption. The cumulative emission of CO2 was the highest under T3 treatment, which increased by 28.6% significantly compared with CK. The increase rate of cumulative emission of CO2 under T4 treatment was the least, which was significantly increased by 17.1% compared with CK (P<0.05), but the difference between T1 and T4 treatment was not significant; the cumulative emission of N2O was the highest under T2 treatment. Compared with CK, the cumulative amount of N2O increased significantly by 111.3%, the increase rate under T4 treatment was the least, and the CK increased significantly by 12.8% (P<0.05). However, CH4 showed absorption, and the absorption capacity of CH4 in farmland soil was reduced after straw returning; the absorption capacity was CK treatment>T4 treatment>T1 treatment>T3 treatment>T2 treatment, and there were significant differences between treatments and CK (P<0.05). (2) Compared with the control, the yield of maize in each treatment increased significantly, and the yield increased by 5.6%-20.8% (P<0.05). However, there were no significant difference in ear length, ear diameter and grain number between treatments. When the straw returned to 30-40 cm, the yield was the highest, which increased by 20.76% than that under CK, and it indicated that straw returning had an important effect on improving soil fertility and increasing crop yield. (3) According to the comprehensive greenhouse gas effect (GWP) and greenhouse gas emission intensity (GHGI), on the scale of 100 years, GWP showed T2 treatment>T3 treatment>T1 treatment>T4 treatment>CK treatment, while GHGI showed T2 treatment>T3 treatment>T1 treatment>CK treatment>T4 treatment. Compared with CK, all treatments increased the comprehensive greenhouse gas effect, while T4 treatment reduced greenhouse gas emission intensity in maize season, indicating that straw returning to 30-40 cm could alleviate the global warming trend to a certain extent. 【Conclusion】 Straw returning could increase CO2 and N2O emissions significantly, but increase the absorption capacity of CH4. The straw returning to 30-40 cm could reduce the global warming potential and the intensity of greenhouse gas emissions, and increase the maize yield significantly. Therefore, in order to simultaneously achieve higher maize yield and lower greenhouse gas emission intensity, straw returning to 30-40 cm was a more reasonable way of soil improvement and fertilization.

    The Influences of Different Nitrogen and Salt Levels Interactions on Fluorescence Characteristics, Yield and Quality of Processed Tomato Under Drip Irrigation
    ZHANG JiFeng,WANG ZhenHua,ZHANG JinZhu,DOU YunQing,HOU YuSheng
    Scientia Agricultura Sinica. 2020, 53(5):  990-1003.  doi:10.3864/j.issn.0578-1752.2020.05.011
    Abstract ( 570 )   HTML ( 19 )   PDF (2628KB) ( 490 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】Xinjiang has the largest area of saline-alkali land and planting base of processed tomatoes in China. In this paper, a two-year experiment in Xinjiang was carried to study the effects of different soil salinity and nitrogen application rate on the growth, physiological, yield and quality of processed tomato, and to obtain the rational nitrogen application rate and soil salinity range of processed tomato suitable for planting saline land in Xinjiang, so as to provide a scientific theoretical basis and technical approach for expanding tomato planting area and rational nitrogen application in Xinjiang. 【Method】This study was carried out in the Key Experimental Base of Modern Water-saving Irrigation Corps of Shihezi University in 2017 and 2018. The local main tomato cultivar “3166” was taken as the experimental material. This experiment was set in four levels of soil salinity: 1.5, 4.0, 7.0 and 10.0 g·kg -1 and four levels of nitrogen: 201, 166, 131 and 96 kg N·hm -2 in 2017. Based on the experiment in 2017, a soil salinity of 10.0 g·kg -1 were removed and a soil salinity of 5.0 g·kg -1 and a nitrogen application rate of 0 were added in 2018. The chlorophyll fluorescence parameters, yield and quality of processed tomatoes were analyzed. 【Result】Our results indicated that under the interaction of nitrogen and soil salinity, the fluorescence parameter and yield of processed tomatoes showed a complex change. Firstly, most of the fluorescence parameters and yields were more dominated by soil salt than nitrogen. At the same nitrogen level, soil salinity of 7.0 g·kg -1 and 10.0 g·kg -1 inhibited the fluorescence index of processed tomatoes mostly. At low salinity level, medium and high nitrogen application of 166 kg N·hm -2 promoted the fluorescence index of processed tomatoes the most, followed by 201 kg N·hm -2, and the worst was 131 kg N·hm -2. At medium and high salt level, 96 kg N·hm -2 had the best promotion degree for processed tomato, followed by no nitrogen level. At the high salt application rate, low nitrogen treatment was better than the high nitrogen treatment to improve tomato yield. The fresh fruit yield of processed tomato was generally consistent with the law of “the higher the salt, the lower the yield”. The yield of low-nitrogen and high-salt treatment was significantly higher than other yields with same salinity levels of different nitrogen. Moreover, it was found that salinity had a stronger effect on tomato quality than nitrogen. Soluble solids, VC, soluble sugar and titratable acid increased gradually with the increase of soil salt content. The maximum sugar-acid ratio appeared in low salinity treatment. Moreover, it was found that salinity had a stronger effect on tomato quality than nitrogen, and the interaction between them had no significant effect on the quality of processed tomatoes. Summary by analysis, the reasonable range of nitrogen application and soil salinity content of processed tomato were obtained. 【Conclusion】In the soil with high salinity, the yield of processed tomatoes could be increased by applying a small amount of nitrogen. The reasonable range of nitrogen application and the range of soil salt content for the relative optimal yield and quality of processed tomatoes were N: 98.12-119.60 kg·hm -2, S: 3.57-5.58 g·kg -1.

    HORTICULTURE
    Identification, Systematic Evolution and Expression Analysis of HD-Zip Gene Family in Capsicum annuum
    SHAO ChenBing,HUANG ZhiNan,BAI XueYing,WANG YunPeng,DUAN WeiKe
    Scientia Agricultura Sinica. 2020, 53(5):  1004-1017.  doi:10.3864/j.issn.0578-1752.2020.05.012
    Abstract ( 1126 )   HTML ( 72 )   PDF (10281KB) ( 957 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】The objectives of this research were to identify the Homeodomain-Leucine Zipper (HD-Zip) family genes from pepper (Capsicum annuum) genome, to know the profile of HD-Zip family such as gene number, gene distribution, gene structure, evolutionary process and expression patterns in different tissues, and to provide theoretical basis for exploring what roles the HD-Zips play in pepper. 【Method】HD-Zip genes in pepper genome were identified by BLAST software based on HD-Zip from Arabidopsis, and verified by Pfam and SMART software. EMBOSS Programs, MEGA, GSDS, MEME, MCScanX, OrthoMCL and Circos softwares were used for bioinformatics analysis of HD-Zip protein and gene sequences. Expression patterns and gene co-regulatory network were analyzed by R and Cytoscape software. 【Result】Total of 42 HD-Zip genes were identified from ‘Zunla-1’ pepper genome, named as CaHDZ01-CaHDZ42. The length of their coding sequences ranged from 459 to 2 529 bps, and the isoelectric point of 70% CaHDZs was less than 7.0. The analysis of the gene’s location on the chromosome revealed that CaHDZs were unevenly distributed on 12 chromosomes of the pepper, except for CaHDZ42. The gene family could be divided into four subgroups, containing 18, 9, 5 and 10 CaHDZ genes, respectively. There were significant differences in gene structure and protein conserved domains among the subgroups. The number of orthologs among pepper, tomato and Arabidopsis was almost the same, but there were a little more orthologs between pepper and tomato. While the number of paralogs in Arabidopsis was significantly more than that in tomato and pepper, and the least in pepper, suggesting that the number of CaHDZ genes did not increase significantly along with genomic replication. To further understand the evolutionary history of CaHDZs in plant, HD-Zip homologous genes in Arabidopsis and 8 other plant species were analyzed. The results showed that all the major subgroups of HD-Zips existed in angiosperms. It was inferred that HD-Zip genes were divided into two groups initially. Then, one group differentiated into subgroup I and II, and the other differentiated into subgroups III and IV. The results of expression patterns analysis showed that the expression trends of four subgroups were different. Most of subgroup I genes expressed highly in pepper, such as CaHDZ22, and the expression of which was highest in stem, suggesting that this gene might play an important role in the growth of pepper stem. The expressions of subgroups II, III and IV CaHDZs were relatively low, but some of them expressed highly in specific tissues. For example, the expression of CaHDZ34 was high in late ripening stage of pepper fruits, CaHDZ02 and CaHDZ28 expressed highly in fruit enlargement stage, and CaHDZ04 expressed highly in early ripening stage of pepper fruits. In the coregulatory networks of CaHDZs, the Pearson correlation coefficients (PCCs) of 33 pairs of CaHDZs were greater than 0.8, and 6 pairs were greater than 0.9, suggesting that the CaHDZs coordinated the growth and development in pepper, and there were cooperative interactions among subgroups. 【Conclusion】All of 42 HD-Zip gene family members were identified from the ‘Zunla-1’ pepper genome, which could be divided into four subgroups. During the evolutionary history, CaHDZs were highly conservative and expanded slowly. Subgroup I and subgroup II had a closer relationship, so did subgroup III and subgroup IV. CaHDZ genes expressed specifically in different tissues and coordinately regulated the growth and development of pepper.

    Effects of Wheat Root Exudates on the Structure of Fungi Community in Continuous Cropping Watermelon Soil
    TIAN Qing,GAO DanMei,LI Hui,LIU ShouWei,ZHOU XinGang,WU FengZhi
    Scientia Agricultura Sinica. 2020, 53(5):  1018-1028.  doi:10.3864/j.issn.0578-1752.2020.05.013
    Abstract ( 683 )   HTML ( 43 )   PDF (611KB) ( 844 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】 The aim of this paper was to study the effects of wheat root exudates on specific microflora, fungal community structure and diversity in watermelon continuous cropping soils, which was of great theoretical significance to find out the effects of root exudates on the improvement of soil microbial environment, the ecological control of watermelon wilt and the healthy maintenance of vegetable soil. 【Method】 In this experiment, the continuous cropping of watermelon for three years was used as the research object. The effects of wheat root exudates on the structure and diversity of fungal community in watermelon continuous cropping soil were studied by soil culture experiment. 【Result】Re-time PCR results showed that exogenously added wheat root exudates reduced the abundance of total fungal, Fusarium spp. and Fusarium oxysporum f. sp. niveum, but the abundance of Trichoderma spp. was increased in the soils with and without watermelon seedlings. Moreover, the abundance of Trichoderma spp. was the highest under the treatment with watermelon seedlings and exogenous addition of wheat root exudates, but the abundance of Fusarium spp. was the lowest. Trichoderma spp. treated with no watermelon seedlings and added with deionized water solution had the lowest abundance, while Fusarium oxysporum had the highest abundance. At the phylum level, exogenous addition of wheat root exudates increased the relative abundance of Chytridiomycota in the watermelon soils, but reduced the relative abundances of Zygomycota and Basidiomycota in the soils with and without watermelon seedlings. At the genus level, exogenous addition of wheat root exudates increased the relative abundances of Chaetomium and Acremonium spp. in the soils with and without watermelon seedlings, whose species could have pathogen-antagonistic and/or plant-growth-promoting effects. However, exogenously addition wheat root exudates decreased the relative abundances of Fusarium and Humicola spp. in the soils with and without watermelon seedlings, which contained the species that could cause plant pathogens. 【Conclusion】Overall, our results showed that, the change of fungal community in watermelon soil caused by wheat root exudates was one of the reasons why wheat/watermelon slowed down watermelon disease.

    FOOD SCIENCE AND ENGINEERING
    Research Progress of Four Sulfur Compounds Related to Red Wine Flavor
    ZHANG QingAn,CHEN BoYu
    Scientia Agricultura Sinica. 2020, 53(5):  1029-1045.  doi:10.3864/j.issn.0578-1752.2020.05.014
    Abstract ( 855 )   HTML ( 32 )   PDF (678KB) ( 836 )   Save
    Figures and Tables | References | Related Articles | Metrics

    Sulfur compounds in wines such as glutathione, thiol, hydrogen sulfide and sulfur dioxide are the important flavor compounds, and their content and existing forms greatly affect the wine flavor. The four sulfur compounds are investigated based on the origin and analysis method as well as the winemaking process, while the results on the above aspects are not in agreement in many studies. In this paper, the research progress was summarized about the content, form, origin, analysis method, evolution during storage, and controlling means of the four sulfur compounds in wine. In terms of content and form, the glutathione mainly existed in the reduced form of GSH, and its content was no more than 70 mg?L -1. Thiol might exist in the free form or combined with metal ions, and its content depended on the specific form ranging from ng?L -1 to μg?L -1. Hydrogen sulfide mainly existed in binding state and easily binds to metal ions, and its total content was no more than 30 μg?L -1. Sulfur dioxide often existed in the form of gas or bisulfite (H2SO3 - ) or binds to the carbonyl compounds, and its total content ranged from 64.8 mg?L -1 to 166.5 mg?L -1. In terms of the origin, these four kinds of sulfur compounds were all related to the microorganisms’ metabolic activities during fermentation. To be specific, the glutathione mainly came from the un-fermented grape juice, and a small part came from the amino acid metabolism. Thiol was mainly from the metabolism of the sulfur amino acid and glutathione as well as the chemical synthesis with the hydrogen sulfide as substrate. Hydrogen sulfide mainly came from the sulfur amino acid metabolism, sulfates and sulfites. Sulfur dioxide came from the exogenous additives and the sulfate metabolism. In terms of analysis method, chemical or spectroscopy method was often used, which could be detected quickly to a certain extent, but causing a large error. Regarding the chromatography technique, it had a higher accuracy, but the sample preparation was complicated and the instrument was expensive. The Fenton reaction, i.e. the oxidation initiated by the oxygen and transition metal ions such as iron and copper ion might significantly affect the contents of thiol and hydrogen sulfide during the storage of wine. Finally, to reduce the unpleasant odor caused by some sulfur compounds, some measures could be conducted including optimizing the quality of grape and must, screening the beneficial yeast strains, improving sulfur dioxide addition process and adding metal salts. In conclusion, future researches could be focused on optimizing the detection method, exploring the changing mechanism of the four kinds of sulfur compounds during fermentation and storage, and improving the wine-making process, so as to provide a reference for the winery.

    Effects of Heat Stress on Cell Membrane and Membrane Protein of Escherichia coli
    ZHANG AiJing,LI LinQiong,WANG PengJie,GAO YuLong
    Scientia Agricultura Sinica. 2020, 53(5):  1046-1057.  doi:10.3864/j.issn.0578-1752.2020.05.015
    Abstract ( 795 )   HTML ( 17 )   PDF (3643KB) ( 682 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】Effects of heat stress on cell membrane and membrane protein of Escherichia coli were investigated with ATCC43889 as the test microorganism in this work, which would provide a theoretical basis for the application of high temperature sterilization technology in the food industry. 【Method】 The changes of the cell membrane and membrane protein for three heat-resistant ATCC43889 strains which were treated with 10 times of heat stress treatments at 50℃, 60℃, and 70℃ for 15 min, transferred into TSB and incubated again were studied, respectively. The morphologic changes of original control strain and the three heat-resistant strains of ATCC43889 were observed using scanning electron microscopy. The biofilm-forming ability for each strain was determined using a 96-well microplate method. The changes and differences of cell membrane fatty acid composition for each strain were monitored using gas chromatography. The changes of phase transition temperature of cell membrane phospholipid for each strain were measured using differential scanning calorimetry (DSC). The changes of outer membrane protein expression for each strain were examined using sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE). 【Result】 The experimental results showed that the individual morphology of ATCC43889 changed evidently after 10 times of heat stress treatments at 50℃, 60℃, and 70℃, transfers and incubation again, respectively. The individual morphology for a part of the cells changed from spheroids to long rods after heat stress treatment at 50℃. The individual morphology of the cells upon heat stress treatment at 60℃ was thinner and longer than that of the cells upon heat stress treatment at 50℃. Upon heat stress treatment at 70℃, most of the cells became longer rods, a large number of cells gathered together, and the surface of the cells was irregular and uneven. The vitality and ability of biofilm-forming for the three heat-resistant ATCC43889 strains enhanced with increasing heat stress temperature. The ability of biofilm-forming for the three ATCC43889 heat-resistant strains significantly (P<0.05) differ from that of the control group, while the ability of biofilm-forming for the heat-resistant strain at 60℃ was not significantly (P>0.05) different from that of the heat-resistant strain at 70℃. Among the fatty acids identified, three fatty acids were absent after 10 times of heat stress treatments at 50℃, 60℃ and 70℃ compared to the original control strain, which were C18:1n9c, C18:3n3, and C21:0, respectively. The amount of saturated fatty acid such as C13:0, C16:0, C17:0 and their total amounts increased, while the amount of unsaturated fatty acid such as C14:1, C16:1, C17:1, C18:1n9t, C18:2n6t and their total amounts in the cell membrane for the three heat-resistant strains decreased with the increase of heat stress temperature. The ratio of saturated to unsaturated fatty acids (SFA/USFA), the melting point (Tm) and the phase transition temperature of cell membrane phospholipids increased as the heat stress temperature increased. These changes in membrane fatty acid composition and the phase transition temperature of cell membrane phospholipids resulted in decreased membrane fluidity of the three heat-resistant strains. The protein band color of molecular weight about 63 and 75 kD deepened with the increase of heat stress temperature. The increase of heat-resistance for the two heat-resistant strains after 10 times of heat stress treatments at 60℃ and 70℃ was accompanied by synthesis of specific outer membrane proteins of molecular weight about 48 to 75 kD. These results indicated that synthesis and increased amounts of some specific outer membrane proteins could induce heat-resistance for E. coli ATCC43889. 【Conclusion】The longer individual morphology, the enhanced ability of biofilm-forming, the increased ratio of saturated to unsaturated fatty acids, the increased phase transition temperature of cell membrane phospholipid and the increased expression of some outer membrane proteins correlated with the greater heat-resistance of E. coli ATCC43889. These changes contributed to the adaptation of ATCC43889 to heat stress environment and improvement of cellular survival viability.

    ANIMAL SCIENCE·VETERINARY SCIENCE·RESOURCE INSECT
    Eukaryotic Expression, Purification and Biological Activity of Recombinant Cervus Nippon Activin A Protein
    ZHANG YuFei,CAO ManYuan,WANG LiYing,ZHAO WeiGang,LI XiaoXia,CHANG Tong,XU BaoZeng
    Scientia Agricultura Sinica. 2020, 53(5):  1058-1070.  doi:10.3864/j.issn.0578-1752.2020.05.016
    Abstract ( 833 )   HTML ( 14 )   PDF (2223KB) ( 984 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】The objective of this study was to investigate the eukaryotic expression and biological activity of recombinant Cervus Nippon Activin A protein, which would provide an experimental basis for further clarification on the physiological function of Activin A in the maturation of the oocytes of Cervus Nippon. 【Method】 The full length cDNA of Activin βA (ACTBA) gene was acquired by RT-PCR (Reverse Transcription-Polymerase Chain Reaction) technology. Bioinformatics tools were used to determine the characteristics of Activin βA sequence. The homologous sequences of Activin βA from other species were downloaded from NCBI, the deduced amino acid sequence of Activin βA was aligned by using the Clustal X (1.83) software, and the phylogenetic tree was constructed by using MEGA 4. Recombinant plasmids of pcDNA4/ACTBA were constructed, and then transfected into CHO cells to express target proteins in vitro. Target proteins were detected by Immunofluorescence technology and Western blot technology, and then purified by Ni-NTA affinity chromatography column. The effects of the treatment of purified Cervus Nippon Activin A on the phosphorylation of SMAD2 and SMAD3 proteins in porcine granulosa cells were investigated through Western blot, as well as the expression levels of steroid hormone-related enzymes in porcine granulosa cells treated with recombinant Cervus Nippon Activin A were detected by real-time PCR and Western blot. 【Result】 The Cervus Nippon Activin A was cloned, which contained 1 278 bp, encoding 426 amino acids. The homology comparison showed that the sequence of ACTBA gene in Cervus Nippon had the highest 98.4% identity with that in cattle. Phylogenetic analysis showed that it had the closest relationship with that in Bos taurus and Capra hircus. The data through endonuclease digestion, PCR and DNA sequencing showed the eukaryotic expression plasmid was constructed successfully. Immunofluorescent results showed that this plasmid expressed in CHO cells successfully, and Activin A protein mainly presented in the cytoplasm of CHO cells. Western blot data showed that the protein molecular weight of precursor Activin A was about 58 kD. Treatment with the purified recombinant mature Activin A through nickel affinity chromatography triggered the phosphorylation of SMAD2 and SMAD3 proteins in porcine granulosa cells, indicating that the functional Activin A could activate the SMAD signaling pathway. Treatment of primary porcine granulosa cells with mature Activin A increased the mRNA and protein levels of P450 aromatase and decreased the mRNA and protein levels of steroidogenic acute regulatory protein (StAR). Meanwhile, the treatment of mature Activin A also enhanced FSHR mRNA levels and decreased LHR mRNA levels in primary pig granulosa cells. Whereas it did not alter the mRNA levels of P450 side chain cleavage enzyme and 3β-hydroxysteroid dehydrogenase in porcine granulosa cells. Thus, the recombinant protein of Cervus Nippon Activin A could enhance the biological effects of FSH in granulosa cells, and attenuate biofunctions of LH in granulosa cells. 【Conclusion】 The eukaryotic expression vector of Activin A protein was successfully constructed in our study. The recombinant Activin A protein had high purity and bioactivity, which provided a foundation for further study of the biological functions and physiological mechanisms of Activin A.

    Development of High Sensitive Zeranol Monoclonal Antibody Based on the Cross Reactivity of Structural Analogs
    HU XiaoFei,LI QingMei,YAO JingJing,HU SiYu,SUN YaNing,XING YunRui,DENG RuiGuang,ZHANG GaiPing
    Scientia Agricultura Sinica. 2020, 53(5):  1071-1080.  doi:10.3864/j.issn.0578-1752.2020.05.017
    Abstract ( 578 )   HTML ( 18 )   PDF (696KB) ( 621 )   Save
    Figures and Tables | References | Related Articles | Metrics

    【Objective】The aim of this study was to obtain highly sensitive monoclonal antibody of Zearalanol (ZAL). 【Method】Zearalanone (ZAN), as the structural analogs of ZAL, was employed to synthesize the artificial complete antigen. ZAN structure was modified by oximation reaction to obtain ZNA-O. ZAN-O was coupled with bovine serum albumin and ovalbumin by 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC) respectively to prepare ZAN-O-BSA and ZAN-O-OVA. ZAN-O-BSA was used to immunize the mice with the immune dose of 50 μg protein/mouse. The mouse with higher serum titer and sensitivity was selected for cell fusion. During the process of cell fusion to screen the positive hybridoma cells, ZAL was used as a blocker instead of ZAN to screen the hybridoma cell lines that could secrete monoclonal antibody against ZAL. ZAL monoclonal antibody was prepared in batches by ascites induction in vivo, and the immunological properties of the monoclonal antibodies were identified. 【Result】By cell fusion and screening for positive hybridoma cell lines, one hybridoma cell line named 12B10A7 that could secrete monoclonal antibody against ZAL was obtained. The sensitivity (half inhibitory concentration, IC50) of the prepared monoclonal antibody was 577 pg?mL -1, the affinity constant Ka was 6.21×10 7 L?mol -1, the cross-reactivity rate with structural analogues such as β-zearalanol, α-zearalenol, β-zearalenol, zearalanone and zearalenone were 43.06%, 15.51%, 15.22%, 77.65% and 9.79%, respectively, and the cross reaction rates with other toxins and carrier proteins were all less than 0.06%. 【Conclusion】In conclusion, based on the cross reaction characteristics of antibody, in this study, we prepared the artificial antigen of ZAN, and got the monoclonal antibody against ZAL, which had high affinity, sensitivity and specificity.