Scientia Agricultura Sinica ›› 2023, Vol. 56 ›› Issue (16): 3226-3236.doi: 10.3864/j.issn.0578-1752.2023.16.014

• ANIMAL SCIENCE·VETERINARY SCIENCE • Previous Articles     Next Articles

Isolation and Pathogenicity of Fowl Adenovirus Serotype 8a Strain

LI HuiXin(), SONG WenPing, HAN ZongXi, LIU ShengWang()   

  1. Harbin Veterinary Research Institute, Chinese Academy of Agricultural Sciences/State Key Laboratory for Animal Disease Control and Prevention, Harbin 150069
  • Received:2022-06-21 Accepted:2022-08-28 Online:2023-08-16 Published:2023-08-18

Abstract:

【Objective】 Fowl adenovirus (FAdV) circulates in chicken flocks with multiple serotypes, while there is less information about the pathogenicity of all serotype strains. To understand the capability of causing disease as a primary pathogen to chicken of the FAdV-8a strain, we carry out the experiment for evaluating the pathogenic characteristics of this serotype strain, which will help making the control strategy for breeding. 【Method】 In 2017, liver tissue was collected form the diseased flocks. The liver tissue homogenates were inoculated into the embryo egg for isolating the virus. The isolate was determined as a FAdV strain after PCR detection. To classify the isolate, genomic sequencing and the genetic evolution based on the complete genome sequence and the hexon gene sequence were performed. To clarify the pathogenicity, thirty 10-day-old SPF chicks were randomly divided into 2 groups and exposed to the isolate JL/170408 via nasal inhalation and eye droppings. The clinical syndrome (including morbidity and mortality), viremia, virus shedding, circulating antibody, postmortem examination and histopathological detection at 5 days post infection (d.p.i.), viral distribution and the tropism on tissues were performed to evaluate the pathogenic capability and characteristics of JL/170408 to SPF chicks. 【Result】 The complete genome sequencing showed that there were the highest identity between the isolate and the FAdV-8a TR59 strain. They showed high identity in the genomic structure and the encoding gene. Phylogenetic analysis based on the complete genome sequence, the isolate JL/170408 was in the cluster of FAdV-E, further was grouped into the branch of serotype 8a based on the hexon gene. Consequently, the isolate JL/170408 was determined as FAdV-8a serotype within the species of FAdV-E. The clinical peak was observed from 3 to 13 d.p.i. without death. The virus shedding and viremia was detected as early as 3 d.p.i. and last for a long period at least 51d, the antibody was not positive conversion completely and the mean ELISA titer S/P<1, which didn’t provide enough neutralizing ability to eliminate the virus in the blood and the intestinal tract. At 54 d.p.i., the ELISA titer reached a peak with a mean S/P>2, with the consequence of viremia disappearing and a sudden drop of virus shedding. Postmortem examination and histopathological detection at 5 d.p.i. showed no obvious pathologic change. While the viral load was detected in 15 tissues, suggested that the isolate propagated in multiple tissues and exhibited higher tropism to gizzard. By monitoring the circulating antibody, the infected birds showed later antibody positive conversion until 15 d post infection. Not all birds showed positive seroconversion even at 51 d post infection, and the antibody level was stable. At 54 d post infection, the antibody titer reached peak, suggesting that birds may suffer a second infection. Virus neutralization test based on the antiserum of 63 d.p.i. showed that there was no obvious correlation between the circulating antibody and the neutralization antibody. 【Conclusion】 The FAdV-8a strain JL/170408 causes disease to 10-day-old chicks as single pathogen without leading to death, the isolate is determined as low pathogenic strain. JL/170408 propagates in multiple tissues with higher tropism to gizzard. The infected chicks show a long duration of virus shedding with a repetitive characteristics.

Key words: fowl adenovirus, serotype 8a, genomic characteristic, pathogenicity

Table 1

Universal primers used for FAdV detection and the type-specific fluorescence quantitative PCR primers for FAdV-8a"

上游引物(5′-3′) Forward primer (5′-3′) 下游引物(5′-3′) Reverse primer (5′-3′) 序列位置a Nucleotide positiona
HF2: CCARATGGCSACSAACTACAA HR2: TVGCGAAAGGCGTACGGAAG 22444-23042
8aF: AAAGGCGCGGAGCTGACGG 8aR: TGGGGTCCACGTTATCGGTTTC 21443-21629

Table 2

Viremia and virus shedding of the infected chicks"

攻毒后天数
Days post infection
口咽拭子
Oropharyngeal swabs
泄殖腔拭子
Cloacal swab
病毒血症
Viremia
3 10/10(100%) 10/10(100%) 6/10(60%)
6 10/10(100%) 10/10(100%) 9/10(90%)
9 10/10(100%) 10/10(100%) 10/10(100%)
12 10/10(100%) 10/10(100%) 10/10(100%)
15 10/10(100%) 9/10(90%) 9/10(90%)
18 9/10(90%) 8/10(80%) 9/10(90%)
21 10/10(100%) 10/10(100%) 9/10(90%)
24 7/10(70%) 9/10(90%) 4/10(40%)
27 8/10(80%) 10/10(100%) 6/10(60%)
30 10/10(100%) 10/10(100%) 7/10(70%)
33 9/10(90%) 10/10(100%) 6/10(60%)
36 6/10(60%) 9/10(90%) 9/10(90%)
39 9/10(90%) 7/10(70%) 10/10(100%)
42 7/10(70%) 9/10(90%) 8/10(80%)
45 5/10(50%) 7/10(70%) 8/10(80%)
48 1/10(10%) 2/10(20%) 4/10(40%)
51 3/10(30%) 6/10(60%) 6/10(60%)
54 1/10(10%) 3/10(30%) 0/10(0)
57 2/10(30%) 2/10(40%) 0/10(0)
60 1/10(10%) 2/10(20%) 0/10(0)
63 1/10(10%) 1/10(10%) 0/10(0)

Fig. 1

Phylogenetic analysis of isolate JL/170408 A: Phylogenetic analysis based on the complete genome sequence of the isolate and the reference strains; B: Phylogenetic analysis based on the hexon gene of the isolate and the reference strains in species of FAdV-E"

Fig. 2

Clinical scores of the infected chicks (n=10)"

Fig. 3

The histopathology detection of the chicks infected by JL/170408 (bar= 100 μm) A: Gross lesion at 5 days postinfection; B: Histopathological examination at 5 days postinfection"

Fig. 4

The distribution of the virus in the tissues of infected chicks and the viral load in the corresponding tissues"

Fig. 5

The ELISA antibody dynamic of chicks infected by JL/170408 (n=10)"

Fig. 6

ELISA antibody and neutralization antibody titer of chicks at 63 d post infection (n=10) A: ELISA antibody of each bird at 63 d.p.i., ELISA titer≥1071 is determined as positive; B: Neutralization antibody of each bird at 63 d.p.i."

[1]
ADAIR B M, FITZGERALD S D. Wiley- Blackwell, Hoboken NJ. Group I adenovirus infections. In: Diseases of poultry, 12th ed. SAIF Y M, FADLY A M, GLISSON J R, MCDOUGALD L R, NOLAN L K, SWAYNE D E, eds. Wiley- Blackwell, Hoboken, NJ. 2008: 252-266.
[2]
HESS M. Detection and differentiation of avian adenoviruses: a review. Avian Pathology, 2000, 29(3): 195-206.

doi: 10.1080/03079450050045440 pmid: 19184805
[3]
GRIFFIN B D, NAGY É. Coding potential and transcript analysis of fowl adenovirus 4: insight into upstream ORFs as common sequence features in adenoviral transcripts. The Journal of General Virology, 2011, 92(6): 1260-1272.

doi: 10.1099/vir.0.030064-0
[4]
MAREK A, NOLTE V, SCHACHNER A, BERGER E, SCHLÖTTERER C, HESS M. Two fiber genes of nearly equal lengths are a common and distinctive feature of Fowl adenovirus C members. Veterinary Microbiology, 2012, 156(3/4): 411-417.

doi: 10.1016/j.vetmic.2011.11.003
[5]
ZHAO J, ZHONG Q, ZHAO Y, HU Y X, ZHANG G Z. Pathogenicity and complete genome characterization of fowl adenoviruses isolated from chickens associated with inclusion body hepatitis and hydropericardium syndrome in China. PLoS ONE, 2015, 10(7): e0133073.
[6]
HELMBOLDT C F, FRAZIER M N. Avian hepatic inclusion bodies of unknown significance. Avian Diseases, 1963, 7(4): 446-450.

pmid: 5896495
[7]
GOMIS S, GOODHOPE A R, OJKIC A D, WILLSON P. Inclusion body hepatitis as a primary disease in broilers in Saskatchewan, Canada. Avian Diseases, 2006, 50(4): 550-555.

doi: 10.1637/7577-040106R.1 pmid: 17274293
[8]
DAR A, GOMIS S, SHIRLEY I, MUTWIRI G, BROWNLIE R, POTTER A, GERDTS V, TIKOO S K. Pathotypic and molecular characterization of a fowl adenovirus associated with inclusion body hepatitis in Saskatchewan chickens. Avian Diseases, 2012, 56(1): 73-81.

pmid: 22545531
[9]
MITTAL D, JINDAL N, TIWARI A K, KHOKHAR R S. Characterization of fowl adenoviruses associated with hydropericardium syndrome and inclusion body hepatitis in broiler chickens. Virusdisease, 2014, 25(1): 114-119.

doi: 10.1007/s13337-013-0183-7 pmid: 24426318
[10]
HOFFMANN R, WESSLING E, DORN P, DANGSCHAT H. Lesions in chickens with spontaneous or experimental infectious hepato- myelopoietic disease (inclusion body hepatitis) in Germany. Avian Diseases, 1975, 19(2): 224-236.

doi: 10.2307/1588976
[11]
FADLY A M, WINTERFIELD R W. Isolation and some characteristics of an agent associated with inclusion body hepatitis, hemorrhages, and aplastic anemia in chickens. Avian Diseases, 1973, 17(1): 182-193.

pmid: 4633275
[12]
STEER P, O'ROURKE D, GHORASHI S, NOORMOHAMMADI A. Application of high-resolution melting curve analysis for typing of fowl adenoviruses in field cases of inclusion body hepatitis. Australian Veterinary Journal, 2011, 89(5): 184-192.

doi: 10.1111/j.1751-0813.2011.00695.x pmid: 21495991
[13]
STEER P A, SANDY J R, O'ROURKE D, SCOTT P C, BROWNING G F, NOORMOHAMMADI A H. Chronological analysis of gross and histological lesions induced by field strains of fowl adenovirus serotypes 1, 8b and 11 in one-day-old chickens. Avian Pathology: Journal of the W V P A, 2015, 44(2): 106-113.

doi: 10.1080/03079457.2015.1007919
[14]
OKUDA Y, ONO M, YAZAWA S, SHIBATA I, SATO S. Experimental infection of specific-pathogen-free chickens with serotype-1 fowl adenovirus isolated from a broiler chicken with gizzard erosions. Avian Diseases, 2001, 45(1): 19-25.

pmid: 11332481
[15]
OKUDA Y, ONO M, SHIBATA I, SATO S. Pathogenicity of serotype 8 fowl adenovirus isolated from gizzard erosions of slaughtered broiler chickens. The Journal of Veterinary Medical Science, 2004, 66(12): 1561-1566.

doi: 10.1292/jvms.66.1561
[16]
LI H X, WANG J, QIU L Y, HAN Z X, LIU S W. Fowl adenovirus species C serotype 4 is attributed to the emergence of hepatitis- hydropericardium syndrome in chickens in China. Infection, Genetics and Evolution, 2016, 45: 230-241.

doi: 10.1016/j.meegid.2016.09.006
[17]
邵震, 刁有祥. 规模化鹅场主要病毒核酸检测结果与分析. 中国农业科学, 2023, 56(10): 2021-2034.

doi: 10.3864/j.issn.0578-1752.2023.10.016
SHAO Z, DIAO Y X. Investigation and Analysis of Nucleic Acid Detection Results of Vain Viruses in Large-scale Goose Farms. Scientia Agricultura Sinica, 2023, 56(10): 2021-2034. (in Chinese)

doi: 10.3864/j.issn.0578-1752.2023.10.016
[18]
ADAIR B M. Immunopathogenesis of chicken anemia virus infection. Developmental & Comparative Immunology, 2000, 24(2/3): 247-255.
[19]
HESS M. Commensal or pathogen - a challenge to fulfil Koch's Postulates. British Poultry Science, 2017, 58(1): 1-12.

doi: 10.1080/00071668.2016.1245849 pmid: 27724044
[20]
VAN DEN BERG T P, ETERRADOSSI N, TOQUIN D, MEULEMANS G. Infectious bursal disease (Gumboro disease). Revue Scientifique et Technique (International Office of Epizootics), 2000, 19(2): 509-543.
[21]
NICZYPORUK J S, WOŹNIAKOWSKI G, CZEKAJ H, SAMOREK- SALAMONOWICZ E. Interactions between Marek's disease virus Rispens/CVI988 vaccine strain and adenovirus field strain in chicken embryo fibroblast (CEF) cultures. Polish Journal of Veterinary Sciences, 2014, 17(1): 3-8.

pmid: 24724464
[22]
SCHONEWILLE E, SINGH A, GÖBEL T W, GERNER W, SAALMÜLLER A, HESS M. Fowl adenovirus (FAdV) serotype 4 causes depletion of B and T cells in lymphoid organs in specific pathogen-free chickens following experimental infection. Veterinary Immunology and Immunopathology, 2008, 121(1/2): 130-139.

doi: 10.1016/j.vetimm.2007.09.017
[23]
MASE M, NAKAMURA K. Phylogenetic analysis of fowl adenoviruses isolated from chickens with gizzard erosion in Japan. The Journal of Veterinary Medical Science, 2014, 76(11): 1535-1538.

doi: 10.1292/jvms.14-0312
[24]
LI C J, LI H Y, WANG D D, WANG J J, WANG Y M, WANG S C, LI J D, LIU P, WANG J L, XU S Z, CUI S J, ZHANG Y, YIN Y B. Characterization of fowl adenoviruses isolated between 2007 and 2014 in China. Veterinary Microbiology, 2016, 197: 62-67.

doi: S0378-1135(16)30624-1 pmid: 27938684
[25]
MCFERRAN J B, ADAIR B M. Avian adenoviruses: a review. Avian Pathology, 1977, 6(3): 189-217.

doi: 10.1080/03079457708418228
[26]
MORSHED R, HOSSEINI H, LANGEROUDI A G, FARD M H B, CHARKHKAR S. Fowl adenoviruses D and E cause inclusion body hepatitis outbreaks in broiler and broiler breeder pullet flocks. Avian Diseases, 2017, 61(2): 205-210.

doi: 10.1637/11551-120516-Reg.1 pmid: 28665737
[27]
OLIVER-FERRANDO S, DOLZ R, CALDERÓN C, VALLE R, RIVAS R, PÉREZ M, BIARNÉS M, BLANCO A, BERTRAN K, RAMIS A, BUSQUETS N, MAJÓ N. Epidemiological and pathological investigation of fowl aviadenovirus serotypes 8b and 11 isolated from chickens with inclusion body hepatitis in Spain (2011-2013). Avian Pathology: Journal of the W V P A, 2017, 46(2): 157-165.

doi: 10.1080/03079457.2016.1232477
[28]
BROWN J A, BLAKE L, BISNATH J, RAMGATTIE C, CARRINGTON C V, OURA C A L. Identification of four serotypes of fowl adenovirus in clinically affected commercial poultry co-infected with chicken infectious anaemia virus in Trinidad and Tobago. Transboundary and Emerging Diseases, 2019, 66(3): 1341-1348.

doi: 10.1111/tbed.13162 pmid: 30817083
[29]
MATOS M, GRAFL B, LIEBHART D, SCHWENDENWEIN I, HESS M. Selected clinical chemistry analytes correlate with the pathogenesis of inclusion body hepatitis experimentally induced by fowl aviadenoviruses. Avian Pathology: Journal of the W V P A, 2016, 45(5): 520-529.

doi: 10.1080/03079457.2016.1168513
[30]
SAIFUDDIN M, WILKS C R. Pathogenesis of an acute viral hepatitis: inclusion body hepatitis in the chicken. Archives of Virology, 1991, 116(1/2/3/4): 33-43.

doi: 10.1007/BF01319229
[31]
SCHACHNER A, MAREK A, JASKULSKA B, BILIC I, HESS M. Recombinant FAdV-4 fiber-2 protein protects chickens against hepatitis-hydropericardium syndrome (HHS). Vaccine, 2014, 32(9): 1086-1092.

doi: 10.1016/j.vaccine.2013.12.056 pmid: 24397897
[32]
SCHONEWILLE E, JASPERS R, PAUL G, HESS M. Specific- pathogen-free chickens vaccinated with a live FAdV-4 vaccine are fully protected against a severe challenge even in the absence of neutralizing antibodies. Avian Diseases, 2010, 54(2): 905-910.

doi: 10.1637/8999-072309-Reg.1
[1] DONG Yu, WU Qian, FENG Xuan, ZHENG YinYing, CUI BaiMing. A Novel Plasmid pEA60 of Erwinia amylovora Enhances the Pathogenicity of Strains by Regulating the Synthesis of Virulence Factors [J]. Scientia Agricultura Sinica, 2026, 59(5): 996-1007.
[2] CONG QiQi, ZHANG JingYi, MENG XiangLong, DAI PengBo, LI Bo, HU TongLe, WANG ShuTong, CAO KeQiang, WANG YaNan. Identification of Hypovirus in Apple Ring Rot Fungus Botryosphaeria dothidea and Detection of Virus-Carrying Status in China [J]. Scientia Agricultura Sinica, 2025, 58(3): 478-492.
[3] TONG ZhaoYang, LIU WenHua, ZHANG GuoXin, DONG ChunYan, ZHANG YanXia, XU XiaoWei, HE Dong, LIU HeChun, LI Yang, WANG FengTao, FENG Jing, YAO XiaoBo, LIU MeiJin, LIN RuiMing. The Relationship Between Occurrence of Hulless Barley Ear Rot and Population Migration of Grass Mite (Siteroptes spp.) [J]. Scientia Agricultura Sinica, 2025, 58(3): 493-506.
[4] YANG WenJuan, GAO JiaCheng, WANG YanTing, LI Yan, GUO Ming, WANG JunCheng, MENG YaXiong, WANG HuaJun, SI ErJing. Function of Effector Pg00778 Regulation on the Pathogenicity of Pyrenophora graminea to Barley [J]. Scientia Agricultura Sinica, 2025, 58(15): 3020-3035.
[5] DONG ZaiFang, DING TengTeng, SHAN YiXuan, LI HongLian, CHEN LinLin, XING XiaoPing. Autophagy-Related Gene FpAtg3 Involves in Growth and Pathogenicity of Fusarium pseudograminearum [J]. Scientia Agricultura Sinica, 2024, 57(6): 1080-1090.
[6] ZHANG AiHong, YANG Fei, ZHAO YuanYe, ZHAO YiHan, DI DianPing, MIAO HongQin. Pathogenicity and Epidemic Risk of Barley Yellow Striate Mosaic Virus [J]. Scientia Agricultura Sinica, 2024, 57(23): 4686-4697.
[7] WANG Yuan, DU MengDan, LI ZhengGang, SHE XiaoMan, YU Lin, LAN GuoBing, DING ShanWen, HE ZiFu, TANG YaFei. Identification of Pathogen Causing Tomato White Tip and Curl Leaf Disease and Its Pathogenicity in Guangdong Province [J]. Scientia Agricultura Sinica, 2024, 57(12): 2350-2363.
[8] ZHANG Jian, ZHAO BinSen, FENG Hao, HUANG LiLi. Function and Mechanism Analysis of Vm-milRN7 Regulating the Pathogenicity of Valsa mali [J]. Scientia Agricultura Sinica, 2024, 57(10): 1930-1942.
[9] GAO XiaoXiao, TU LiQin, YANG Liu, LIU YaNan, GAO DanNa, SUN Feng, LI Shuo, ZHANG SongBai, JI YingHua. Construction of an Infectious Clone of Tobacco Mild Green Mosaic Virus Isolate Infecting Pepper from Jiangsu Based on Genomic Clone [J]. Scientia Agricultura Sinica, 2023, 56(8): 1494-1502.
[10] GONG AnDong, LEI YinYu, WU NanNan, LIU JingRong, SONG MengGe, ZHANG YiMei, YANG Guang, YANG Peng. The Effect of 3-Oxyacyl ACP Reductase Gene FgOAR1 on the Growth, Development and Pathogenicity of Fusarium graminearum [J]. Scientia Agricultura Sinica, 2023, 56(24): 4854-4865.
[11] YANG ShiMan, XU ChengZhi, XU BangFeng, WU YunPu, JIA YunHui, QIAO ChuanLing, CHEN HuaLan. Amino Acid of 225 in the HA Protein Affects the Pathogenicities of H1N1 Subtype Swine Influenza Viruses [J]. Scientia Agricultura Sinica, 2022, 55(4): 816-824.
[12] HUANG JiaQuan,LI Li,WU FengNian,ZHENG Zheng,DENG XiaoLing. Proliferation of Two Types Prophage of ‘Candidatus Liberibacter asiaticus’ in Diaphorina citri and their Pathogenicity [J]. Scientia Agricultura Sinica, 2022, 55(4): 719-728.
[13] ZHANG JinLong,ZHAO ZhiBo,LIU Wei,HUANG LiLi. The Function of Key T3SS Effectors in Pseudomonas syringae pv. actinidiae [J]. Scientia Agricultura Sinica, 2022, 55(3): 503-513.
[14] LI ZhengGang,TANG YaFei,SHE XiaoMan,YU Lin,LAN GuoBing,HE ZiFu. Molecular Characteristics and Pathogenicity Analysis of Youcai Mosaic Virus Guangdong Isolate Infecting Radish [J]. Scientia Agricultura Sinica, 2022, 55(14): 2752-2761.
[15] ZHANG ChengQi,LIAO LuLu,QI YongXia,DING KeJian,CHEN Li. Functional Analysis of the Nucleoporin Gene FgNup42 in Fusarium graminearium [J]. Scientia Agricultura Sinica, 2021, 54(9): 1894-1903.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!