Abstract:

【Objective】Cucumber green mottle mosaic virus (CGMMV) is one of the main viruses that infect melon crops, which causes great harm to the melon industry. The objective of this study is to identify the molecular characteristic and phylogenetic status of CGMMV-GDLZ isolate, analyze the pathogenicity of CGMMV-GDLZ isolate on cucumber, bottle gourd, and watermelon, and to provide a theoretical basis for the prevention and control of CGMMV. 【Method】Two symptomatic samples and one asymptomatic sample were collected from a farm located in Lianzhou City of Guangdong Province and were subjected to total RNA extraction. RT-PCR detection was performed using primer pair F: CCACGAGTTGTTTCCTAATGCTG/R: TTTGCTAGGCGTGATCGGATTGT, which was designed according to CGMMV reference genome (GenBank accession number KX883801). The annealing temperature is 53℃, and the product is 890 bp in length. To construct pCB301-CGMMV infectious cDNA clones, two primer pairs were designed to amplify the first half (1-3 511 nt) and the second half (3 301-6 423 nt) of the nucleotide sequence of CGMMV-GDLZ isolate. The primer pair used to amplify the first half is F: AAGTTCATTTCATTTGGA GAGGGTTTTAATTTTTATAATTAAACAAA/R: AGTTCTGCATTAATTGCTATTTGGTAGGCACAGTGGTAG, and the primer pair used to amplify the second half is F: GTGCGTGCTACCCCGACTCCAATAGGTTTGATTGCCCGTG/R: GGTGGAGATGC CATGCCGACCCTGGGCCCCTACCCGGGGAAAGG. Then the acquired products were cloned into pCB301 by homologous recombination, followed by Sanger DNA sequencing. Blast analysis was performed in NCBI using the full-length sequence of CGMMV-GDLZ isolate, then the phylogenetic tree was constructed by MEGA7 software using the sequences of CGMMV-GDLZ and other reported CGMMV isolates. Agrobacterium containing pCB301-CGMMV was infiltrated into Nicotiana benthamiana leaves to verify the infectivity of CGMMV-GDLZ isolate. Subsequently, pCB301-CGMMV was agroinfiltrated into the cotyledon of cucumber, bottle gourd, and watermelon to analyze the pathogenicity of CGMMV. 【Result】RT-PCR detection verified that the two symptomatic samples were infected by CGMMV. Sanger sequencing reveals that CGMMV-GDLZ isolate contains 6 423 nt and encodes four proteins, 129K replicase (61-3 495 nt), 186K replication-associated protein (61-5 007 nt), movement protein (4 994-5 788 nt), and coat protein (5 763-6 248 nt). CGMMV-GDLZ isolate has the highest nucleotide similarity (99.97%) with CGMMV-eWT isolate (GenBank accession number KY753928). Phylogenetic analysis showed that CGMMV-GDLZ and other CGMMV isolates from Japan and Korea were clustered into Group 1, and CGMMV-GDLZ was closest to isolates from Shandong, Zhejiang, and Henan. In addition, the pCB301-CGMMV infectious cDNA clones could successfully infect N. benthamiana, causing crinkle, mottle, and mosaic symptoms in the upper leaves. RT-PCR and Western blot detection further verified the infection of the infectious cDNA clones. Moreover, CGMMV-GDLZ isolate could also infect bottle gourd and watermelon, causing mottle, mosaic, and growth retardation at 15 days post-infiltration (dpi), and showed more severe symptoms at 24 dpi. However, the upper leaves of cucumber agro-infiltrated with pCB301-CGMMV did not show obvious symptoms compared with control plants. Further studies found the agro-infiltrated plants began to appear mottle and mosaic symptoms at 30 dpi after transferred from the greenhouse to artificial net-room without temperature control. The symptoms were more obvious at 40 dpi. RT-PCR and Western blot detection further verified the above results. 【Conclusion】CGMMV-GDLZ isolate from Lianzhou City of Guangdong Province may have the same infection source with CGMMV isolates from Shandong, Zhejiang, and Henan provinces. CGMMV-GDLZ isolate can infect N. benthamiana, cucumber, bottle gourd, and watermelon, but the pathogenicity varies in different crops.

Key words: bottle gourd, Cucumber green mottle mosaic virus (CGMMV), molecular characteristic, infectious cDNA clones, pathogenicity