Scientia Agricultura Sinica ›› 2019, Vol. 52 ›› Issue (8): 1295-1307.doi: 10.3864/j.issn.0578-1752.2019.08.001

Special Issue: MALE STERILITY OF CROP

• MALE STERILITY OF CROP • Previous Articles     Next Articles

The Function of the Polyketide Synthase OsPKS1 and OsPKS2 in Regulating Pollen Wall Formation in Rice

ZHOU YuLu1,LIN Hong1,ZHANG DaBing1,2,WANG CanHua1(),YU Jing1()   

  1. 1 School of Life Sciences and Biotechnology, Shanghai Jiao Tong University, Shanghai 200240
    2 School of Agriculture, Food and Wine, University of Adelaide; Australia SA 5005
  • Received:2018-12-10 Accepted:2019-01-24 Online:2019-04-16 Published:2019-04-26
  • Contact: CanHua WANG,Jing YU E-mail:wangcanhua@sjtu.edu.cn;yujing@sjtu.edu.cn

Abstract:

【Background】 Plant pollen is surrounded by pollen wall which acts as a natural protective barrier for male gametes and plays a pivotal role in plant reproductive development. The main component of pollen wall is sporopollenin, which is mainly composed of lipidic and phenolic substances. Therefore, the metabolism of these two substances is a key step for anther wall and pollen wall formation. PKS1/PKSA/LAP6 and PKS2/PKSB/LAP5 show conserved biochemical functions in sporopollenin biosynthesis pathways among different species. 【Objective】 The role of OsPKS1 and OsPKS2 in rice anther wall and pollen wall development was studied to provide a new understanding for the mechanism of this process. 【Method】 A gene co-expressed network, AntherNet predicted a gene OsPKS1 that might be involved in sporopollenin biosynthesis, using the CRISPR/Cas9 genome editing system to generate ospks1 and ospks1 ospks2 in Japonica subspecies 9522 background and ospks2 background, respectively. Under the same growth condition, the vegetative growth and floral organ development of the mutant plants were analyzed by comparing the phenotypes of the wild type and the mutants. I2-KI staining was utilized to analyze the pollen viability of ospks1 and ospks1 ospks2. Semi-thin section was performed to observe four cell layers and microspore development in the wild type and the mutants at different stages. Scanning electron microscope (SEM) was used to observe the fine structures of anther wall outer and inner surface as well as pollen wall surface both in the wild type and the mutants. And transmission electron microscopy (TEM) was performed to observe the fine structures of anther wall cell, Ubisch body and pollen wall of the wild type and the mutants.【Result】Four ospks1 and four ospks1 ospks2 were obtained by CRISPR/Cas9 approach, among which ospks1-3 and ospks1-4 ospks2 were homozygous mutants. Both ospks1-3 and ospks1-4 ospks2 were male sterile. ospks1-3 and ospks2 displayed abnormal pollen wall and Ubisch body, however, the detailed morphology was different between two mutants. ospks1-3 could form convex wall structure on the surface of pollen wall and the tapetal layer could be normally degraded; a large number of tiny cavities were formed in the inner structure of pollen wall and the bacula became shorter, which might cause invalid connection between tectum and nexine; the bottom structure of Ubisch bodies was decreased while the top structure was increased and Ubisch bodies were sharper than those of the wild type. By observing ospks1-4 ospks2, it was found that the cuticle was reduced and the tapetal layer could not be degraded normally. Besides, there was no obvious pollen wall structure on the surface of microspores and the microspores were degraded at stage 11; Ubisch bodies were less formed with abnormal structure at stage 9 and were detached from the anther wall at stage 11. 【Conclusion】 The function of PKS1/PKSA/LAP6 and PKS2/PKSB/LAP5 are conserved among various species and could affect the biosynthesis and accumulation of sporopollenin. However, these two genes show different function for the formation of the inner structure of pollen wall and Ubisch bodies in rice: OsPKS1 is more important for the formation of bacula and the bottom structure of Ubisch bodies; OsPKS2 is more important for the formation of tectum and the top structure of Ubisch bodies. They regulate the formation of pollen wall, anther wall and the degradation of tapetum.

Key words: Oryza sativa, OsPKS1, OsPKS2, sporopollenin, pollen wall, male sterile

Table 1

CRISPR primers and genotyping primers for OsPKS1"

引物名称
Primer name
正向引物
Forward primer(5′-3′)
反向引物
Reverse primer (5′-3′)
OsPKS1_Cri_T1 TAGGTCTCCCAAGGAAGAGAAGTTTTAGAGCTAGAA CGGGTCTCACTTGGCTGCTCCTGCACCAGCCGGG
OsPKS1_Cri_T2 TAGGTCTCCACTACAAGGACGGTTTTAGAGCTAGAA CGGGTCTCATAGTAGCCGCGGTGCACCAGCCGGG
OsPKS1_Cri_GT CTAGACGAGCACCCAGAGCT ACCTTGTCCGTCCCTGGTAG

Fig. 1

Target sites of the gRNA in the OsPKS1 gene and mutation site analysis A: Position of two targets in OsPKS1 gene locus, cloning of two gRNA cassettes into the pRGEB32CRISPR/Cas9 vector; B: Mutation site sequencing results of ospks1-3 and ospks1-4 ospks2; C: The protein prediction analysis of the wild type and the mutants, green boxes indicate putative conserved domain, the arrows indicate the mutation position. D: Mutation information in other alleles"

Fig. 2

The phenotypic comparison among the wild type, ospks1-3 and ospks1-4 ospks2 A: Wild-type plant (left), ospks1-3 mutant plant (middle) and ospks1-4 ospks2 mutant plant (right); B: Part of a wild-type panicle (left), an ospks1-3 panicle (middle) and an ospks1-4 ospks2 panicle (right) at seed producing stage; C-E: Wild-type flower, ospks1-3 flower and ospks1-4 ospks2 flower at stage 13 all with lemma and palea removed; F: Wild-type yellow anther and pollen grains stained with I2-KI solution at stage 13; G: ospks1-3 mutant anther and pollen grains stained with I2-KI solution at stage 13; H: ospks1-4 ospks2 mutant anther and pollen grains stained with I2-KI solution at stage 13. Pi: Pistil; St: Stamen. Bars: 10 cm (A); 5 cm (B); 2 mm (C-E), 1 mm (F-H), 200 μm in insets (F-H)"

Fig. 3

Transverse section analysis of anther development in the wild type, ospks1-3 and ospks1-4 ospks2 A-E: Wild type; F-J: ospks1-3; K-O: ospks1-4 ospks2. DMsp: Degenerated microspores; E: Epidermis; En: Endothecium; Ml: Middle layer; Msp: Microspore; T: Tapetum; Tds: Tetrads; Mp: Mature pollen; DMp: Degenerated mature pollen. Bar: 20 μm (A-O)"

Fig. 4

SEM and TEM observation for anther and pollen in the wild type and ospks1-3 A-H: SEM analysis of the surface of anthers and pollen grains in the wild type and ospks1-3 at stage 13; I-L: TEM observation of pollen wall and Ubisch body in the wild type and ospks1-3 at stage 10. A: Pollens of the wild type; B: Anther epidermis of the wild type; C: Pollen wall of the wild type; D: The inner surface of the wild type; E: Pollens of ospks1-3; F: Anther epidermis of ospks1-3; G: Pollen wall of ospks1-3; H: The inner surface of ospks1-3; I: Ultra-thin sections of pollen wall in the wild type; J: Ultra-thin sections of pollen wall in ospks1-3; K: Ultra-thin sections of Ubisch body in the wild type; L: Ultra-thin sections of Ubisch body in ospks1-3. Ex: Exine; DEx: Deformed exine; Ne: Nexine; Ub: Ubisch body; Ba: Bacula; Te: Tectum. Bars: 20 μm (A, E); 10 μm (B, F); 1 μm (C, D, G, H); 0.5 μm (I-L)"

Fig. 5

SEM observation for anther and pollen in the wild type and ospks1-4 ospks2 A: Anther epidermis of the wild type; B: The inner surface of the wild type; C: Anther epidermis of ospks1-4 ospks2; D: The inner surface of ospks1-4 ospks2. Ub: Ubisch body. Bars: 10 μm (A, C), 1 μm (B, D)"

Fig. 6

Transmission electron microscopy analysis of anthers in the wild type and ospks1- 4 ospks2 A-C: Pollen wall of the wild type from stage 9 to stage 11; D-F: Pollen wall of ospks1-4 ospks2 from stage 9 to stage 11; G-I: Ubisch body in the wild type from stage 9 to stage 11; J-L: Ubisch body in ospks1-4 ospks2 from stage 9 to stage 11. Msp: Microspore; DMsp: Degenerated microspore; AEx: Abnormal exine; Ne: Nexine; Ub: Ubisch body; T: Tapetum; Ba: Bacula; Te: Tectum; Pb: Probacula; Pe: Prim-exine. Bars: 0.5 μm"

Fig. 7

The proposed roles of OsPKS1 and OsPKS2 in anther cuticle and pollen wall development OsACOS12 catalyzes diverse fatty acids to produce fatty acyl coenzyme A which is then condensed by OsPKS1 or OsPKS2 to form different types of polyketide. Different types of polyketide involved in the formation of cutin monomers and sporopollenin precursor are required for the different structures in Ubisch body and pollen wall formation and also participate in the development of anther cuticle"

[1] LONDO J P, CHIANG Y C, HUNG K H, CHIANG Y C, HUNG K H, CHIANG T Y, SCHAAL B A . Phylogeography of Asian wild rice,Oryza rufipogon, reveals multiple independent domestications of cultivated rice, Oryza sativa. Proceedings of the National Academy of Sciences of the United States of America, 2006,103(25):9578-9583.
[2] ZHANG D S, LIANG W Q, YIN C S, ZONG J, GU F W, ZHANG D B . OsC6, encoding a lipid transfer protein, is required for postmeiotic anther development in rice. Plant Physiology, 2010,154(1):149-162.
doi: 10.1104/pp.110.158865
[3] ARIIZUMI T, TORIYAMA K . Genetic regulation of sporopollenin synthesis and pollen exine development. Annual Review of Plant Biology, 2011,62(1):437-460.
doi: 10.1146/annurev-arplant-042809-112312
[4] JIANG J, ZHANG Z, CAO J . Pollen wall development: The associated enzymes and metabolic pathways. Plant Biology, 2013,15(2):249-263.
doi: 10.1111/plb.2013.15.issue-2
[5] BLACKMORE S, WORTLEY H A, SKVARLA J J, ROWLEY J R . Pollen wall development in flowering plants. New Phytologist, 2007,174(3):483-498.
doi: 10.1111/nph.2007.174.issue-3
[6] SCOTT R J, SPIELMAN M, DICKINSON H G . Stamen structure and function. The Plant Cell, 2004,16(Suppl.):S46.
doi: 10.1105/tpc.017012
[7] SHI J X, CUI M H, YANG L, KIM Y J, ZHANG D B . Genetic and biochemical mechanisms of pollen wall development. Trends in Plant Science, 2015,20(11):741-753.
doi: 10.1016/j.tplants.2015.07.010
[8] GOLDBERG R, BEALS T, SANDERS P . Anther development: basic principles and practical applications. The Plant Cell, 1993,5(10):1217-1229.
doi: 10.1105/tpc.5.10.1217
[9] BUBERT H, LAMBERT J, STEUERNAGEL S, AHLERS F, WIERMANN R . Continuous decomposition of sporopollenin from pollen of Typha angustifolia L. by acidic methanolysis. Zeitschrift Fur Naturforschung Section C-a Journal of Biosciences, 2002,57(11/12):1035-1041.
[10] BROOKS J, SHAW G . Chemical structure of the exine of pollen walls and a new function for carotenoids in nature. Nature, 1968,219(5153):532-533.
[11] SCOTT R J, STEAD A D. Molecular and Cellular Aspects of Plant Reproduction. England: Cambridge University Press, 1994: 49-81.
[12] HUI L, PINOT F, SAUVEPLANE V, WERCK-REICHHART D, DIEHL P, SCHREIBER L, FRANKE R, ZHANG P, CHEN L, GAO Y W, LIANG W Q, ZHANG D B . Cytochrome P450 family member CYP704B2 catalyzes the {omega-hydroxylation of fatty acids and is required for anther cutin biosynthesis and pollen exine formation in rice. The Plant Cell, 2010,22(9):173-90.
doi: 10.1105/tpc.109.070326
[13] YANG X J, WU D, SHI J X, HE Y, PINOT F, GRAUSEM B, YIN C S, ZHU L, CHEN M J, LUO Z J, LIANG W Q, ZHANG D B . Rice CYP703A3, a cytochrome P450 hydroxylase, is essential for development of anther cuticle and pollen exine. Journal of Integrative Plant Biology, 2014,56(10):979-994.
doi: 10.1111/jipb.v56.10
[14] DOBRITSA A A, SHRESTHA J, MORANT M, PINOT F, MATSUNO M, SWANSON R, MØLLER B L, PREUSS D . CYP704B1 is a long-chain fatty acid ω-hydroxylase essential for sporopollenin synthesis in pollen of Arabidopsis. Plant Physiology, 2009,151(2):574-589.
[15] MORANT M, JØRGENSEN K, SCHALLER H, PINOT F, MØLLER B L, WERCK-REICHHART D, BAKA S . CYP703 is an ancient cytochrome P450 in land plants catalyzing in-chain hydroxylation of lauric acid to provide building blocks for sporopollenin synthesis in pollen. The Plant Cell, 2007,19(5):1473-1487.
doi: 10.1105/tpc.106.045948
[16] SHI J, TAN H X, YU X H, LIU Y Y, LIANG W Q, RANATHUNGE K, FRANKE R B, SCHREIBER L, WANG Y J, KAI G Y, SHANKLIN J, MA H, ZHANG D B . Defective Pollen Wall is required for anther and microspore development in rice and encodes a fatty acyl carrier protein reductase. The Plant Cell, 2011,23(6):2225-2246.
doi: 10.1105/tpc.111.087528
[17] CHEN W W, YU X H, ZHANG K S, SHI J X, OLIVEIRA S D, SCHREIBER L, SHANKLIN J, ZHANG D B . Male Sterile2 encodes a plastid-localized fatty acyl carrier protein reductase required for pollen exine development in Arabidopsis. Plant Physiology, 2011,157(2):842-853.
[18] XU D W, SHI J X, RAUTENGARTEN C, YANG L, QIAN X L, UZAIR M, ZHU L, LUO Q, AN G H, WAßMANN F, SCHREIBER L, HEAZLEWOOD J L, SCHELLER H V, HU J P, ZHANG D B, LIANG W Q . Defective Pollen Wall 2 (DPW2) encodes an acyl transferase required for rice pollen development. Plant Physiology, 2016,173(1):240-255.
[19] LIU Z, LIN S, SHI J X, YU J, ZHU L, YANG X J, ZHANG D B, LIANG W Q . Rice No Pollen 1 (NP1) is required for anther cuticle formation and pollen exine patterning. The Plant Journal, 2017,91(2):263-277.
doi: 10.1111/tpj.2017.91.issue-2
[20] JEPSON C, KARPPINEN K, DAKU R M, STERENBERG B T, SUH D Y , . Hypericum perforatum hydroxyalkylpyrone synthase involved in sporopollenin biosynthesis--phylogeny, site-directed mutagenesis, and expression in nonanther tissues. The FEBS Journal, 2014,281(17):3855-3868.
doi: 10.1111/febs.2014.281.issue-17
[21] LI Y L, LI D D, GUO Z L, SHI Q S, XIONG S X, ZHANG C, ZHU J, YANG Z N . OsACOS12, an orthologue of Arabidopsis acyl-CoA synthetase5, plays an important role in pollen exine formation and anther development in rice. BMC Plant Biology, 2016,16(1):256.
[22] QIN M M, TIAN T T, XIA S Q, WANG Z X, SONG L P Y B, QIN WEN J, SHEN J X, MA C Z, FU T D, TU J X . Heterodimer formation of BnPKSA or BnPKSB with BnACOS5 constitutes a multienzyme complex in tapetal cells and is involved in male reproductive development in Brassica napus. Plant and Cell Physiology, 2016,57(8):1643-1656.
[23] YANG X J, LIANG W Q, CHEN M J, ZHANG D B, ZHAO X X, SHI J X . Rice fatty acyl-CoA synthetase OsACOS12 is required for tapetum programmed cell death and male fertility. Planta, 2017,246(1):105-122.
doi: 10.1007/s00425-017-2691-y
[24] WANG Y B, LIN Y C, SO J, DU Y G, LO C . Conserved metabolic steps for sporopollenin precursor formation in tobacco and rice. Physiologia Plantarum, 2013,149(1):13-24.
doi: 10.1111/ppl.2013.149.issue-1
[25] SOUZA C D A, KIM S S, KOCH S, KIENOW L, SCHNEIDER K, MCKIM S M, HAUGHN G W, KOMBRINK E, DOUGLAS C J . A novel fatty Acyl-CoA Synthetase is required for pollen development and sporopollenin biosynthesis in Arabidopsis. The Plant Cell, 2009,21(2):507-525.
[26] XIE L L, LIU P L, ZHU Z X, ZHANG S F, ZHANG S J, LI F, ZHANG H, LI G L, WEI Y X, SUN R F . Phylogeny and expression analyses reveal important roles for plant PKS III family during the conquest of land by plants and angiosperm diversification. Frontiers in Plant Science, 2016,7(136):1312.
[27] KIM S S, GRIENENBERGER E, LALLEMAND B, COLPITTS C C, KIM S Y, SOUZA C D A, GEOFFROY P, HEINTZ D, KRAHN D, KAISER M, KOMBRINK E, HEITZ T, SUH D Y, LEGRAND M, DOUGLASA C J . LAP6/POLYKETIDE SYNTHASE a and LAP5/POLYKETIDE SYNTHASE B encode hydroxyalkyl α-pyrone synthases required for pollen development and sporopollenin biosynthesis in Arabidopsis thaliana. The Plant Cell, 2010,22(12):4045-4066.
[28] GRIENENBERGER E, KIM S S, LALLEMAND B, GEOFFROY P, HEINTZ D, SOUZA C D A, HEITZ T, DOUGLAS C J, LEGRAND M . Analysis of TETRAKETIDE α-PYRONE REDUCTASE function in Arabidopsis thaliana reveals a previously unknown, but conserved, biochemical pathway in sporopollenin monomer biosynthesis. The Plant Cell, 2010,22(12):4067-4083.
[29] ZHU X L, YU J, SHI J X, TOHGE T, FERNIE A R, MEIR S, AHARONI A, XU D W, ZHANG D B, LIANG W Q . The polyketide synthase OsPKS2 is essential for pollen exine and Ubisch body patterning in rice. Journal of Integrative Plant Biology, 2017,59(9):612-628.
doi: 10.1111/jipb.12574
[30] SHI Q S, WANG K Q, LI Y L, ZHOU L, XIONG S X, HAN Y, ZHANG Y F, YANG N Y, YANG Z N, ZHU J . OsPKS1 is required for sexine layer formation, which shows functional conservation between rice and Arabidopsis. Plant Science, 2018,277:145-154.
[31] DOBRITSA A A, LEI Z T, NISHIKAWA S I, URBANCZYK- WOCHNIAK E, HUHMAN D V, PREUSS D, SUMNER L W . LAP5 and LAP6 encode anther-specific proteins with similarity to chalcone synthase essential for pollen exine development in Arabidopsis. Plant Physiology, 2010,153(3):937-955.
[32] ZOU T, XIAO Q, LI W J, LUO T, YUAN G Q, HE Z Y, LIU M X, LI Q, XU P Z, ZHU J, LIANG Y Y, DENG Q M, WANG S Q, ZHENG A P, WANG L X, LI P and LI S C . OsLAP6/OsPKS1, an orthologue of Arabidopsis PKSA/LAP6, is critical for proper pollen exine formation. Rice, 2017,10(1):53.
doi: 10.1186/s12284-017-0191-0
[33] XIE K B, MINKENBERG B, YANG Y N . Boosting CRISPR/Cas9 multiplex editing capability with the endogenous tRNA-processing system. Proceedings of the National Academy of Sciences of the USA, 2015,112(11):3570-3575.
doi: 10.1073/pnas.1420294112
[34] LI N, ZHANG D S, LIU H S, YIN C S, LI X X, LIANG W Q, YUAN Z, XU B, CHU H W, WANG J, WEN T Q, HUANG H, LUO D, MA H, ZHANG D B . The rice tapetum degeneration retardation gene is required for tapetum degradation and anther development. The Plant Cell, 2006,18(11):2999-3014.
doi: 10.1105/tpc.106.044107
[35] ZHANG D B, WILSON Z A . Stamen specification and anther development in rice. Chinese Science Bulletin, 2009,54(14):2342-2353.
doi: 10.1007/s11434-009-0348-3
[36] ZHANG D B, LUO X, ZHU L . Cytological analysis and genetic control of rice anther development. Journal of Genetics and Genomics, 2011,38(9):379-390.
doi: 10.1016/j.jgg.2011.08.001
[37] LIN H, YU J, PEARCE S P, ZHANG D B, WILSON Z A . RiceAntherNet: A gene co-expression network for identifying anther and pollen development genes. The Plant Journal, 2017,92(6):1076-1091.
doi: 10.1111/tpj.13744
[38] MEN X, SHI J X, LIANG W Q, ZHANG Q F, LIAN G B, QUAN S, ZHU L, LUO Z J, CHEN M J, ZHANG D B . Glycerol-3-Phosphate Acyltransferase 3 (OsGPAT3) is required for anther development and male fertility in rice. Journal of Experimental Botany, 2017,68(3):513-526.
[1] ZHUANG LiHua, LUO Lei, ZHAO ChunFang, WANG JiZhong, ZHANG YaDong, HE Lei. Identification and Gene Mapping of Rice Grain Shape Mutant sgd13 [J]. Scientia Agricultura Sinica, 2025, 58(24): 5097-5109.
[2] DONG Xue, CHEN MengQiu, SHAO Jin, WU XueYou, TANG PeiAn. Construction of a Differential Gene Expression and Quality Regulation Network in Stored Rice Grain Using WGCNA [J]. Scientia Agricultura Sinica, 2025, 58(14): 2885-2903.
[3] ZENG YueHui, ZOU WenGuang, ZHAO FuMing, XIAO ChangChun, HUANG JianHong, MA BinLin, YANG WangXing, WEI XinYu, XU XuMing. Map-Based Cloning and Functional Verification of A Novel Split Glume Gene OsSG2 in Rice (Oryza sativa L.) [J]. Scientia Agricultura Sinica, 2025, 58(11): 2062-2080.
[4] ZHANG BiDong, LIN Hong, ZHU SiYing, LI ZhongCheng, ZHUANG Hui, LI YunFeng. Identification and Candidate Gene Analysis of the ABNORMAL HULL 1 (ah1) Mutant in Rice (Oryza sativa L.) [J]. Scientia Agricultura Sinica, 2024, 57(3): 429-441.
[5] YAN LiuHui, ZHONG Qi, MA ZengFeng, WEI MinYi, LIU Chi, QIN YuanYuan, ZHOU XiaoLong, HUANG DaHui, LU YingPing, QIN Gang, ZHANG YueXiong. Identification and Evolutionary Analysis of the Early Heading Gene OsEHD8 in Common Wild Rice (Oryza rufipogon Giff.) [J]. Scientia Agricultura Sinica, 2024, 57(14): 2703-2716.
[6] ZHU HongHui, LI YingZi, GAO YuanZhuo, LIN Hong, WANG ChengYang, YAN ZiYi, PENG HanPing, LI TianYe, XIONG Mao, LI YunFeng. Map-Based Cloning of the SHORT AND WIDEN GRAIN 1 Gene in Rice (Oryza sativa L.) [J]. Scientia Agricultura Sinica, 2023, 56(7): 1260-1274.
[7] XING MiaoMiao, XU YuanYuan, LU YuYu, YAN JiYong, ZENG AiSong. Development of Ogura CMS Restorers of Broccoli via Genetic Transformation of Rfo [J]. Scientia Agricultura Sinica, 2023, 56(15): 2966-2976.
[8] ZHAO ChunFang,ZHAO QingYong,LÜ YuanDa,CHEN Tao,YAO Shu,ZHAO Ling,ZHOU LiHui,LIANG WenHua,ZHU Zhen,WANG CaiLin,ZHANG YaDong. Screening of Core Markers and Construction of DNA Fingerprints of Semi-Waxy Japonica Rice Varieties [J]. Scientia Agricultura Sinica, 2022, 55(23): 4567-4582.
[9] PANG HongBo, CHENG Lu, YU MingLan, CHEN Qiang, LI YueYing, WU LongKun, WANG Ze, PAN XiaoWu, ZHENG XiaoMing. Genome-Wide Association Study of Cold Tolerance at the Germination Stage of Rice [J]. Scientia Agricultura Sinica, 2022, 55(21): 4091-4103.
[10] DENG AiXing,LIU YouHong,MENG Ying,CHEN ChangQing,DONG WenJun,LI GeXing,ZHANG Jun,ZHANG WeiJian. Effects of 1.5℃ Field Warming on Rice Yield and Quality in High Latitude Planting Area [J]. Scientia Agricultura Sinica, 2022, 55(1): 51-60.
[11] YinHua MA,KaiQin MO,Lu LIU,PingFang LI,ChenZhong JIN,Fang YANG. Effect of Overexpression of OsRRK1 Gene on Rice Leaf Development [J]. Scientia Agricultura Sinica, 2021, 54(5): 877-886.
[12] ZHANG YaDong,LIANG WenHua,HE Lei,ZHAO ChunFang,ZHU Zhen,CHEN Tao,ZHAO QingYong,ZHAO Ling,YAO Shu,ZHOU LiHui,LU Kai,WANG CaiLin. Construction of High-Density Genetic Map and QTL Analysis of Grain Shape in Rice RIL Population [J]. Scientia Agricultura Sinica, 2021, 54(24): 5163-5176.
[13] XU ZiYi,CHENG Xing,SHEN Qi,ZHAO YaNan,TANG JiaYu,LIU Xi. Identification and Gene Functional Analysis of Yellow Green Leaf Mutant ygl3 in Rice [J]. Scientia Agricultura Sinica, 2021, 54(15): 3149-3157.
[14] REN ZhiJie,LI Qian,SUN YuJia,KONG DongDong,LIU LiangYu,HOU CongCong,LI LeGong. OsCSC11 Mediates Dry-Hot Wind/Drought-Induced Ca2+ Signal to Regulate Stamen Development in Rice [J]. Scientia Agricultura Sinica, 2021, 54(10): 2039-2052.
[15] LIU HaiYing,FENG BiDe,RU ZhenGang,CHEN XiangDong,HUANG PeiXin,XING ChenTao,PAN YinYin,ZHEN JunQi. Relationship Between Phytohormones and Male Sterility of BNS and BNS366 in Wheat [J]. Scientia Agricultura Sinica, 2021, 54(1): 1-18.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!