Scientia Agricultura Sinica ›› 2023, Vol. 56 ›› Issue (13): 2574-2585.doi: 10.3864/j.issn.0578-1752.2023.13.011

• HORTICULTURE • Previous Articles     Next Articles

The Function of PmABCG9 Transporter Related to the Volatilization of Benzyl Alcohol in Prunus mume

HAO RuiJie1(), QIU Chen2, GENG XiaoYun1, JIA HaoTian1, ZHANG YaJing1, CHANG Jun1, FENG XinXin1   

  1. 1 College of Horticulture, Shanxi Agricultural University, Taigu 030801, Shanxi
    2 College of Urban and Rural Construction, Shanxi Agricultural University, Taigu 030801, Shanxi
  • Received:2022-09-23 Accepted:2023-01-12 Online:2023-07-01 Published:2023-07-06
  • Contact: HAO RuiJie

Abstract:

【Objective】The aim of this study was to improve the volatilization mechanism of floral scent by exploring the gene related to the transmembrane transport of important aromatic components in P. mume. 【Method】The P. mume Caizhiwufen was applied as material plant. Based on the analysis of volatile and endogenous contents of benzyl alcohol at different blooming stages, the ABC transporters (ATP-binding cassette transporter) involved in the transmembrane transport of benzyl alcohol were identified by weighted gene co-expression network analysis (WGCNA), phylogenetic analysis, and gene expression profiles. Finally, the functions of PmABCG9 were validated by subcellular localization, transgenic technology and incubation assay with substrates. 【Result】The flowering process of P. mume was divided into seven blooming stages, and the total relative content of benzaldehyde, benzyl alcohol and benzyl acetate reached more than 80% at the initial blooming stage, indicating that they were the key aromatic components of Caizhiwufen. The quantitative analysis showed that the endogenous content of benzaldehyde was the highest among the above three, while its volatile content was only 13.17 ng·g-1·h-1 at the highest level. The endogenous and volatile content of benzyl alcohol reached the highest at wither stage, up to 82.28 ng·g-1·h-1 of the volatile content. The highest volatile content of benzyl acetate was at full blooming stage and up to 280.21 ng·g-1·h-1. WGCNA between the transcriptome data of different blooming stages and the volatile content of aromatic components showed that the turquoise module highly correlated with the volatile content of benzyl alcohol, importantly. 11 ABCG subfamily genes were identified. Moreover, based on the expression patterns of PmABCG9 in different flower organs and blooming stages of P. mume, it was inferred that PmABCG9 was related to the transmembrane transport of benzyl alcohol in P. mume. Therefore, PmABCG9 gene was cloned, and the typical NBD-TMD domain of PmABCG9 gene was confirmed. Subcellular localization showed that PmABCG9 was localized on the cell membrane. The leaves of transgenic PmABCG9 Nicotiana benthamiana and wild-type plants were incubated with benzyl alcohol solution, and the volatile content of benzyl alcohol from each line were analyzed by GC-MS. It was noted that the volatile content of benzyl alcohol from transgenic tobaccos was significantly higher than that of wild-type ones, demonstrating that PmABCG9 had the function of transporting benzyl alcohol. 【Conclusion】 Benzaldehyde, benzyl alcohol and benzyl acetate were the key aromatic components at florescence of P. mume Caizhiwufen. PmABCG9 belonged to the semi-molecular transporters type from ABCG subfamily, PmABCG9 was closely related to volatile content benzyl alcohol, furthermore, it could effectively transport benzyl alcohol into the air through cell membrane.

Key words: Prunus mume, benzyl alcohol, PmABCG9, transport, floral scent

Fig. 1

Flower phenotypes of Caizhiwufen at different blooming stages LB: Dew petals stage; XL: Small-bud stage; ZL: Mid-bud stage; DL: Big-bud stage; CH: Initial blooming stage; SH: Full blooming stage; MH: Wither stage. The same as below"

Table 1

Primer sequence and purpose"

引物名称
Primer name
引物序列
Prime sequence (5′-3′)
用途
Purpose
PmABCG9-F TTGGAGAGGACACGC*ATGGAATTGCCAGTGACAATGC PmABCG9克隆、超表达
Cloning and overexpression of PmABCG9
PmABCG9-R GCAGGACTCTAGGGACTAGTCTCTGTTTCTGCAGCAT
PmABCG9-GFP-F AACACGGGGGACTTTGCAACATGGAATTGCCAGTGACAATGCCGG PmABCG9亚细胞定位
Subcellular localization of PmABCG9
PmABCG9-GFP-R CCTGAAGCGGCCGCTGTACAGTCTCTGTTTCTGCAGCATCTGTACC
PmABCG9-qPCR-F GGTTGGTTGGATTAAGGAGGAA 实时荧光定量
qRT-PCR
PmABCG9-qPCR-R CACTGAAACAAGCCACAACAG
UBC-F GCAGGTGGAGTGTTCCTTGTGA 内参引物
Internal reference primer
UBC-R GGCAGGGCTCCACTGTTCTTT

Fig. 2

The variety about content of aromatic components at different blooming stages of Caizhiwufen A: The relative content of benzaldehyde, benzyl alcohol and benzyl acetate at different blooming stages of Caizhiwufen; B: The volatile and endogenous content of benzaldehyde at different blooming stages; C: The volatile and endogenous content of benzyl alcohol at different blooming stages; D: The volatile and endogenous content of benzyl acetate at different blooming stages. Different capital and lowercase letters indicate significant difference in volatile content and endogenous content, respectively (P<0.05). The same as below"

Fig. 3

Correlation between volatiles and the genes of modules at different blooming stages of P. mume The numbers in the modules represent the value of the correlation coefficient between the module and the phenotype, and the numbers in parentheses represent the significance P value"

Fig. 4

Phylogenetic analysis of PmABCGs"

Fig. 5

The expression patterns of PmABCGs in P. mume"

Fig. 6

Conserved domain analysis and subcellular localization of PmABCG9 A: The conserved domain of PmABCG9; B: The prediction of PmABCG9 transmembrane protein structure; C: The subcellular localization of PmABCG9"

Fig. 7

The transgenic PmABCG9 tobacco lines and detection of its expression level A: Schematic of pHZM27-PmABCG9 vector; B: Seedlings of transgenic PmABCG9 tobacco; C: The expression of PmABCG9 in transgenic tobacco lines"

Fig. 8

PmABCG9 transgenic tobacco lines incubated with benzyl alcohol solution A: The volatile content of PmABCG9 transgenic tobacco lines; B: The endogenous content of PmABCG9 transgenic tobacco lines"

[1]
ZHANG Q X, CHEN W B, SUN L D, ZHAO F Y, HUANG B Q, YANG W R, TAO Y, WANG J, YUAN Z Q, FAN G Y, et al. The genome of Prunus mume. Nature Communications, 2012, 3: 1318.

doi: 10.1038/ncomms2290
[2]
HAO R J, ZHANG Q, YANG W R, WANG J, CHENG T R, PAN H T, ZHANG Q X. Emitted and endogenous floral scent compounds of Prunus mume and hybrids. Biochemical Systematics and Ecology, 2014, 54: 23-30.

doi: 10.1016/j.bse.2013.12.007
[3]
PICHERSKY E, NOEL J P, DUDAREVA N. Biosynthesis of plant volatiles: nature’s diversity and ingenuity. Science, 2006, 311(5762): 808-811.

doi: 10.1126/science.1118510
[4]
TZIN V, GALILI G. New insights into the shikimate and aromatic amino acids biosynthesis pathways in plants. Molecular Plant, 2010, 3(6): 956-972.

doi: 10.1093/mp/ssq048 pmid: 20817774
[5]
BOATRIGHT J, NEGRE F, CHEN X L, KISH C M, WOOD B, PEEL G, ORLOVA I, GANG D, RHODES D, DUDAREVA N. Understanding in vivo benzenoid metabolism in Petunia petal tissue. Plant Physiology, 2004, 135(4): 1993-2011.

doi: 10.1104/pp.104.045468
[6]
ZHANG T X, BAO F, YANG Y J, HU L, DING A Q, DING A Q, WANG J, CHENG T R, ZHANG Q X. A comparative analysis of floral scent compounds in intraspecific cultivars of Prunus mume with different Corolla colours. Molecules, 2019, 25(1): 145.

doi: 10.3390/molecules25010145
[7]
HAO R J, DU D L, WANG T, YANG W R, WANG J, ZHANG Q X. A comparative analysis of characteristic floral scent compounds in Prunus mume and related species. Bioscience, Biotechnology, and Biochemistry, 2014, 78(10): 1640-1647.

doi: 10.1080/09168451.2014.936346
[8]
PUGH S, MCKENNA R, HALLOUM I, NIELSEN D R. Engineering Escherichia coli for renewable benzyl alcohol production. Metabolic Engineering Communications, 2015, 2: 39-45.

doi: 10.1016/j.meteno.2015.06.002
[9]
JACOB S E, BARRON G S. Benzyl alcohol: A covert fragrance. Dermatitis, 2007, 18(4): 232-233.

pmid: 18021606
[10]
WOOD W F, LARGENT D L. Benzaldehyde and benzyl alcohol, the odour compounds from Agaricus smithii. Biochemical Systematics and Ecology, 1999, 27(5): 521-522.

doi: 10.1016/S0305-1978(98)00116-1
[11]
SCHIESTL F P. The evolution of floral scent and insect chemical communication. Ecology Letters, 2010, 13(5): 643-656.

doi: 10.1111/j.1461-0248.2010.01451.x pmid: 20337694
[12]
RACHERSBERGER M, CORDEIRO G D, SCHÄFFLER I, DÖTTERL S. Honeybee pollinators use visual and floral scent cues to find apple (Malus domestica) flowers. Journal of Agricultural and Food Chemistry, 2019, 67(48): 13221-13227.

doi: 10.1021/acs.jafc.9b06446
[13]
TISSIER A, MORGAN J A, DUDAREVA N. Plant volatiles: Going ‘In’ but not ‘out’ of trichome cavities. Trends in Plant Science, 2017, 22(11): 930-938.

doi: 10.1016/j.tplants.2017.09.001
[14]
WIDHALM J R, JAINI R, MORGAN J A, DUDAREVA N. Rethinking how volatiles are released from plant cells. Trends in Plant Science, 2015, 20(9): 545-550.

doi: 10.1016/j.tplants.2015.06.009 pmid: 26189793
[15]
ADEBESIN F, WIDHALM J R, BOACHON B, LEFèVRE F, PIERMAN B, LYNCH J H, ALAM I, JUNQUEIRA B, BENKE R, RAY S, PORTER J A, YANAGISAWA M, WETZSTEIN H Y, MORGAN J A, BOUTRY M, SCHUURINK R C, DUDAREVA N. Emission of volatile organic compounds from petunia flowers is facilitated by an ABC transporter. Science, 2017, 356(6345): 1386-1388.

doi: 10.1126/science.aan0826 pmid: 28663500
[16]
VELAMAKANNI S, WEI S L, JANVILISRI T, VAN VEEN H W. ABCG transporters: structure, substrate specificities and physiological roles: A brief overview. Journal of Bioenergetics and Biomembranes, 2007, 39(5/6): 465-471.

doi: 10.1007/s10863-007-9122-x
[17]
HWANG J U, SONG W Y, HONG D, KO D, YAMAOKA Y, JANG S, YIM S, LEE E, KHARE D, KIM K, PALMGREN M, YOON H, MARTINOIA E, LEE Y. Plant ABC transporters enable many unique aspects of a terrestrial plant’s lifestyle. Molecular Plant, 2016, 9(3): 338-355.

doi: 10.1016/j.molp.2016.02.003
[18]
PANIKASHVILI D, SHI J X, SCHREIBER L, AHARONI A. The Arabidopsis ABCG13 transporter is required for flower cuticle secretion and patterning of the petal epidermis. New Phytologist, 2011, 190(1): 113-124.

doi: 10.1111/nph.2011.190.issue-1
[19]
ALEJANDRO S, LEE Y, TOHGE T, SUDRE D, OSORIO S, PARK J, BOVET L, LEE Y, GELDNER N, FERNIE A, MARTINOIA E. AtABCG29 is a monolignol transporter involved in lignin biosynthesis. Current Biology, 2012, 22(13): 1207-1212.

doi: 10.1016/j.cub.2012.04.064 pmid: 22704988
[20]
ZHANG K W, NOVAK O, WEI Z Y, GOU M Y, ZHANG X B, YU Y, YANG H J, CAI Y H, STRNAD M, LIU C J. Arabidopsis ABCG14 protein controls the acropetal translocation of root-synthesized cytokinins. Nature Communications, 2014, 5: 3274.

doi: 10.1038/ncomms4274
[21]
LEFÈVRE F, BOUTRY M. Towards identification of the substrates of ATP-binding cassette transporters. Plant Physiology, 2018, 178(1): 18-39.

doi: 10.1104/pp.18.00325 pmid: 29987003
[22]
ZHU L, SHI J X, ZHAO G C, ZHANG D B, LIANG W Q. Post-meiotic deficient anther1 (PDA1) encodes an ABC transporter required for the development of anther cuticle and pollen exine in rice. Journal of Plant Biology, 2013, 56(1): 59-68.

doi: 10.1007/s12374-013-0902-z
[23]
WU L N, GUAN Y S, WU Z G, YANG K, LV J, CONVERSE R, HUANG Y X, MAO J X, ZHAO Y, WANG Z W, MIN H Q, KAN D Y, ZHANG Y. OsABCG15 encodes a membrane protein that plays an important role in anther cuticle and pollen exine formation in rice. Plant Cell Reports, 2014, 33(11): 1881-1899.

doi: 10.1007/s00299-014-1666-8 pmid: 25138437
[24]
HAO R J, YANG S T, ZHANG Z Q, ZHANG Y J, CHANG J, QIU C. Identification and specific expression patterns in flower organs of ABCG genes related to floral scent from Prunus mume. Scientia Horticulturae, 2021, 288: 110218.

doi: 10.1016/j.scienta.2021.110218
[25]
LANGFELDER P, HORVATH S. WGCNA: An R package for weighted correlation network analysis. BMC Bioinformatics, 2008, 9: 559.

doi: 10.1186/1471-2105-9-559 pmid: 19114008
[26]
张中起, 王娇, 靳炜, 葛冬冬, 刘康, 吕芬妮, 孙敬. 陆地棉CRK基因家族的鉴定及其表达分析. 中国农业科学, 2018, 51(13): 2442-2461. doi: 10.3864/j.issn.0578-1752.2018.13.002.

doi: 10.3864/j.issn.0578-1752.2018.13.002
ZHANG Z Q, WANG J, JIN W, GE D D, LIU K, F N, SUN J. Identification and expression analysis of CRK gene family in upland cotton. Scientia Agricultura Sinica, 2018, 51(13): 2442-2461. doi: 10.3864/j.issn.0578-1752.2018.13.002. (in Chinese)

doi: 10.3864/j.issn.0578-1752.2018.13.002
[27]
HAO R J, CHANG J, QIU C, YANG S T. An identification and expression analysis of the ABCG genes related to benzaldehyde transportation among three Prunus species. Horticulturae, 2022, 8(6): 475.

doi: 10.3390/horticulturae8060475
[28]
WANG T, LU J X, XU Z D, YANG W R, WANG J, CHENG T R, ZHANG Q X. Selection of suitable reference genes for miRNA expression normalization by qRT-PCR during flower development and different genotypes of Prunus mume. Scientia Horticulturae, 2014, 169: 130-137.

doi: 10.1016/j.scienta.2014.02.006
[29]
MIGOCKA M, PAPIERNIAK A, RAJSZ A. Cucumber PDR8/ ABCG36 and PDR12/ABCG40 plasma membrane proteins and their up-regulation under abiotic stresses. Biologia Plantarum, 2017, 61(1): 115-126.

doi: 10.1007/s10535-016-0679-2
[30]
EICHHORN H, KLINGHAMMER M, BECHT P, TENHAKEN R. Isolation of a novel ABC-transporter gene from soybean induced by salicylic acid. Journal of Experimental Botany, 2006, 57(10): 2193-2201.

doi: 10.1093/jxb/erj179 pmid: 16720608
[31]
KHARE D, CHOI H, HUH S U, BASSIN B, KIM J, MARTINOIA E, SOHN K H, PAEK K H, LEE Y. Arabidopsis ABCG34 contributes to defense against necrotrophic pathogens by mediating the secretion of camalexin. Proceedings of the National Academy of Sciences of the United States of America, 2017, 114(28): 5712-5720.
[32]
ICHINO T, YAZAKI K. Modes of secretion of plant lipophilic metabolites via ABCG transporter-dependent transport and vesicle- mediated trafficking. Current Opinion in Plant Biology, 2022, 66: 102184.

doi: 10.1016/j.pbi.2022.102184
[33]
COLQUHOUN T A, VERDONK J C, SCHIMMEL B C J, TIEMAN D M, UNDERWOOD B A, CLARK D G. Petunia floral volatile benzenoid/phenylpropanoid genes are regulated in a similar manner. Phytochemistry, 2010, 71(2/3): 158-167.

doi: 10.1016/j.phytochem.2009.09.036
[34]
MAITI S, MITRA A. Morphological, physiological and ultrastructural changes in flowers explain the spatio-temporal emission of scent volatiles in Polianthes tuberosa L. Plant and Cell Physiology, 2017, 58(12): 2095-2111.

doi: 10.1093/pcp/pcx143
[35]
LI Y Y, MA H, WAN Y M, LI T Q, LIU X X, SUN Z H, LI Z H. Volatile organic compounds emissions from Luculia pinceana flower and its changes at different stages of flower development. Molecules, 2016, 21(4): 531.

doi: 10.3390/molecules21040531
[36]
DAFNI A, KEVAN P G. Flower size and shape: implications in pollination. Israel Journal of Plant Sciences, 1997, 45(2/3): 201-211.

doi: 10.1080/07929978.1997.10676684
[37]
YIM S, KHARE D, KANG J, HWANG J U, LIANG W Q, MARTINOIA E, ZHANG D B, KANG B, LEE Y. Postmeiotic development of pollen surface layers requires two Arabidopsis ABCG-type transporters. Plant Cell Reports, 2016, 35(9): 1863-1873.

doi: 10.1007/s00299-016-2001-3
[38]
DUDAREVA N, KLEMPIEN A, MUHLEMANN J K, KAPLAN I. Biosynthesis, function and metabolic engineering of plant volatile organic compounds. The New Phytologist, 2013, 198(1): 16-32.

doi: 10.1111/nph.2013.198.issue-1
[39]
XIN A Z, HERBURGER K. Precursor biosynthesis regulation of lignin, suberin and cutin. Protoplasma, 2021, 258(6): 1171-1178.

doi: 10.1007/s00709-021-01676-4 pmid: 34120228
[40]
HE Y X, XU J, WANG X Y, HE X M, WANG Y, ZHOU J G, ZHANG S Q, MENG X Z. The Arabidopsis pleiotropic drug resistance transporters PEN3 and PDR12 mediate camalexin secretion for resistance to Botrytis cinerea. The Plant Cell, 2019, 31(9): 2206-2222.

doi: 10.1105/tpc.19.00239
[41]
XIE X D, WANG G H, YANG L, CHENG T C, GAO J P, WU Y Q, XIA Q Y. Cloning and characterization of a novelNicotiana tabacumABC transporter involved in shoot branching. Physiologia Plantarum, 2015, 153(2): 299-306.

doi: 10.1111/ppl.2015.153.issue-2
[42]
LI R, TEE C S, JIANG Y L, JIANG X Y, VENKATESH P N, SAROJAM R, YE J. A terpenoid phytoalexin plays a role in basal defense of Nicotiana benthamiana against Potato virus X. Scientific Reports, 2015, 5: 9682.

doi: 10.1038/srep09682
[43]
FANG F, OLIVA M, OVADIA R, BAR E, NISSIM-LEVI A, KUMAR V, WANG R, NEEMAN A, ZACCAI M, LEWINSOHN E, OREN-SHAMIR M. Increased substrate availability reveals the potential of scentless lisianthus flowers in producing fragrant benzenoid- phenylpropanoids. Physiologia Plantarum, 2021, 172(1): 19-28.

doi: 10.1111/ppl.v172.1
[44]
XIE X D, CAO P J, WANG Z, GAO J P, WU M Z, LI X X, ZHANG J F, WANG Y F, GONG D P, YANG J. Genome-wide characterization and expression profiling of the PDR gene family in tobacco (Nicotiana tabacum). Gene, 2021, 788: 145637.

doi: 10.1016/j.gene.2021.145637
[45]
SRIKANT S, GAUDET R, MURRAY A W. Selecting for altered substrate specificity reveals the evolutionary flexibility of ATP-binding cassette transporters. Current Biology, 2020, 30(9): 1689-1702.

doi: S0960-9822(20)30284-0 pmid: 32220325
[46]
COLLAUTO A, MISHRA S, LITVINOV A, MCHAOURAB H S, GOLDFARB D. Direct spectroscopic detection of ATP turnover reveals mechanistic divergence of ABC exporters. Structure, 2017, 25(8): 1264-1274.

doi: S0969-2126(17)30194-6 pmid: 28712805
[1] FENG WeiQing, NI YuanQian, FEI Teng, LI YouMei, XIE ZhaoSen. Differences in Vascular Bundle Morphological Structure, Distribution, and Water Transport Function in Grape Fruits of Different Shapes [J]. Scientia Agricultura Sinica, 2026, 59(1): 161-178.
[2] ZHUANG LiHua, LUO Lei, ZHAO ChunFang, WANG JiZhong, ZHANG YaDong, HE Lei. Identification and Gene Mapping of Rice Grain Shape Mutant sgd13 [J]. Scientia Agricultura Sinica, 2025, 58(24): 5097-5109.
[3] HUANG HongMei, WANG SiQi, YANG QingChuan, GUO ChangHong, WANG Xue. Phosphate Transporter MsPT5 Regulates Phosphate Uptake and Utilization in Alfalfa [J]. Scientia Agricultura Sinica, 2025, 58(21): 4544-4556.
[4] LI YongFei, LI ZhanKui, ZHANG ZhanSheng, CHEN YongWei, KANG JianHong, WU HongLiang. Effects of Postponing Nitrogen Fertilizer Application on Flag Leaf Physiological Characteristics and Yield of Spring Wheat Under High Temperature Stress [J]. Scientia Agricultura Sinica, 2024, 57(8): 1455-1468.
[5] LUO LiDan, CHEN JiaMing, AN Qi, LIU Lei, SUN QinZhe, LIU Huan, WANG SenShan, SONG LiWen. Effects of Extreme High Temperature on Trehalose Content and Trehalose Transporter Gene in Tetranychus truncatus [J]. Scientia Agricultura Sinica, 2024, 57(6): 1091-1101.
[6] ZHAO YiYan, GUO HongFang, LIU WeiMin, ZHAO XiaoMing, ZHANG JianZhen. Effects of Apolipophorin on Ovarian Development and Lipid Deposition in Locusta migratoria [J]. Scientia Agricultura Sinica, 2024, 57(4): 711-720.
[7] SHI DeYang, LI YanHong, WANG FeiFei, XIA DeJun, JIAO YanLin, SUN NiNa, ZHAO Jian. Regulation Effects of Line-Spacing Expansion and Row-Spacing Shrinkage on Dry Matter and Nutrient Accumulation and Transport of Summer Maize Under High Plant Density [J]. Scientia Agricultura Sinica, 2024, 57(23): 4658-4672.
[8] LIU YiHan, MU QingShan, HE Xiang, CHEN Min, HU Jin, GUAN YaJing. Study on the Involvement of OsFWL3 in the Regulation of Metal Ion Transport and Accumulation in Rice [J]. Scientia Agricultura Sinica, 2024, 57(21): 4161-4174.
[9] YIN YuQin, XU HuanHuan, TANG LiPing, WANG XinYa, HU ChunMei, HOU XiLin, LI Ying. Genome-Wide Identification of GST Gene Family and Functional Analysis of the BcGSTF6 Gene Related to Anthocyanin in Pak Choi [J]. Scientia Agricultura Sinica, 2024, 57(16): 3234-3249.
[10] WEI XiaoDong, SONG XueMei, WANG Ning, ZHAO QingYong, ZHU Zhen, CHEN Tao, ZHAO Ling, WANG CaiLin, ZHANG YaDong. Distribution Characteristics of Photosynthetic Products of Nanjing Series of Super Rice During Filling Stage [J]. Scientia Agricultura Sinica, 2024, 57(12): 2309-2321.
[11] WANG Yu, SONG YiFan, ZHANG Rong, MU HaiMeng, SUN LiFang, FU KaiXia, WU ZiJun, HUANG QingQing, XU YingMing, LI GeZi, WANG YongHua, GUO TianCai. Effects of Soil Application of Passivating Agent and Compound Microbial Fertilizer on Cadmium Accumulation in Winter Wheat [J]. Scientia Agricultura Sinica, 2024, 57(1): 126-141.
[12] WU SiHui, ZHU HuanHuan, ZHANG JunWei, BAO ManZhu, ZHANG Jie. Determination and Analysis of Flavonoids Metabolites in Different Colors Cultivars and Blooming Stages of Prunus mume [J]. Scientia Agricultura Sinica, 2023, 56(9): 1760-1774.
[13] ZHANG PengYun, CHEN Min, LIU MingXing, ZHOU Hong, LIN HuiXing, FAN HongJie. Development and Application of Indirect ELISA Kits for Antibody Detection of Haemophilus parasuis [J]. Scientia Agricultura Sinica, 2023, 56(8): 1606-1614.
[14] AN Yong, QIN ShiZhen, SHI ZhaoGuo, GONG LiYuan, ZHANG Shuai, JI Feng. Influences of Phosphorus Level in Diet of Parent Pigeons on Biochemical Index, Untargeted Metabolomics Profile of Serum, and Gene Expression of Phosphate Transporters in Squabs [J]. Scientia Agricultura Sinica, 2023, 56(23): 4772-4788.
[15] CHAO ChengSheng,WANG YuQian,SHEN XinJie,DAI Jing,GU ChiMing,LI YinShui,XIE LiHua,HU XiaoJia,QIN Lu,LIAO Xing. Characteristics of Efficient Nitrogen Uptake and Transport of Rapeseed at Seedling Stage [J]. Scientia Agricultura Sinica, 2022, 55(6): 1172-1188.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!