Loading...

Archive

    2019 Vol. 18 No. 12 Previous Issue    Next Issue

    Crop Science
    Horticulture
    Plant Protection
    Animal Science · Veterinary Medicine
    Agro-ecosystem & Environment
    Agricultural Economics and Management


      Cover illustration

    For Selected: Toggle Thumbnails
    Crop Science
    Gene mapping and candidate gene analysis of multi-floret spikelet 3 (mfs3) in rice (Oryza sativa L.)
    ZHENG Hao, ZHANG Jun, ZHUANG Hui, ZENG Xiao-qin, TANG Jun, WANG Hong-lei, CHEN Huan, LI Yan, LING Ying-hua, HE Guang-hua, LI Yun-feng
    2019, 18(12): 2673-2681.  DOI: 10.1016/S2095-3119(19)62652-3
    Abstract ( )   PDF in ScienceDirect  
    Rice (Oryza sativa L.) is one of the most important food crops worldwide and a model monocot plant for gene function analysis, so it is an ideal system for studying flower development.  This study reports a mutant, named multi-floret spikelet 3 (mfs3), which is related to the spikelet development in rice and derived from the ethylmethane sulfonate (EMS)-treated rice cultivar XIDA 1B.  In mfs3, the main body of palea (bop) was degenerated severely and only glume-like marginal regions of palea (mrp) remained, while other floral organs developed normally, indicating that the palea identity was seriously influenced by the mutation.  It was also observed that the number of floral organs was increased in some spikelets, including 2 lemmas, 4 mrp, 4 lodicules, 8–10 stamens, and 2 pistils, which meant that the spikelet determinacy was lost to some degree in mfs3.  Furthermore, genetic analysis demonstrated that the mfs3 trait was controlled by a single recessive gene.  Using 426 F2 mutants derived from the cross between sterile line 56S and mfs3, the MULTI-FLORET SPIKELET 3 (MFS3) gene was mapped between the molecular markers RM19347 and RM19352 on Chr.6, with a physical distance of 106.3 kb.  Sequencing of candidate genes revealed that an 83-bp fragment loss and a base substitution occurred in the LOC_Os06g04540 gene in the mutant, confirming preliminarily that the LOC_Os06g04540 gene was the MFS3 candidate gene.  Subsequent qPCR analysis showed that the mutation caused the down-regulation of OsMADS1 and FON1 genes, and the up-regulation of OsIDS1 and SNB genes, which are all involved in the regulation of spikelet development.  The MFS3 mutation also significantly reduced the transcription of the REP gene, which is involved in palea development.  These results indicated that the MFS3 gene might be involved in the spikelet meristem determinacy and palea identity by regulating the expression of these related genes.
    TaSAUR78 enhances multiple plant abiotic stress responses by regulating the interacting gene TaVDAC1
    GUO Yuan, XU Chang-bing, SUN Xian-jun, HU Zheng, FAN Shou-jin, JIANG Qi-yan, ZHANG Hui
    2019, 18(12): 2682-2690.  DOI: 10.1016/S2095-3119(19)62651-1
    Abstract ( )   PDF in ScienceDirect  
    SMALL AUXIN-UP RNAs (SAURs) regulated by abiotic stress play multiple functions in plants.  However, the functions of SAURs in abiotic stress are largely unknown.  In this study, we cloned a novel SAUR gene, TaSAUR78, from wheat, and we found that TaSAUR78 interacted with TaVDAC1 (voltage-dependent anion channel).  Salt stress decreased expression of TaSAUR78 and increased expression of TaVDAC1.  Overexpression of TaSAUR78 enhanced tolerance to salt, drought, and freezing stresses in transgenic Arabidopsis and reduced the accumulation of reactive oxygen species (ROS) under salt stress.  Overexpression of TaVDAC1 enhanced tolerance to salt stress, while decreased tolerance to drought and low temperature stresses in transgenic Arabidopsis.  TaVDAC1 overexpression increased the accumulation of ROS in plants.  These results suggested that TaSAUR78 improved plant tolerance to abiotic stresses by regulating TaVDAC1.  This study generated valuable information on the functions of TaSAUR78 and TaVDAC1 in multiple abiotic stresses, which may facilitate the deployment of these genes to enhance crop tolerance to abiotic stresses in the future.
    TaARR1, a cytokinin response regulator gene in Triticum aestivum, is essential in plant N starvation tolerance via regulating the N acquisition and N assimilation
    YANG Meng-ya, CHEN Jia-qi, TIAN He-yang, NI Chen-yang, XIAO Kai
    2019, 18(12): 2691-2702.  DOI: 10.1016/S2095-3119(19)62698-5
    Abstract ( )   PDF in ScienceDirect  
    Plant N starvation response is closely associated with the N signaling components that involve transduction of the low-N cues.  In this study, we functionally characterized TaARR1, a cytokinin (CK) response regulator gene in Triticum aestivum, in mediating the N starvation adaptation in plants.  TaARR1 harbors two conserved domains specified by plant ARR family members; subcellular localization analysis indicated its target onto nucleus after endoplasmic reticulum assortment.  TaARR1 displayed modified expression upon the N starvation stressor, showing upregulated expression in roots and leaves over a 27-h N starvation treatment and whose induced transcripts were gradually recovered along with progression of the N recovery treatment.  The tobacco lines overexpressing TaARR1 displayed improved low-N stress tolerance, displaying enlarged phenotype, increased biomass and N accumulation, and enhanced glutamine synthetase (GS) activities compared with wild type (WT) following the N starvation treatment.  Expression analysis on genes encoding the nitrate transporter (NRT) and GS proteins in Nicotiana tabacum revealed that NtNRT2.2 and NtGS3 are upregulated in expression in the N-deprived transgenic lines, whose expression patterns were contrasted to other above family genes that were unaltered on transcripts between the transgenic lines and WT.  Transgene analysis validated the function of NtNRT2.2 and NtGS3 in regulating N accumulation, GS activity, growth traits, and N use efficiency in plants.  These results suggested the internal connection between the TaARR1-mediated N starvation tolerance and the modified transcription of distinct N acquisition- and assimilation-associated genes.  Our investigation together indicates that TaARR1 is essential in plant N starvation adaptation due to the gene function in transcriptionally regulating distinct NRT and GS genes that affect plant N uptake and assimilation under the N starvation condition.
    Differential responses of root growth to nutrition with different ammonium/nitrate ratios involve auxin distribution in two tobacco cultivars
    MENG Lin, DONG Jian-xin, WANG Shu-sheng, SONG Ke, LING Ai-fen, YANG Jin-guang, XIAO Zhi-xin, LI Wei, SONG Wen-jing, LIANG Hong-bo
    2019, 18(12): 2703-2715.  DOI: 10.1016/S2095-3119(19)62595-5
    Abstract ( )   PDF in ScienceDirect  
    Nitrogen (N), the major forms of which are nitrate (NO3–) and ammonium (NH4+), plays an important role in plant growth and mediation of root development.  However, the role of auxin in root growth in response to different NH4+/NO3– ratios remains unclear.  Two tobacco cultivars (Nicotiana tabacum L.) were adopted in this study, which displayed variant growth features under the situations with sole NO3– nutrition ratio (NH4+/NO3– ratio: 0/100), low NO3– nutrition ratio (NH4+/NO3– ratio: 97/3), and optimal NH4+/NO3– ratio (50/50).  We investigated the effects of the different NH4+/NO3– ratios on the formation and elongation of lateral roots (LRs), auxin concentration, DR5::GUS expression, 3H-labeled indole acetic acid ([3H]IAA) transport, and the expression of six PIN genes in tobacco roots.  We also examined the effects of exogenous auxin and a transport inhibitor on LRs growth.  The results are shown as follows, compared to optimal N nutrition conditions, the biomass and nitrogen (N) accumulation were largely reduced by sole and low NO3– nutrition treatment in NC89, but no difference was observed in Zhongyan 100.  In most cases, sole and low NO3– nutrition impaired the elongation and formation of first-order lateral roots (1° LRs), only in NC89, thus reducing the root growth.  IAA concentration and DR5::GUS expression levels decreased in roots when NC89 was subjected to sole and low NO3– nutrition media, suggesting that different NH4+/NO3– ratios affect the transport of auxin from leaves to roots.  Results were similar following exogenous NAA application to low NO3– nutrition treated seedlings.  Based on direct [3H]IAA transport measurement, the transport of polar auxin from shoots to roots decreased due to low NO3– nutrition.  PIN4 expression levels were markedly decreased in roots of NC89 by sole and low NO3– nutrition, while they were unaffected in Zhongyan 100 roots.  Overall, our findings suggest that LRs formation in tobacco seedlings is regulated by NH4+/NO3– ratios via modifying polar transport of auxin.
     
    Optimizing integrative cultivation management improves grain quality while increasing yield and nitrogen use efficiency in rice
    ZHANG Hao, HOU Dan-ping, PENG Xian-long, MA Bing-ju, SHAO Shi-mei, JING Wen-jiang, GU Jun-fei, LIU Li-jun, WANG Zhi-qin, LIU Yuan-ying, YANG Jian-chang
    2019, 18(12): 2716-2731.  DOI: 10.1016/S2095-3119(19)62836-4
    Abstract ( )   PDF in ScienceDirect  
    A major challenge in rice (Oryza sativa L.) production is to cope with increasing grain yield and fertilizer use efficiency without compromising grain quality.  This study was designed to determine if optimizing integrative cultivation management in rice could improve grain quality while increase yield and nitrogen use efficiency (NUE).  An indica-japonica hybrid rice cultivar and a japonica rice cultivar were grown in the field, with five cultivation managements including no N application (0 N), local farmer’s practice (LFP), and three optimizing integrative cultivation managements, reducing N rate and increasing plant density (ND), ND+alternate wetting and moderate soil drying irrigation (NDW), and NDW+applying rapeseed cake fertilizer (NDWR).  The results showed that the optimizing integrative cultivation managements could not only increase grain yield, but also enhance NUE compared to LFP.  Compared to LFP, NDWR significantly increased brown, milled, head milled rice rate, ratio of the kernel length to breadth and breakdown value of starch, whereas decreased amylose content, gel consistency, prolamin content, setback value, percentage of chalky kernels, and chalkiness.  The three optimizing integrative cultivation managements increased contents of total proteins, albumin and glutelin, activities of the key enzymes involved in the sucrose-starch conversion in grains, root oxidation activity, and malic and succinic acid concentrations in root exudates during the grain-filling period.  The results suggested that optimizing integrative cultivation managements could improve grain quality meanwhile increase grain yield and NUE by enhancing physiological activities of rice plants.
    Diurnal variation of gas exchange, chlorophyll fluorescence, and photosynthetic response of six parental lines of maize released in three eras
    LI Cong-feng, DONG Shu-ting, LIU Rui-xian, REN Hong, DING Zai-song, ZHAO Ming
    2019, 18(12): 2732-2743.  DOI: 10.1016/S2095-3119(19)62693-6
    Abstract ( )   PDF in ScienceDirect  
    Over the past seven decades, the grain yield of maize (Zea mays L.) has increased continuously in China, mostly due to hybridization innovations, particularly recent genetic improvements in photosynthesis.  In order to reveal photosynthetic characters of elite inbred lines in different ears, a field experiment was conducted at the North China Plain of Shandong Province in China.  Six parental lines of maize introduced in three eras (the 1960s, 1980s, and 2000s) were investigated diurnal variation of gas exchange, chlorophyll fluorescence, and photosynthetic response characteristic at the grain filling stage.  Compared to earlier parental lines, the 2000s parental lines always had higher net photosynthetic rate (Pn) throughout the day, especially at noon, and a mid-day depression in Pn did not occur in all hybrids parental lines.  Moreover, the stomatal conductance (Gs) and water use efficiency (WUE) of the 2000s’ lines showed higher value than those of the 1960s’ and 1980s’ lines.  The inbred lines differences in photosynthetic parameters were partly owing to their different quantum carboxylation efficiencies and light synthase activities.  Simultaneously, the 2000s parental lines exhibited lower light and CO2 compensation points, and their higher apparent quantum yield, and carboxylation efficiency.  These suggested that the modern parental lines required lower light intensity and less CO2 to maintain a relatively high photosynthetic capacity, substantially increasing leaf physical quality and stress resistance.  It provided crucial information of high photo-efficiency and stress-resistance breeding in maize.
    Physiological and molecular responses to cold stress in rapeseed (Brassica napus L.)
    YAN Lei, Tariq Shah, CHENG Yong, Lü Yan, ZHANG Xue-kun, ZOU Xi-ling
    2019, 18(12): 2742-2752.  DOI: 10.1016/S2095-3119(18)62147-1
    Abstract ( )   PDF in ScienceDirect  
    Low temperature is one of the most important abiotic factors inhibiting growth, productivity, and distribution of rapeseed (Brassica napus L.).  Therefore, it is important to identify and cultivate cold-tolerant germplasm.  The objective of this study was to figure out the mechanism of chilling (4 and 2°C) and freezing (–2 and –4°C) stresses along with a control (22°C) in B. napus cultivars (1801 and C20) under controlled environment (growth chamber).  The experiment was arranged in a complete randomized design with three replications.  Our results exhibited that under chilling and freezing stresses, the increment of proline accumulation, soluble sugar and protein contents, and antioxidant enzyme activity were enhanced more in 1801 cultivar compared with C20 cultivar.  At –2 and –4°C, the seedlings of C20 cultivar died completely compared with 1801 cultivar.  Hydrogen peroxide (H2O2) and malondialdehyde contents (MDA) increased in both cultivars, but when the temperature was decreased up to –2 and –4°C, the MDA and H2O2 contents continuously dropped in 1801 cultivar.  Moreover, we found that leaf abscisic acid (ABA) was enhanced in 1801 cultivar under chilling and freezing stresses.  Additionally, the transcriptional regulations of cold-tolerant genes (COLD1, CBF4, COR6.6, COR15, and COR25) were also determined using real-time quantitative PCR (RT-qPCR).  RT-qPCR showed that higher expression of these genes were found in 1801 as compared to C20 under cold stress (chilling and freezing stresses).  Therefore, it is concluded from this experiment that 1801 cultivar has a higher ability to respond to cold stress (chilling and freezing stresses) by maintaining hormonal, antioxidative, and osmotic activity along with gene transcription process than C20.  The result of this study will provide a solid foundation for understanding physiological and molecular mechanisms of cold stress signaling in rapeseed (B. napus).
    Horticulture
    Evolution of the R2R3-MYB gene family in six Rosaceae species and expression in woodland strawberry
    LIU Hui, XIONG Jin-song, JIANG Yue-ting, WANG Li, CHENG Zong-ming (Max)
    2019, 18(12): 2753-2770.  DOI: 10.1016/S2095-3119(19)62818-2
    Abstract ( )   PDF in ScienceDirect  
    R2R3-MYB gene family play important roles in plants development, metabolism, and responses to various biotic and abiotic stresses.  In this study, 838 R2R3-MYB genes were identified from six Rosaceae species, including 105 in woodland strawberry (Fragaria vesca), 173 in European pear (Pyrus communis), 219 in apple (Malus domestica), 121 in peach (Prunus persica), 121 in Chinese rose (Rosa chinensis), and 99 in black raspberry (Rubus occidentalis).  All R2R3-MYB genes in the six Rosaceae species were clustered into 51 species-specific duplicated clades with 109 genes and 50 lineage-specific duplicated clades with 242 genes according to phylogenetic analysis.  R2R3-MYB genes were distributed on all chromosomes in each of the six species, with a small amount of tandem duplication events.  The proportion of tandem repeat genes ranged from 0 to 25.1%.  The R2R3-MYB protein was conserved in a clade and likely to share similar functions.  The distribution of Ks showed the duplication times of R2R3-MYB genes in six Rosaceae species.  Furthermore, most of the R2R3-MYB genes had Ka/Ks values less than 1, which indicated they were driven by purifying selection during the evolutionary processes.  The GO term enrichment analysis revealed that R2R3-MYB genes in strawberry and black raspberry were more divergent than in other Rosaceae species.  Analysis of transcriptomes of 42 different tissues and development stages of woodland strawberry showed that high expression levels of R2R3-MYB suggested that the R2R3-MYB genes in strawberry played a key role in growth and development of both vegetative tissues and fruits.  The strawberry R2R3-MYB genes in sub-group of S1, S2, S11, S20, and S22 had high expression levels both in young leaves (YL) and old leaves (OL) strawberry tissues under drought treatments.
    Deciphering codon usage patterns and evolutionary forces in chloroplast genes of Camellia sinensis var. assamica and Camellia sinensis var. sinensis in comparison to Camellia pubicosta
    Sophiarani Yengkhom, Arif Uddin, Supriyo Chakraborty
    2019, 18(12): 2771-2785.  DOI: 10.1016/S2095-3119(19)62716-4
    Abstract ( )   PDF in ScienceDirect  
    Codon usage bias (CUB) is a unique property of genome which refers to non-random usage of synonymous codons in coding sequences.  The present study makes an attempt to find out the pattern of CUB in chloroplast (cp) genes among three tea species, i.e., Camellia sinensis var. assamica (Assam tea), Camellia sinensis var. sinensis (Chinese tea) and Camellia pubicosta (wild tea species) as no work on CUB was reported earlier.  To understand the patterns of codon usage among the cp genes of three tea groups, we used bioinformatic tools to investigate the protein coding sequences of cp genes.  In our present study, the mean nucleobase T was the highest whereas C was the lowest in all the three tea groups.  The overall AT content was more than GC content, i.e., genes were AT rich.  The scaled chi-square (SCS) value indicated that the CUB of cp genes was low.  The codon CGT (Arg) was over-represented in C. sinensis var. sinensis whereas GGA (Pro) was over-represented in C. pubicosta species.  Heatmap study revealed that most of the GC ending codons showed positive correlations between codon usage and GC3 while AT ending codons exhibited negative correlations.  From neutrality plot analysis, it was evident that natural selection had played a major role, while mutation pressure exerted a minor effect in the CUB of cp genes in three tea groups.  Highly significant (P<0.01) positive correlation was found between SCS and synonymous codon usage order (SCUO) of cp genes which suggested that high expression of cp genes was associated with high degree of CUB.
    Plant Protection
    Identification of three Berberis species as potential alternate hosts for Puccinia striiformis f. sp. tritici in wheat-growing regions of Xinjiang, China
    ZHUANG Hua, ZHAO Jing, HUANG Li-li, KANG Zhen-sheng, ZHAO Jie
    2019, 18(12): 2786-2792.  DOI: 10.1016/S2095-3119(19)62709-7
    Abstract ( )   PDF in ScienceDirect  
    Since the recent discovery of barberry (Berberis spp.) as an alternate host for the stripe rust pathogen Puccinia striiformis, many Chinese Berberis species have been identified as alternate hosts for P. striiformis f. sp. tritici.  However, little is known about Berberis species and their distribution in wheat-growing regions in Xinjiang, China, where stripe rust is endemic.  As the largest province or autonomous region, Xinjiang represents a relatively independent epidemic region for wheat stripe rust in China.  In this study, we conducted a survey of barberry plants in the main wheat-growing areas of Xinjiang.  We identified three Berberis species, B. heteropoda, B. nummularia and B. kaschgarica, and confirmed their roles as potential alternate hosts for P. striiformis f. sp. tritici in the laboratory. 
    Fitness of F1 hybrids between stacked transgenic rice T1c-19 with cry1C*/bar genes and weedy rice
    HUANG Yao, WANG Yuan-yuan, QIANG Sheng, SONG Xiao-ling, DAI Wei-min
    2019, 18(12): 2793-2805.  DOI: 10.1016/S2095-3119(19)62662-6
    Abstract ( )   PDF in ScienceDirect  
    Compared to single-trait transgenic crops, stacked transgenic plants may be more prone to become weedy, and transgene flow from stacked transgenic plants to weedy relatives may pose a potential environmental risk because these hybrids could be more advantageous under specific environmental conditions.  Evaluation of the potential environmental risk caused by stacked transgenes is essential for assessing the environmental consequences caused by crop-weed transgene flow.  The agronomic performance of fitness-related traits was assessed in F1+ (transgene positive) hybrids (using the transgenic line T1c-19 as the paternal parent) in monoculture and mixed planting under presence or absence glufosinate pressure in the presence or absence of natural insect pressure and then compared with the performance of F1– (transgene negative) hybrids (using the non-transgenic line Minghui 63 (MH63) as the paternal parent) and their weedy rice counterparts.  The results demonstrated that compared with the F1– hybrids and weedy rice counterparts, the F1+ hybrid presented higher performance (P<0.05) or non-significant changes (P>0.05) under natural insect pressure, respectively, lower performance (P<0.05) or non-significant changes (P>0.05) in the absence of insect pressure in monoculture planting, respectively.  And compared to weedy rice counterparts, the F1+ hybrid presented higher performance (P<0.05) or non-significant changes (P>0.05) in the presence or absence of insect pressure in mixed planting, respectively.  The F1+ hybrids presented non-significant changes (P>0.05) under the presence or absence glufosinate pressure under insect or non-insect pressure in monoculture planting.  The all F1+ hybrids and two of three F1– hybrids had significantly lower (P<0.05) seed shattering than the weedy rice counterparts.  The potential risk of gene flow from T1c-19 to weedy rice should be prevented due to the greater fitness advantage of F1 hybrids in the majority of cases. 
    Molecular characterization and functional analysis of two new lysozyme genes from soybean cyst nematode (Heterodera glycines)
    WANG Ning, PENG Huan, LIU Shi-ming, HUANG Wen-kun, Ricardo Holgado, Jihong Liu-Clarke, PENG De-liang
    2019, 18(12): 2806-2813.  DOI: 10.1016/S2095-3119(19)62766-8
    Abstract ( )   PDF in ScienceDirect  
    Soybean cyst nematode (SCN, Heterodera glycines (I.)) is one of the most important soil-borne pathogens for soybeans.  In plant parasitic nematodes, including SCN, lysozyme plays important roles in the innate defense system.  In this study, two new lysozyme genes (Hg-lys1 and Hg-lys2) from SCN were cloned and characterized.  The in situ hybridization analyses indicated that the transcripts of both Hg-lys1 and Hg-lys2 accumulated in the intestine of SCN.  The qRT-PCR analyses showed that both Hg-lys1 and Hg-lys2 were upregulated after SCN second stage juveniles (J2s) were exposed to the Gram-positive bacteria Bacillus thuringiensis, Bacillus subtilis or Staphylococcus aureus.  Knockdown of the identified lysozyme genes by in vitro RNA interference caused a significant decrease in the survival rate of SCN.  All of the obtained results indicate that lysozyme is very important in the defense system and survival of SCN. 
    LncRNAs are potentially involved in the immune interaction between small brown planthopper and rice stripe virus
    CHEN Meng-yao, YE Wan-yi, XIAO Hua-mei, LI Mei-zhen, CAO Zheng-hong, YE Xin-hai, ZHAO Xian-xin, HE Kang, LI Fei
    2019, 18(12): 2814-2822.  DOI: 10.1016/S2095-3119(19)62569-4
    Abstract ( )   PDF in ScienceDirect  
    Small brown planthopper (SBPH, Laodelphax striatellus Fallén) is an important vector of major crop pathogen rice stripe virus (RSV).  Controlling SBPH population is an efficient approach to control RSV.  Long non-coding RNAs (lncRNA) have been reported to block virus replication in hosts.  However, the function of lncRNAs in RSV infection and replication is still unknown.  Here, we aimed to study regulatory mechanisms of lncRNA in an immune system during RSV infection.  First, lncRNA genes were predicted from SBPH transcriptomes using a bioinformatics pipeline based on characteristics of lncRNA.  We identified 4 786 lncRNA genes corresponding to 5 790 transcripts in SBPH from an RNA-Seq dataset of 15 transcriptomes.  Differential expression analysis indicated that 3, 11, and 25 lncRNA genes were highly expressed in gut, salivary gland, and ovary, respectively, of viruliferous SBPH (Student’s t-test, P<0.05).  We randomly selected eight lncRNAs for expression validation using quantitative real-time PCR, confirming the differential expression of these lncRNAs between viruliferous and non-viruliferous SBPH.  In summary, we present evidence that the expression of lncRNA genes was induced by RSV infection, suggesting that RSV might be involved in the antivirus immune system in SBPH and participate in regulating the RSV replication mechanism.  These data provide helpful information for future investigations of the interaction between lncRNA and RSV. 
    Physiological, histopathological and cellular immune effects of Pergularia tomentosa extract on Locusta migratoria nymphs
    Meriam Miladi, Khemais Abdellaoui, Amel Ben Hamouda, Iteb Boughattas, Mouna Mhafdhi, Fatma Acheuk, Monia Ben Halima-Kamel
    2019, 18(12): 2823-2834.  DOI: 10.1016/S2095-3119(19)62704-8
    Abstract ( )   PDF in ScienceDirect  
    The migratory locust Locusta migratoria (Orthoptera, Acrididae) is one of the most important pests due to its extensive and severe damage to crops in large parts of Africa and Asia.  Biodegradable and ecologically natural products such as botanical insecticides are emerging candidates for replacement of usually applied chemical pesticides.  The crude methanolic extract of Pergularia tomentosa (PME) was investigated for their toxicity and physiological aspects on L. migratoria nymphs.  Results showed that treatment of newly emerged fourth and fifth instar nymphs resulted in significant mortality and significant repellent activity with an LC50 value of 0.18 and 0.38%, respectively, after seven days of treatment.  The PME toxicity was also demonstrated by histopathological changes in the alimentary canal resulting in considerable disorganization and severe damage of the caeca and proventriculus structure.  The extract induced cellular immune reactions which manifested by a significant decrease in the number of the differential haemocyte counts (prohemocytes and plasmatocytes) and important cell lysis.  Data of biochemical analyses showed that the PME reduced the activity of acetylcholinesterase and induced the glutathione S-transferases.  The neurotoxic effect was confirmed by the histological alterations in the brain structure, particularly in the neurosecretory cells showing typical signs of cell necrosis.
    Animal Science · Veterinary Medicine
    Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines
    ZHOU Zheng-wei, CAO Guo-hua, LI Zhe, HAN Xue-jie, LI Chen, LU Zhen-yu, ZHAO Yu-hang, LI Xue-ling
    2019, 18(12): 2835-2843.  DOI: 10.1016/S2095-3119(19)62744-9
    Abstract ( )   PDF in ScienceDirect  
    The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding.  In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of gRNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding.  A 20-bp gRNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site.  The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using gRNAs truncated by 1, 2, 3 and 5 bp, respectively.  These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting.  PCR was performed for each off-target site.  All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared.  The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed.  The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively; rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively; all were 0% at the Off-MSTN-2 locus; rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively.  The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower.  This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp gRNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting.  This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.
    Milk production and composition and metabolic alterations in the mammary gland of heat-stressed lactating dairy cows
    FAN Cai-yun, SU Di, TIAN He, HU Rui-ting, RAN Lei, YANG Ying, SU Yan-jing, CHENG Jian-bo
    2019, 18(12): 2844-2854.  DOI: 10.1016/S2095-3119(19)62834-0
    Abstract ( )   PDF in ScienceDirect  
    This experiment was conducted to investigate the effects of heat stress (HS) on the feed intake, milk production and composition and metabolic alterations in the mammary gland of dairy cows.  Twenty Holstein cows were randomly assigned to one of two treatments according to a completely randomized design.  Half of the cows were allocated to the HS group in August (summer season), and the other half were assigned to the HS-free group in November (autumn season).  HS reduced (P<0.01) dry matter intake (DMI), milk yield, milk protein and milk urea nitrogen (MUN) of cows compared with HS-free control, but increased (P<0.01) milk somatic cell counts (SCC).  We determined the HS-induced metabolic alterations and the relevant mechanisms in dairy cows using liquid chromatography mass spectrometry combined with multivariate analyses.  Thirty-four metabolites were identified as potential biomarkers for the diagnosis of HS in dairy cows.  Ten of these metabolites, glucose, lactate, pyruvate, lactose, β-hydroxybutyrate, citric acid, α-ketoglutarate, urea, creatine, and orotic acid, had high sensitivity and specificity for HS diagnoses, and seven metabolites were also identified as potential biomarkers of HS in plasma, milk, and liver.  These substances are involved in glycolysis, lactose, ketone, tricarboxylic acid (TCA), amino acid and nucleotide metabolism, indicating that HS mainly affects lactose, energy and nucleotide metabolism in the mammary gland of lactating dairy cows.  This study suggested that HS might affect milk production and composition by affecting the feed intake and substance metabolisms in the mammary gland tissue of lactating dairy cows.
    Agro-ecosystem & Environment
    The effects of aerated irrigation on soil respiration, oxygen, and porosity
    ZHU Yan, Miles Dyck, CAI Huan-jie, SONG Li-bing, CHEN Hui
    2019, 18(12): 2854-2868.  DOI: 10.1016/S2095-3119(19)62618-3
    Abstract ( )   PDF in ScienceDirect  
    To ameliorate soil oxygen deficiencies around subsurface drip irrigation (SDI) drippers, aerated irrigation (AI) was introduced to supply aerated water to the soil through venturi installed in the SDI pipeline.  The objectives of this study were to assess the effects of AI on soil respiration (SR), air-filled porosity (AFP), soil temperature (ST), and oxygen concentrations (OCC).  Total soil respiration (TSR), biological activity temperature index (BAT), and soil oxygen consumption (OCS) based on SR, ST, and OCC, respectively, were subsequently calculated to explore the relationships between TSR, BAT, OCS, OCC, and AFP.  Greenhouse-based experiments included two treatments: AI and unaerated SDI (CK), during the tomato growing season in the fall of 2015.  The results showed that compared with CK, AI treatment significantly increased OCC and AFP (by 16 and 7.4%, respectively), as well as TSR and OCS (by 24.21 and 22.91%, respectively) (P<0.05).  Mean fruit yield with AI treatment was also 23% higher (P<0.05) than that with CK.  When BAT was controlled, partial correlations between TSR, OCS, OCC, and AFP were all significant in the AI treatment but not in the CK treatment.  TSR was more sensitive to the interaction effects of OCC, OCS, AFP, and BAT under the AI treatment.  Thus, the significantly increased TSR with AI appeared to be due to the favorable soil aeration conditi ons (higher OCC and AFP).  Furthermore, the improvements in soil aeration conditions and respiration with AI appeared to facilitate the improvement in fruit yields, which also suggests the economic benefits of AI.
    Spatial distribution of air temperature and relative humidity in the greenhouse as affected by external shading in arid climates
    Hesham A. Ahmed, TONG Yu-xin, YANG Qi-chang, Abdulellah A. Al-Faraj, Ahmed M. Abdel-Ghany
    2019, 18(12): 2869-2882.  DOI: 10.1016/S2095-3119(19)62598-0
    Abstract ( )   PDF in ScienceDirect  
    The effect of external roof shading on the spatial distribution of air temperature and relative humidity in a greenhouse (Tin and RHin) was evaluated under the arid climatic conditions of Riyadh City, Saudi Arabia.  Two identical, evaporatively-cooled, single-span greenhouses were used in the experiment.  One greenhouse was externally shaded (Gs) using a movable black plastic net (30% transmissivity), and the other greenhouse was kept without shading (Gc).  Strawberry plants were cultivated in both greenhouses.  The results showed that the spatial distribution of the Tin and RHin was significantly affected by the outside solar radiation and evaporative cooling operation.  The regression analysis showed that when the outside solar radiation intensity increased from 200 to 800 W m–2, the Tin increased by 4.5°C in the Gc and 2°C in the Gs, while the RHin decreased by 15% in the Gc and 5% in the Gs, respectively.  Compared with those in the Gc, more uniformity in the spatial distribution of the Tin and RHin was observed in the Gs.  The difference between the maximum and minimum Tin of 6.4°C and the RHin of 10% was lower in the Gs than those in the Gc during the early morning.  Around 2°C difference in the Tin was shown between the area closed to the exhausted fans and the area closed to the cooling pad with the external shading.  In an evaporatively-cooled greenhouse in arid regions, the variation of the Tin and RHin in the vertical direction and along the sidewalls was much higher than that in the horizontal direction.  The average variation of the Tin and RHin in the vertical direction was 5.2°C and 10% in the Gc and 5.5°C and 13% in the Gs, respectively.  The external shading improved the spatial distribution of the Tin and RHin and improved the cooling efficiency of the evaporative cooling system by 12%, since the transmitted solar radiation and accumulated thermal energy in the greenhouse were significantly reduced. 
    High resolution crop intensity mapping using harmonized Landsat-8 and Sentinel-2 data
    HAO Peng-yu, TANG Hua-jun, CHEN Zhong-xin, YU Le, WU Ming-quan
    2019, 18(12): 2883-2897.  DOI: 10.1016/S2095-3119(19)62599-2
    Abstract ( )   PDF in ScienceDirect  
    An increase in crop intensity could improve crop yield but may also lead to a series of environmental problems, such as depletion of ground water and increased soil salinity.  The generation of high resolution (30 m) crop intensity maps is an important method used to monitor these changes, but this is challenging because the temporal resolution of the 30-m image time series is low due to the long satellite revisit period and high cloud coverage.  The recently launched Sentinel-2 satellite could provide optical images at 10–60 m resolution and thus improve the temporal resolution of the 30-m image time series.  This study used harmonized Landsat Sentinel-2 (HLS) data to identify crop intensity.  The sixth polynomial function was used to fit the normalized difference vegetation index (NDVI) and enhanced vegetation index (EVI) curves.  Then, 15-day NDVI and EVI time series were then generated from the fitted curves and used to generate the extent of croplands.  Lastly, the first derivative of the fitted VI curves were used to calculate the VI peaks; spurious peaks were removed using artificially defined thresholds and crop intensity was generated by counting the number of remaining VI peaks.  The proposed methods were tested in four study regions, with results showing that 15-day time series generated from the fitted curves could accurately identify cropland extent.  Overall accuracy of cropland identification was higher than 95%.  In addition, both the harmonized NDVI and EVI time series identified crop intensity accurately as the overall accuracies, producer’s accuracies and user’s accuracies of non-cropland, single crop cycle and double crop cycle were higher than 85%.  NDVI outperformed EVI as identifying double crop cycle fields more accurately.
    Agricultural Economics and Management
    Farm size and fertilizer sustainable use: An empirical study in Jiangsu, China
    HU Ling-xiao, ZHANG Xiao-heng, ZHOU Ying-heng
    2019, 18(12): 2898-2909.  DOI: 10.1016/S2095-3119(19)62732-2
    Abstract ( )   PDF in ScienceDirect  
    Inefficient use of fertilizer has caused serious environmental problems and unsustainable development of agriculture in China.  To meet the increasing food demand in the future without damaging the ecological environment, Chinese government officially launched the Action Plan for the Zero Growth of Fertilizer Use in 2015.  At the same time, China released a series of policies aiming explicitly at expanding farm size and a great number of large scale farmers emerged recently.  However, whether the expansion of farm size will be beneficial for the increase of fertilizer use efficiency still remains to be investigated.  In this study, we comprehensively explored the relationship between fertilizer use efficiency and farm size.  Based on the 4?281 farm households’ survey data collected by the National Development and Reform Commission (NDRC) of China from 2004 to 2016 in Jiangsu Province, China, this paper applies a stochastic frontier production function to estimate fertilizer use efficiency across farm size and uses a regression model to analyze the influence of farm size on fertilizer use efficiency.  The results show that: (1) the average fertilizer use efficiency of whole samples was only 0.60, much lower than the average technical efficiency, indicating that on average half of the fertilizer utilized are excessive in China; and (2) the smallest farm size group get the highest fertilizer use efficiency score.  We also provide some possible explanations for the inverse relationship between farm size and fertilizer use efficiency.
    Farmers using insurance and cooperatives to manage agricultural risks: A case study of the swine industry in China
    ZHANG Yan-yuan, JU Guang-wei, ZHAN Jin-tao
    2019, 18(12): 2910-2918.  DOI: 10.1016/S2095-3119(19)62823-6
    Abstract ( )   PDF in ScienceDirect  
    Purchasing agricultural insurance and joining agricultural cooperatives are two prevalent instruments used by farmers in China for dealing with agricultural risks.  Data from 443 swine farmers in Jiangsu and Henan provinces of China were collected.  Factors affecting the farmers’ decision to purchase agricultural insurance and join agricultural cooperatives were assessed.  The possibility of simultaneous use of both instruments and the potential correlation between these two decisions was considered as well.  Results showed that the farmers’ decision to use agricultural insurance and cooperatives was positively correlated, indicating that farmers who purchased agricultural insurance which mainly used to mitigate production risks were more likely to join agricultural cooperatives which more used to share market risks, and vice versa.  Farmers’ knowledge of swine insurance and trust in the local government positively impacted the purchase of agricultural insurance, while education, years involved in swine production and scale of swine production positively impacted farmers joining agricultural cooperatives.