Please wait a minute...
Journal of Integrative Agriculture  2019, Vol. 18 Issue (12): 2835-2843    DOI: 10.1016/S2095-3119(19)62744-9
Animal Science · Veterinary Medicine Advanced Online Publication | Current Issue | Archive | Adv Search |
Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines
ZHOU Zheng-wei*, CAO Guo-hua*, LI Zhe*, HAN Xue-jie, LI Chen, LU Zhen-yu, ZHAO Yu-hang, LI Xue-ling 
State Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.China
Download:  PDF in ScienceDirect  
Export:  BibTeX | EndNote (RIS)      
Abstract  
The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding.  In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of gRNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding.  A 20-bp gRNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site.  The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using gRNAs truncated by 1, 2, 3 and 5 bp, respectively.  These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting.  PCR was performed for each off-target site.  All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared.  The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed.  The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively; rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively; all were 0% at the Off-MSTN-2 locus; rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively.  The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower.  This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp gRNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting.  This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.
Keywords:  CRISPR/Cas9        gRNA        targeting site        off-target rate
 
  
Received: 19 October 2018   Accepted:
Fund: This study was supported by the National Transgenic Project of China (2016ZX08010001-002 and 2016ZX08010005-001), the National Natural Science Foundation of China (81471001), and the Inner Mongolia Science and Technology Program, China (201502073).
Corresponding Authors:  Correspondence LI Xue-ling, Tel: +86-471-3679807, E-mail: lixueling@hotmail.com    
About author:  ZHOU Zheng-wei, E-mail: 970066824@qq.com; * These authors contributed equally to this study.

Cite this article: 

ZHOU Zheng-wei, CAO Guo-hua, LI Zhe, HAN Xue-jie, LI Chen, LU Zhen-yu, ZHAO Yu-hang, LI Xue-ling. 2019. Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines. Journal of Integrative Agriculture, 18(12): 2835-2843.

Aiello D, Patel K, Lasagna E. 2018. The myostatin gene: An overview of mechanisms of action and its relevance to livestock animals. Animal Genetics, 20, 12696.
Boman I A, Klemetsdal G, Blichfeldt T, Nafstad O, Våge D I. 2009. A frameshift mutation in the coding region of the myostatin gene (MSTN) affects carcass conformation and fatness in Norwegian White sheep (Ovis aries). Animal Genetics, 40, 418–422.
Chang N, Sun C, Gao L, Zhu D, Xu X, Zhu X, Xiong J W, Xi J J. 2013. Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Research, 23, 465–472.
Clop A, Marcq F, Takeda H, Pirottin D, Tordoir X, Bibé B, Bouix J, Caiment F, Elsen J M, Eychenne F, Larzul C, Laville E, Meish F, Milenkovic D, Tobin J, Charlier C, Georges M. 2006. A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nature Genetics, 38, 813–818.
Cong L, Ran F A, Cox D, Lin S, Barretto R, Haibb N, Hsu P D, Wu X, Jiang W, Marraffini L A, Zhang F. 2013. Multiplex genome engineering using CRISPR/Cas systems. Science, 339, 819–823.
Feng C, Yuan J, Wang R, Liu Y, Birchler J A, Han F. 2016. Efficient target genome modification in maize using CRISPR/Cas9 system. Journal of Genetics and Genomics, 43, 37–43.
Fu Y, Foden J A, Khayter C, Maeder M L, Reyon D, Joung J K, Sander J D. 2013. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nature Biotechnology, 31, 822–826.
Fu Y, Sander J D, Reyon D, Reyon D, Cascio V M, Joung J K. 2014. Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nature Biotechnology, 32, 279–284.
 Grobet L, Martin L J, Poncelet D, Pirottin D, Brouwers B, Riquet J, Schoeberlein A, Dunner S, Ménissier F, Massabanda J, Fries R, Hanset R, Georges M. 1997. A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nature Genetics, 17, 71.
Heo Y T, Quan X, Xu Y N, Baek S, Choi H, Kim N H, Kim J. 2015. CRISPR/Cas9 nuclease-mediated gene knock-in in bovine-induced pluripotent cells. Stem Cells and Development, 24, 393–402.
Hsu P D, Lander E S, Zhang F. 2014. Development and applications of CRISPR-Cas9 for genome engineering. Cell, 157, 1262–1278.
Hsu P D, Scott D A, Weinstein J A, Ran F A, Konermann S, Agarwala V, Li Y, Fine E J, Wu X, Shalem O, Cradick T J, Marraffini L A, Bao G, Zhang F. 2013. DNA targeting specificity of RNA-guided Cas9 nucleases. Nature Biotechnology, 31, 827–832.
Jako?iūnas T, Bonde I, Herrgård M, Harrison S J, Kristensen M, Pedersen L E, Jensen M K, Keasling J D. 2015. Multiplex metabolic pathway engineering using CRISPR/Cas9 in Saccharomyces cerevisiae. Metabolic Engineering, 28, 213–222.
Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna J A, Charpentier E. 2012. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337, 816–821.
Kambadur R, Sharma M, Smith T P, Bass J J. 1997. Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Research, 7, 910–916.
Li T, Huang S, Jiang W Z, Wright D, Spalding M H, Weeks D P, Yang B. 2011. TAL nucleases (TALNs): Hybrid proteins composed of TAL effectors and FokI DNA-cleavage domain. Nucleic Acids Research, 39, 359–372.
Liu D, Wang Z, Xiao A, Zhang Y, Li W, Zu Y, Yao S, Lin S, Zhang B. 2014. Efficient gene targeting in zebrafish mediated by a zebrafish-codon-optimized cas9 and evaluation of off targeting effect. Journal of Genetics and Genomics, 41, 43–46.
Liu H, Liu C, Zhao Y H, Han X J, Wang C, Zhou Z W. 2018. Comparing successful gene knock-in efficiencies of CRISPR/Cas9 with ZFNs and TALENs gene editing systems in bovine and dairy goat fetal fibroblasts. Journal of Integrative Agriculture, 17, 406-414.
Liu X, Wang Y, Guo W, Chang B, Liu J, Guo Z, Quan F, Zhang Y. 2013. Zinc-finger nickase-mediated insertion of the lysostaphin gene into the β-casein locus in cloned cows. Nature Communications, 4, 2565.
Mali P, Aach J, Stranges P B, Esvelt K M, Moosburner M, Kosuri S, Yang L, Church G M. 2013. CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nature Biotechnology, 31, 833–838.
Mali P, Yang L, Esvelt K M, Aach J, Guell M, Dicarlo J E, Norville J E, Church G M. 2013. RNA-guided human genome engineering via Cas9. Science, 339, 823–826.
Montague T G, Cruz J M, Gagnon J A, Church G M, Valen E. 2014. CHOPCHOP: aCRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Research, 42, W401–W407.
Ni W, Qiao J, Hu S, Zhao X, Regouski M, Yang M, Polejaeva I A, Chen C. 2014. Efficient gene knockout in goats using CRISPR/Cas9 system. PLoS ONE, 9, e106718.
O’Geen H, Henry I M, Bhakta M S, Meckler J F, Segal D J. 2015. A genome-wide analysis of Cas9 binding specificity using ChIP-seq and targeted sequence capture. Nucleic Acids Research, 43, 3389–3404.
Pattanayak V, Lin S, Guilinger J P, Ma E, Doudna J A, Liu D R. 2013. High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity. Nature Biotechnology, 31, 839–843.
Proudfoot C, Carlson D F, Huddart R, Long C R, Pryor J H, King T J, Lillico S G, Mileham A J, McLaren D G, Whitelaw C B, Fahrenkrug S C. 2015. Genome edited sheep and cattle. Transgenic Research, 24, 147–153.
Ramakrishna S, Kwaku Dad A B, Beloor J, Gopalappa R, Lee S K, Kim H. 2014. Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA. Genome Research, 24, 1020–1027.
Shen B, Zhang W, Zhang J, Zhou J, Wang J, Chen L, Wang L, Hodgkins A, Iyer V, Huang X, Skarnes W C. 2014. Efficient genome modification by CRISPR-Cas9 nickase with minimal off-target effects. Nature Methods, 11, 399–402.
Wu H, Wang Y, Zhang Y, Yang M, Lv J, Liu J, Zhang Y. 2015. TALE nickase-mediated SP110 knockin endows cattle with increased resistance to tuberculosis. Proceedings of the National Academy of Sciences of the United States of America, 112, E1530–E1539.
Xiao A, Cheng Z, Kong L, Zhu Z, Lin S, Gao G, Zhang B. 2014. CasOT: A genome-wide Cas9/gRNA off-target searching tool. Bioinformatics, 30, 1180–1182.
Zhao Y, Liang H, Liu M, Li X. 2014. The application of gene knock-out technologies in big domestic animals. Acta Veterinaria et Zootechnica Sinica, 45, 1–8. (in Chinese)
Zhou H, He M, Li J, Chen L, Huang Z F, Zheng S Y, Zhu L Y, Ni E, Jiang D G, Zhao B R, Zhuang C X. 2016. Development of commercial Thermo-sensitive genic male sterile rice accelerates hybrid rice breeding using the CRISPR/Cas9-mediated TMS5 editing system. Scientific Reports, 6, 37395–37406.
Zhou X, Xin J, Fan N, Zou Q, Huang J, Ouyang Z, Zhao Y, Zhao B, Liu Z, Lai S, Yi X, Guo L, Esteban M A, Zeng Y, Yang H, Lai L. 2015. Generation of CRISPR/Cas9-mediated gene targeted pigs via somatic cell nuclear transfer. Cellular and Molecular Life Sciences, 72, 1175–1184.
[1] Ruining Zhang, Yunlin Cao, Tong Zhang, Yingyue Ma, Jiajia Li, Kunsong Chen, Xian Li. CRISPR/Cas9-mediated mutagenesis of transcriptional repressor SlMYB32 improves flavonols and flavanones accumulation in tomato fruit[J]. >Journal of Integrative Agriculture, 2026, 25(4): 0-.
[2] Qinhan Yu, Yue Sun, Yaping Xie, Jiaxin Li, Rong Wang, Qiaoling Zheng, Chang Liu, Ningbo Zhang, Weirong Xu. Amur grape VaMYB4a mediates grapevine cold tolerance via dual regulation of CBF–COR and ABA pathways[J]. >Journal of Integrative Agriculture, 2026, 25(3): 989-1008.
[3] Hui Song, Meiran Li, Zhenquan Duan. Current status of the genetic transformation of Arachis plants[J]. >Journal of Integrative Agriculture, 2026, 25(2): 577-584.
[4] Qiang Yan, Guosheng Liu, Yingying He, Shuang Hou, Kangli Hao, Jiale Xing, Tingting Zhang, Shutang Zhou. CRISPR/xCas9-mediated corazonin knockout reveals the effectiveness of xCas9 editing and the crucial role of corazonin in insect cuticle development[J]. >Journal of Integrative Agriculture, 2025, 24(10): 3953-3965.
[5] Shanyu Li, Guifang Lin, Haoqi Wen, Haiyan Lu, Anyuan Yin, Chanqin Zheng, Feifei Li, Qingxuan Qiao, Lu Jiao, Ling Lin, Yi Yan, Xiujuan Xiang, Huang Liao, Huiting Feng, Yussuf Mohamed Salum, Minsheng You, Wei Chen, Weiyi He. Knock-in of exogenous sequences based on CRISPR/Cas9 targeting autosomal genes and sex chromosomes in the diamondback moth, Plutella xylostella[J]. >Journal of Integrative Agriculture, 2024, 23(9): 3089-3103.
[6] Jun Lü, Jingxiang Chen, Yutao Hu , Lin Chen, Shihui Li, Yibing Zhang, Wenqing Zhang.

CRISPR/Cas9-mediated NlInR2 mutants: Analyses of residual mRNA and truncated proteins [J]. >Journal of Integrative Agriculture, 2024, 23(6): 2006-2017.

[7] Jiali Ying, Yan Wang, Liang Xu, Tiaojiao Qin, Kai Xia, Peng Zhang, Yinbo Ma, Keyun Zhang, Lun Wang, Junhui Dong, Lianxue Fan, Yuelin Zhu, Liwang Liu.

Establishing VIGS and CRISPR/Cas9 techniques to verify RsPDS function in radish [J]. >Journal of Integrative Agriculture, 2024, 23(5): 1557-1567.

[8] Wei Huang, Ruyu Jiao, Hongtao Cheng, Shengli Cai, Jia Liu, Qiong Hu, Lili Liu, Bao Li, Tonghua Wang, Mei Li, Dawei Zhang, Mingli Yan.

Targeted mutations of BnPAP2 lead to a yellow seed coat in Brassica napus L. [J]. >Journal of Integrative Agriculture, 2024, 23(2): 724-730.

[9] Yang Yang, Hongfei Li, Changhao Liang, Donghai He, Hang Zhao, Hongbo Jiang, Jinjun Wang. Neuropeptide signaling systems are involved in regulating thermal tolerance in the oriental fruit fly[J]. >Journal of Integrative Agriculture, 2024, 23(12): 4147-4160.
[10] CAO Song, SUN Dong-dong, LIU Yang, YANG Qing, WANG Gui-rong.

Mutagenesis of odorant coreceptor Orco reveals the distinct role of olfaction between sexes in Spodoptera frugiperda [J]. >Journal of Integrative Agriculture, 2023, 22(7): 2162-2172.

[11] OUYANG Chun-zheng, YE Fan, WU Qing-jun, WANG Shao-li, Neil CRICKMORE, ZHOU Xu-guo, GUO Zhao-jiang, ZHANG You-jun. CRISPR/Cas9-based functional characterization of PxABCB1 reveals its roles in the resistance of Plutella xylostella (L.) to Cry1Ac, abamectin and emamectin benzoate[J]. >Journal of Integrative Agriculture, 2023, 22(10): 3090-3102.
[12] JIANG Mao-cheng, HU Zi-xuan, WANG Ke-xin, YANG Tian-yu, LIN Miao, ZHAN Kang, ZHAO Guo-qi. CRISPR/Cas9-mediated knockout of SLC15A4 gene involved in the immune response in bovine rumen epithelial cells[J]. >Journal of Integrative Agriculture, 2023, 22(10): 3148-3158.
[13] XIANG Guang-ming, ZHANG Xiu-ling, XU Chang-jiang, FAN Zi-yao, XU Kui, WANG Nan, WANG Yue, CHE Jing-jing, XU Song-song, MU Yu-lian, LI Kui, LIU Zhi-guo. The collagen type I alpha 1 chain gene is an alternative safe harbor locus in the porcine genome[J]. >Journal of Integrative Agriculture, 2023, 22(1): 202-213.
[14] JIN Ming-hui, TAO Jia-hui, LI Qi, CHENG Ying, SUN Xiao-xu, WU Kong-ming, XIAO Yu-tao . Genome editing of the SfABCC2 gene confers resistance to Cry1F toxin from Bacillus thuringiensis in Spodoptera frugiperda[J]. >Journal of Integrative Agriculture, 2021, 20(3): 815-820.
[15] ZHANG Ting-ting, WEN Ting-mei, YUE Yang, YAN Qiang, DU Er-xia, FAN San-hong, Siegfried ROTH, LI Sheng, ZHANG Jian-zhen, ZHANG Xue-yao, ZHANG Min. Egg tanning improves the efficiency of CRISPR/Cas9-mediated mutant locust production by enhancing defense ability after microinjection[J]. >Journal of Integrative Agriculture, 2021, 20(10): 2716-2726.
No Suggested Reading articles found!