|
|
|
|
|
| Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines |
ZHOU Zheng-wei*, CAO Guo-hua*, LI Zhe*, HAN Xue-jie, LI Chen, LU Zhen-yu, ZHAO Yu-hang, LI Xue-ling |
State Key Laboratory of Reproductive Regulation & Breeding of Grassland Livestocks/Research Center for Laboratory Animal Science, Inner Mongolia University, Hohhot 010070, P.R.China |
|
|
|
|
Abstract The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding. In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of gRNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding. A 20-bp gRNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site. The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using gRNAs truncated by 1, 2, 3 and 5 bp, respectively. These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting. PCR was performed for each off-target site. All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared. The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed. The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively; rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively; all were 0% at the Off-MSTN-2 locus; rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively. The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower. This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp gRNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting. This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.
|
|
Received: 19 October 2018
Accepted:
|
| Fund: This study was supported by the National Transgenic Project of China (2016ZX08010001-002 and 2016ZX08010005-001), the National Natural Science Foundation of China (81471001), and the Inner Mongolia Science and Technology Program, China (201502073). |
|
Corresponding Authors:
Correspondence LI Xue-ling, Tel: +86-471-3679807, E-mail: lixueling@hotmail.com
|
| About author: ZHOU Zheng-wei, E-mail: 970066824@qq.com; * These authors contributed equally to this study. |
Cite this article:
ZHOU Zheng-wei, CAO Guo-hua, LI Zhe, HAN Xue-jie, LI Chen, LU Zhen-yu, ZHAO Yu-hang, LI Xue-ling.
2019.
Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines. Journal of Integrative Agriculture, 18(12): 2835-2843.
|
Aiello D, Patel K, Lasagna E. 2018. The myostatin gene: An overview of mechanisms of action and its relevance to livestock animals. Animal Genetics, 20, 12696.
Boman I A, Klemetsdal G, Blichfeldt T, Nafstad O, Våge D I. 2009. A frameshift mutation in the coding region of the myostatin gene (MSTN) affects carcass conformation and fatness in Norwegian White sheep (Ovis aries). Animal Genetics, 40, 418–422.
Chang N, Sun C, Gao L, Zhu D, Xu X, Zhu X, Xiong J W, Xi J J. 2013. Genome editing with RNA-guided Cas9 nuclease in zebrafish embryos. Cell Research, 23, 465–472.
Clop A, Marcq F, Takeda H, Pirottin D, Tordoir X, Bibé B, Bouix J, Caiment F, Elsen J M, Eychenne F, Larzul C, Laville E, Meish F, Milenkovic D, Tobin J, Charlier C, Georges M. 2006. A mutation creating a potential illegitimate microRNA target site in the myostatin gene affects muscularity in sheep. Nature Genetics, 38, 813–818.
Cong L, Ran F A, Cox D, Lin S, Barretto R, Haibb N, Hsu P D, Wu X, Jiang W, Marraffini L A, Zhang F. 2013. Multiplex genome engineering using CRISPR/Cas systems. Science, 339, 819–823.
Feng C, Yuan J, Wang R, Liu Y, Birchler J A, Han F. 2016. Efficient target genome modification in maize using CRISPR/Cas9 system. Journal of Genetics and Genomics, 43, 37–43.
Fu Y, Foden J A, Khayter C, Maeder M L, Reyon D, Joung J K, Sander J D. 2013. High-frequency off-target mutagenesis induced by CRISPR-Cas nucleases in human cells. Nature Biotechnology, 31, 822–826.
Fu Y, Sander J D, Reyon D, Reyon D, Cascio V M, Joung J K. 2014. Improving CRISPR-Cas nuclease specificity using truncated guide RNAs. Nature Biotechnology, 32, 279–284.
Grobet L, Martin L J, Poncelet D, Pirottin D, Brouwers B, Riquet J, Schoeberlein A, Dunner S, Ménissier F, Massabanda J, Fries R, Hanset R, Georges M. 1997. A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nature Genetics, 17, 71.
Heo Y T, Quan X, Xu Y N, Baek S, Choi H, Kim N H, Kim J. 2015. CRISPR/Cas9 nuclease-mediated gene knock-in in bovine-induced pluripotent cells. Stem Cells and Development, 24, 393–402.
Hsu P D, Lander E S, Zhang F. 2014. Development and applications of CRISPR-Cas9 for genome engineering. Cell, 157, 1262–1278.
Hsu P D, Scott D A, Weinstein J A, Ran F A, Konermann S, Agarwala V, Li Y, Fine E J, Wu X, Shalem O, Cradick T J, Marraffini L A, Bao G, Zhang F. 2013. DNA targeting specificity of RNA-guided Cas9 nucleases. Nature Biotechnology, 31, 827–832.
Jako?iūnas T, Bonde I, Herrgård M, Harrison S J, Kristensen M, Pedersen L E, Jensen M K, Keasling J D. 2015. Multiplex metabolic pathway engineering using CRISPR/Cas9 in Saccharomyces cerevisiae. Metabolic Engineering, 28, 213–222.
Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna J A, Charpentier E. 2012. A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337, 816–821.
Kambadur R, Sharma M, Smith T P, Bass J J. 1997. Mutations in myostatin (GDF8) in double-muscled Belgian Blue and Piedmontese cattle. Genome Research, 7, 910–916.
Li T, Huang S, Jiang W Z, Wright D, Spalding M H, Weeks D P, Yang B. 2011. TAL nucleases (TALNs): Hybrid proteins composed of TAL effectors and FokI DNA-cleavage domain. Nucleic Acids Research, 39, 359–372.
Liu D, Wang Z, Xiao A, Zhang Y, Li W, Zu Y, Yao S, Lin S, Zhang B. 2014. Efficient gene targeting in zebrafish mediated by a zebrafish-codon-optimized cas9 and evaluation of off targeting effect. Journal of Genetics and Genomics, 41, 43–46.
Liu H, Liu C, Zhao Y H, Han X J, Wang C, Zhou Z W. 2018. Comparing successful gene knock-in efficiencies of CRISPR/Cas9 with ZFNs and TALENs gene editing systems in bovine and dairy goat fetal fibroblasts. Journal of Integrative Agriculture, 17, 406-414.
Liu X, Wang Y, Guo W, Chang B, Liu J, Guo Z, Quan F, Zhang Y. 2013. Zinc-finger nickase-mediated insertion of the lysostaphin gene into the β-casein locus in cloned cows. Nature Communications, 4, 2565.
Mali P, Aach J, Stranges P B, Esvelt K M, Moosburner M, Kosuri S, Yang L, Church G M. 2013. CAS9 transcriptional activators for target specificity screening and paired nickases for cooperative genome engineering. Nature Biotechnology, 31, 833–838.
Mali P, Yang L, Esvelt K M, Aach J, Guell M, Dicarlo J E, Norville J E, Church G M. 2013. RNA-guided human genome engineering via Cas9. Science, 339, 823–826.
Montague T G, Cruz J M, Gagnon J A, Church G M, Valen E. 2014. CHOPCHOP: aCRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids Research, 42, W401–W407.
Ni W, Qiao J, Hu S, Zhao X, Regouski M, Yang M, Polejaeva I A, Chen C. 2014. Efficient gene knockout in goats using CRISPR/Cas9 system. PLoS ONE, 9, e106718.
O’Geen H, Henry I M, Bhakta M S, Meckler J F, Segal D J. 2015. A genome-wide analysis of Cas9 binding specificity using ChIP-seq and targeted sequence capture. Nucleic Acids Research, 43, 3389–3404.
Pattanayak V, Lin S, Guilinger J P, Ma E, Doudna J A, Liu D R. 2013. High-throughput profiling of off-target DNA cleavage reveals RNA-programmed Cas9 nuclease specificity. Nature Biotechnology, 31, 839–843.
Proudfoot C, Carlson D F, Huddart R, Long C R, Pryor J H, King T J, Lillico S G, Mileham A J, McLaren D G, Whitelaw C B, Fahrenkrug S C. 2015. Genome edited sheep and cattle. Transgenic Research, 24, 147–153.
Ramakrishna S, Kwaku Dad A B, Beloor J, Gopalappa R, Lee S K, Kim H. 2014. Gene disruption by cell-penetrating peptide-mediated delivery of Cas9 protein and guide RNA. Genome Research, 24, 1020–1027.
Shen B, Zhang W, Zhang J, Zhou J, Wang J, Chen L, Wang L, Hodgkins A, Iyer V, Huang X, Skarnes W C. 2014. Efficient genome modification by CRISPR-Cas9 nickase with minimal off-target effects. Nature Methods, 11, 399–402.
Wu H, Wang Y, Zhang Y, Yang M, Lv J, Liu J, Zhang Y. 2015. TALE nickase-mediated SP110 knockin endows cattle with increased resistance to tuberculosis. Proceedings of the National Academy of Sciences of the United States of America, 112, E1530–E1539.
Xiao A, Cheng Z, Kong L, Zhu Z, Lin S, Gao G, Zhang B. 2014. CasOT: A genome-wide Cas9/gRNA off-target searching tool. Bioinformatics, 30, 1180–1182.
Zhao Y, Liang H, Liu M, Li X. 2014. The application of gene knock-out technologies in big domestic animals. Acta Veterinaria et Zootechnica Sinica, 45, 1–8. (in Chinese)
Zhou H, He M, Li J, Chen L, Huang Z F, Zheng S Y, Zhu L Y, Ni E, Jiang D G, Zhao B R, Zhuang C X. 2016. Development of commercial Thermo-sensitive genic male sterile rice accelerates hybrid rice breeding using the CRISPR/Cas9-mediated TMS5 editing system. Scientific Reports, 6, 37395–37406.
Zhou X, Xin J, Fan N, Zou Q, Huang J, Ouyang Z, Zhao Y, Zhao B, Liu Z, Lai S, Yi X, Guo L, Esteban M A, Zeng Y, Yang H, Lai L. 2015. Generation of CRISPR/Cas9-mediated gene targeted pigs via somatic cell nuclear transfer. Cellular and Molecular Life Sciences, 72, 1175–1184. |
| No Suggested Reading articles found! |
|
|
Viewed |
|
|
|
Full text
|
|
|
|
|
Abstract
|
|
|
|
|
Cited |
|
|
|
|
| |
Shared |
|
|
|
|
| |
Discussed |
|
|
|
|
