Scientia Agricultura Sinica ›› 2020, Vol. 53 ›› Issue (1): 148-159.doi: 10.3864/j.issn.0578-1752.2020.01.014

;

• SPECIAL FOCUS: MOLECULAR BIOLOGY OF CUCUMBER • Previous Articles     Next Articles

Cloning and Functional Analysis of CsRPL1/2 in Cucumber

WeiYuan SONG,Yu HOU,JianYu ZHAO,XiaoFeng LIU,XiaoLan ZHANG()   

  1. College of Horticulture, China Agricultural University, Beijing 100089
  • Received:2019-06-03 Accepted:2019-07-02 Online:2020-01-01 Published:2020-01-19
  • Contact: XiaoLan ZHANG E-mail:zhxiaolan@cau.edu.cn

Abstract:

【Objective】AtRPL is an important gene regulating Arabidopsis fruit development and mediating replum formation. Using homologous cloning, the RPL homolog in cucumber was identified, the biological function of CsRPL by expression analysis and ectopic transformation in Arabidopsis was explored.【Method】We cloned the CsRPL gene by performing a BLAST search of AtRPL in cucumber genome. Then we performed amino acid sequence alignment of CsRPL and RPL homologs from other species by MEGA5.2. CsRPL expression pattern in cucumber was detected by real-time quantitative PCR (qRT-PCR) and in situ hybridization. Expression and phenotypic analysis of transgenic Arabidopsis upon ectopic expression of CsRPL were performed as well.【Result】Two RPL genes, named CsRPL1 and CsRPL2, were identified in cucumber with the conserved BELL domain and Homeodomain, and two EAR-Motifs. CsRPL1 was expressed in all organs of cucumber, with the highest expression level in male flowers at anthesis. During early stages of fruit development, the CsRPL1 expression decreased gradually. The expression level of CsRPL2 was significantly lower than that of CsRPL1. In situ hybridization revealed that signals of CsRPL1/2 were detected in the placenta of fruits and the central zone (CZ) of the shoot apical meristem (SAM). Ectopic overexpression of CsRPL1/2 into Arabidopsis resulted in shorter siliques, reduced pollen fertility, and inhibited seed development.【Conclusion】CsRPL1/2 were involved in the development of reproductive organs and might have functional redundancy in cucumber. CsRPL1 might play the primary role under normal growth condition. The function of CsRPL1/2 was not fully conserved as compared to that of AtRPL.

Key words: cucumber, CsRPL, transgenic plant, expression analysis, fruit

Table 1

Primers sequences"

引物名称 Primer name 引物序列Primer sequence (5′-3′)
CsRPL1-F ATGGCTGAGGGTATTGAATCCTAC
CsRPL1-R TCAGCCCACAAAGTCATGTAACAGC
CsRPL2-F ATGGCGGAGGGTTTTGAAGTTTAC
CsRPL2-R TCAAAACCACTCATTTACAAACCCT
CsRPL1-1300-F TACACCAAATCGACTCTAGAATGGCTGAGGGTATTGAATC
CsRPL1-1300-A CCTTGCTCACCATGGTACCGCCCACAAAGTCATGTAACA
CsRPL2-1300-F TACACCAAATCGACTCTAGAATGGCGGAGGGTTTTGAAGT
CsRPL2-1300-A CCTTGCTCACCATGGTACCAAACCACTCATTTACAAACC
35S-F GTAAGGGATGACGCACAATC
CsRPL1-OV-R ATTGAGAGAAGCGTTGATTTATGAG
CsRPL2-OV-R TACTCAAATGTCGTAACCACTGCTT
UBI-F CACCAAGCCCAAGAAGATC
UBI-R TAAACCTAATCACCACCAGC
Actin-F CCTTCGTCTTGATCTTGCGG
Actin-R AGCGATGGCTGGAACAGAAC
CsRPL1-qPCR-F CCGCTCACAATGGAAAACCC
CsRPL1-qPCR-R AGGATACATTCAAGGGCTCG
CsRPL2-qPCR-F TACGCCTCCTTTCGTTCCACT
CsRPL2-qPCR-R TTGTCGTCGGAGATGTTAGGG
CsRPL1-SP6 GATTTAGGTGACACTATAGAATGCTACCCGCTCACAATGGAAAAC
CsRPL1-T7 TGTAATACGACTCACTATAGGGGTCCACCCATCACATACCCA
CsRPL2-SP6 GATTTAGGTGACACTATAGAATGCTCTTCTTCTTTTTTTTCACCCG
CsRPL2-T7 TGTAATACGACTCACTATAGGGCTTCCAAGGAGTCAAAAACGG

Fig. 1

The phylogenetic analysis and gene structure of cucumber CsRPL1/2 and Arabidopsis AtRPL A: Phylogenetic analysis of BELL subfamily gene in cucumber and Arabidopsis thaliana, AtRPL and its homologous gene CsRPL1/2 in the red box. BEL1 (AT5G41410); ATH1 (AT4G32980); BLH1 (AT2G35940); BLH2/SAW1 (AT4G36870); BLH3 (AT1G75410); BLH4/SAW2 (AT2G23760); BLH5 (AT2G27220); BLH6 (AT4G34610); BLH7 (AT2G16400); BLH8/PNF (AT2G27990); BLH9/RPL (AT5G02030); BLH10 (AT1G19700); BLH11 (AT1G75430). B: Purple squares represent 5' UTR, 3' UTR; orange squares represent exons; straight lines represent introns"

Fig. 2

Sequence alignment of cucumber CsRPL with RPL homologs from other species A: BELL-Domain in the orange box, Homeodomain in the blue box, and EAR-Motifs in the red dotted box. AtRPL: Arabidopsis RPL(NP_195823.1); GmRPL: Melon RPL (XP_008448414.1); VvRPL: Grape RPL (XP_010654234.1); PpRPL: Peach RPL (XP_007208167.1); GhRPL: Cotton RPL (XP_016738976.1); MdRPL: Apple RPL (XP_008363517.1); GmRPL: Soybean RPL (XP_003516903.1); SlRPL: Tomato RPL (XP_004246395.1); ZmRPL: Corn RPL: (NP_001168681.1); TaRPL: Wheat RPL (BAJ04689. 1); OsRPL: Rice RPL (XP_015641948.1); B-E: Amino acid conservation analysis of BELL-Domain (B), Homeodomain (C) and EAR-Motif (D and E); VvRPL, GhRPL and monocotyledon ZmRPL, TaRPL and OsRPL was not included; Asterisks represent the completely conserved amino acids"

Fig. 3

Gene expression pattern of CsRPL1/2 A: Relative expression of CsRPL1/2 in various parts of cucumber; B-F: In situ hybridization analysis of CsRPL1 (B, C) and CsRPL2 (D, E) in cucumber fruits and shoot tips; B, D: CsRPL1/2 expressed in placenta C, E: CsRPL1/2 signal was enriched in the central zone of the meristem in the shoot tips; White dotted box represents the signal enrichment region; F: CsRPL-SP6 probe was used as negative control, and no hybridization signal was found. Scale bar: 100 μm"

Fig. 4

PCR identification of transgenic Arabidopsis M: 2000 bp marker; Plasmid: positive control plasmid; Col: wild type Arabidopsis"

Fig. 5

Phenotypic observation and statistical analysis of ectopic expression of CsRPL1/2 in Arabidopsis A: The phenotype of wild type and transgenic plants (Col: wild type; #1-1: CsRPL1 overexpressing line; #2-1: CsRPL2 overexpressing line, scale bar: 10 cm); B: Seeds development in the fruits, white arrows pointed to abortive seeds (scale bar: 2 mm); C: The character of silique length (scale bar: 1 cm) D: Statistical data of silique length; E: Pollen viability test (scale bar 1 mm); F: Statistical data of seed number per silique; G: Statistical data of pollen viability test; H: Expression analysis of CsRPL1/2 in wild type and transgenic plants"

[1] ROEDER A H K, FERRANDIZ C, YANOFSKY M F . The role of the REPLUMLESS homeodomain protein in patterning the Arabidopsis fruit. Current Biology, 2003,13(18):1630-1635.
[2] SCOTT M P, WEINER A J . Structural relationships among genes that control development: Sequence homology between the Antennapedia, Ultrabithorax, and fushi tarazu loci of Drosophila. Proceedings of the National Academy of Sciences of the United States of America, 1984,81(13):4115-4119.
[3] ITO M, SATO Y, MATSUOKA M . Involvement of homeobox genes in early body plan of monocot. International Review of Cytology, 2002,218:1-35.
[4] HAKE S, SMITH H M S, HOLTAN H, MAGNANI E, MELE G, RAMIREZ J . The role of KNOX genes in plant development. Annual Review of Cell and Developmental Biology, 2004,20:125-151.
[5] BÜRGLIN T R . Analysis of TALE superclass homeobox genes (MEIS, PBC, KNOX, Iroquois, TGIF) reveals a novel domain conserved between plants and animals. Nucleic Acids Research, 1997,25(21):4173-4180.
[6] BÜRGLIN T R . The PBC domain contains a MEINOX domain: coevolution of Hox and TALE homeobox genes. Development Genes and Evolution, 1998,208(2):113-116.
[7] VOLLBRECHT E, VEIT B, SINHA N, HAKE S . The developmental gene knotted-1 is a member of a maize homeobox gene family. Nature, 1991,350(6315):241-243.
[8] BELLAOUI M, PIDKOWICH M S, SAMACH A, KUSHALAPPA K, KOHALMI S E, MODRUSAN Z, CROSBY W L, HAUGHN G W . The Arabidopsis BELL1 and KNOX TALE homeodomain proteins interact through a domain conserved between plants and animals. The Plant Cell, 2001,13(11):2455-2470.
[9] MULLER J, WANG Y M, FRANZEN R, SANTI L, SALAMINI F, ROHDE W . In vitro interactions between barley TALE homeodomain proteins suggest a role for protein-protein associations in the regulation of Knox gene function. Plant Journal, 2001,27(1):13-23.
[10] COLE M, NOLTE C, WERR W . Nuclear import of the transcription factor SHOOT MERISTEMLESS depends on heterodimerization with BLH proteins expressed in discrete subdomains of the shoot apical meristem of Arabidopsis thaliana. Nucleic Acids Research, 2006,34(4):1281-1292.
[11] REISER L, MODRUSAN Z, MARGOSSIAN L, SAMACH A, OHAD N, HAUGHN G W, FISCHER R L . The BELL1 gene encodes a homeodomain protein involved in pattern formation in the Arabidopsis ovule primordium. Cell, 1995,83(5):735-742.
[12] TRAAS J, VERNOUX T . The shoot apical meristem: The dynamics of a stable structure. Philosophical transactions of the Royal Society B-Biological Sciences, 2002,357(1422):737-747.
[13] AIDA M, TASAKA M . Genetic control of shoot organ boundaries. Current Opinion in Plant Biology, 2006,9(1):72-77.
[14] BLECKMANN A, SIMON R . Interdomain signaling in stem cell maintenance of plant shoot meristems. Molecular Cells, 2009,27(6):615-620.
[15] ENDRIZZI K, MOUSSIAN B, HAECKER A, LEVIN J Z, LAUX T . The SHOOT MERISTEMLESS gene is required for maintenance of undifferentiated cells in Arabidopsis shoot and floral meristems and acts at a different regulatory level than the meristem genes WUSCHEL and ZWILLE. Plant Journal, 1996,10(6):967-979.
[16] LONG J A, MOAN E I, MEDFORD J I, BARTON M K . A member of the KNOTTED class of homeodomain proteins encoded by the STM gene of Arabidopsis. Nature, 1996,379(6560):66-69.
[17] BHATT A M, ETCHELLS J P, CANALES C, LAGODIENKO A, DICKINSON H . VAAMANA-a BEL1-like homeodomain protein, interacts with KNOX proteins BP and STM and regulates inflorescence stem growth in Arabidopsis. Gene, 2004,328:103-111.
[18] BYRNE M E, GROOVER A T, FONTANA J R, MARTIENSSEN R A . Phyllotactic pattern and stem cell fate are determined by the Arabidopsis homeobox gene BELLRINGER. Development, 2003,130(17):3941-3950.
[19] SMITH H M S, HAKE S . The interaction of two homeobox genes,BREVIPEDICELLUS and PENNYWISE, regulates internode patterning in the Arabidopsis inflorescence. The Plant Cell, 2003,15(8):1717-1727.
[20] SMITH H M S, CAMPBELL B C, HAKE S . Competence to respond to floral inductive signals requires the homeobox genes PENNYWISE and POUND-FOOLISH. Current Biology, 2004,14(9):812-817.
[21] KANRAR S, BHATTACHARYA M, ARTHUR B, COURTIER J, SMITH H M S . Regulatory networks that function to specify flower meristems require the function of homeobox genes PENNYWISE and POUND-FOOLISH in Arabidopsis. Plant Journal, 2008,54(5):924-937.
[22] ANDRÉS F, ROMERA-BRANCHAT M, MARTÍNEZ-GALLEGOS R, PATEL V, SCHNEEBERGER K, JANG S, ALTMÜLLER J, NÜRNBERG P, COUPLAND G . Floral induction in Arabidopsis by FLOWERING LOCUS T requires direct repression of BLADE-ON- PETIOLE genes by the homeodomain protein PENNYWISE. Plant Physiology, 2015,169(3):2187-2199.
[23] 张娟, 颜爽爽, 赵文圣, 张小兰 . 黄瓜CsFT基因的克隆及其功能分析. 园艺学报, 2013,40(11):2180-2188.
ZHANG J, YAN S S, ZHAO W S, ZHANG X L . Cloning and functional analysis of CsFT in cucumber. Acta Horticulturae Sinica, 2013,40(11):2180-2188. (in Chinese)
[24] 柳美玲, 丁莲, 张小兰 . 蔬菜作物的RNA原位杂交技术. 山西农业大学学报, 2013,33(1):42-45.
LIU M L, DING L, ZHANG X L . RNA in situ hybridization in vegetable plants. Journal of Shanxi Agricultural University, 2013,33(1):42-45. (in Chinese)
[25] HAY A, TSIANTIS M . KNOX genes: versatile regulators of plant development and diversity. Development, 2010,137(19):3153-3165.
[26] BAO X Z, FRANKS R G, LEVIN J Z, LIU Z C . Repression of AGAMOUS by BELLRINGER in floral and inflorescence meristems. The Plant Cell, 2004,16(6):1478-1489.
[27] DINNENY J R, WEIGEL D, YANOFSKY M F . A genetic framework for fruit patterning in Arabidopsis thaliana. Development, 2005,132(21):4687-4696.
[28] KANRAR S, ONGUKA O, SMITH H M S . Arabidopsis inflorescence architecture requires the activities of KNOX-BELL homeodomain heterodimers. Planta, 2006,224(5):1163-1173.
[29] YU L F, PATIBANDA V, SMITH H M S . A novel role of BELL1-like homeobox genes PENNYWISE and POUND-FOOLISH in floral patterning. Planta, 2008,229(3):693-707.
[30] HAMANT O, PAUTOT V . Plant development: A TALE story. Comptes Rendus Biologies, 2010,333(4):371-381.
[31] ETCHELLS J P, MOORE L, JIANG W Z, PRESCOTT H, CAPPER R, SAUNDERS N J, BHATT A M, DICKINSON H G . A role for BELLRINGER in cell wall development is supported by loss-of- function phenotypes. BMC Plant Biology, 2012,12:212. doi: 10.1186/1471-2229-12-212.
[32] ARNAUD N, PAUTOT V . Ring the BELL and tie the KNOX: Roles for TALEs in gynoecium development. Frontiers in Plant Science, 2014,5:93. doi: 10.3389/fpls.2014.00093.
[33] CHÁVEZ MONTES R A, HERRERA-UBALDO H, SERWATOWSKA J, DE FOLTER S . Towards a comprehensive and dynamic gynoecium gene regulatory network. Current Plant Biology, 2015,3:3-12.
[34] BENCIVENGA S, SERRANO-MISLATA A, BUSH M, FOX S, SABLOWSKI R . Control of oriented tissue growth through repression of organ boundary genes promotes stem morphogenesis. Developmental Cell, 2016,39(2):198-208.
[35] GONZÁLEZ-REIG S, RIPOLL J J, VERA A, YANOFSKY M F, MARTÍNEZ-LABORDA A . Antagonistic gene activities determine the formation of pattern elements along the mediolateral axis of the Arabidopsis fruit. PLoS Genetics, 2012,8(11):e1003020.
[36] OHTA M, MATSUI K, HIRATSU K, SHINSHI H, OHME-TAKAGI M . Repression domains of class II ERF transcriptional repressors share an essential motif for active repression. The Plant Cell, 2001,13(8):1959-1968.
[37] HIRATSU K, MATSUI K, KOYAMA T, OHME-TAKAGI M . Dominant repression of target genes by chimeric repressors that include the EAR motif, a repression domain, in Arabidopsis. Plant Journal, 2003,34(5):733-739.
[38] HILL K, WANG H, PERRY S E . A transcriptional repression motif in the MADS factor AGL15 is involved in recruitment of histone deacetylase complex components. Plant Journal, 2008,53(1):172-185.
[39] TIWARI S B, HAGEN G, GUILFOYLE T J . Aux/IAA proteins contain a potent transcriptional repression domain. The Plant Cell, 2004,16(2):533-543.
[40] HONYS D, TWELL D . Comparative analysis of the Arabidopsis pollen transcriptome. Plant Physiology, 2003,132(2):640-652.
[41] SMYTH D R, BOWMAN J L, MEYEROWITZ E M . Early flower development in Arabidopsis. The Plant Cell, 1990,2(8):755-767.
[42] ITO T, WELLMER F, YU H, DAS P, ITO N, ALVES-FERREIRA M, RIECHMANN J L, MEYEROWITZ E M . The homeotic protein AGAMOUS controls microsporogenesis by regulation of SPOROCYTELESS. Nature, 2004,430(6997):356-360.
[43] HORD C L H, CHEN C B, DEYOUNG B J, CLARK S E, MA H . The BAM1/BAM2 receptor-like kinases are important regulators of Arabidopsis early anther development. The Plant Cell, 2006,18(7):1667-1680.
[44] JIA G X, LIU X D, OWEN H A, ZHAO D Z . Signaling of cell fate determination by the TPD1 small protein and EMS1 receptor kinase. Proceedings of the National Academy of Sciences of the United States of America, 2008,105(6):2220-2225.
[45] ALBRECHT C, RUSSINOVA E, HECHT V, BAAIJENS E, DE VRIES S . The Arabidopsis thaliana SOMATIC EMBRYOGENESIS RECEPTOR-LIKE KINASES1 and 2 control male sporogenesis. The Plant Cell, 2005,17(12):3337-3349.
[46] MIZUNO S, OSAKABE Y, MARUYAMA K, ITO T, OSAKABE K, SATO T, SHINOZAKI K, YAMAGUCHI-SHINOZAKI K . Receptor- like protein kinase 2 (RPK2) is a novel factor controlling anther development in Arabidopsis thaliana. Plant Journal, 2007,50(5):751-766.
[47] CANALES C, BHATT A M, SCOTT R, DICKINSON H . EXS, a putative LRR receptor kinase, regulates male germline cell number and tapetal identity and promotes seed development in Arabidopsis. Current Biology, 2002,12(20):1718-1727.
[48] FENG B M, LU D H, MA X, PENG Y B, SUN Y J, NING G, MA H . Regulation of the Arabidopsis anther transcriptome by DYT1 for pollen development. Plant Journal, 2012,72(4):612-624.
[49] WILSON Z A, MORROLL S M, DAWSON J, SWARUP R, TIGHE P J . The Arabidopsis MALE STERILITY1 (MS1) gene is a transcriptional regulator of male gametogenesis, with homology to the PHD-finger family of transcription factors. Plant Journal, 2001,28(1):27-39.
[50] SORENSEN A M, KRÖBER S, UNTE U S, HUIJSER P, DEKKER K, SAEDLER H . The Arabidopsis ABORTED MICROSPORES (AMS) gene encodes a MYC class transcription factor. Plant Journal, 2003,33(2):413-423.
[51] XU J, DING Z W, VIZCAY-BARRENA G, SHI J X, LIANG W Q, YUAN Z, WERCK-REICHHART D, SCHREIBER L, WILSON Z A, ZHANG D B . ABORTED MICROSPORES acts as a master regulator of pollen wall formation in Arabidopsis. The Plant Cell, 2014,26(4):1544-1556.
[1] CAO HaiShun, ZHOU DongYuan, WANG Rui, SHI ZhaoWan, WU TingQuan, ZHANG ChangYuan. Identification of Short Hypocotyl Cucumber Germplasm Under Low Light Stress and QTL Mapping of the Trait [J]. Scientia Agricultura Sinica, 2026, 59(6): 1286-1301.
[2] ZHANG LiDong, GUO YiCong, HUANG HongYu, NIE Jing, WANG Bing, LI MengYu, LI JiaWang, SUI XiaoLei, LI YuHe. Correlation Analysis of Cucumber Fruit Quality Integrating Sensory Evaluation with Nutritional Traits and Flavor Compound Characteristics [J]. Scientia Agricultura Sinica, 2026, 59(5): 1087-1100.
[3] FENG WeiQing, NI YuanQian, FEI Teng, LI YouMei, XIE ZhaoSen. Differences in Vascular Bundle Morphological Structure, Distribution, and Water Transport Function in Grape Fruits of Different Shapes [J]. Scientia Agricultura Sinica, 2026, 59(1): 161-178.
[4] FU Han, YU Yang, AI Niu, ZHANG SiQing, YU LianWei, SUN ShuHao, ZHAO JinZhang, HAN XiaoYu, SHI Yan, YANG Xue. The Photosystem II Protein NbPsbQ1 Inhibits Viral Infection by Promoting Photosynthetic Efficiency [J]. Scientia Agricultura Sinica, 2026, 59(1): 90-100.
[5] YANG CaiLi, LI YongZhou, HE LiangLiang, SONG YinHua, ZHANG Peng, LIU ZhaoXian, LI PengHui, LIU SanJun. Genome-Wide Identification and Analysis of TPS Gene Family and Functional Verification of VvTPS4 in the Formation of Monoterpenes in Grape [J]. Scientia Agricultura Sinica, 2025, 58(7): 1397-1417.
[6] TENG MengXin, XU Ya, HE Jing, WANG Qi, QIAO Fei, LI JingYang, LI XinGuo. Identification and Functional Analysis of Ca2+-ATPase Gene Family in Banana [J]. Scientia Agricultura Sinica, 2025, 58(7): 1418-1433.
[7] ZHANG YaFeng, DONG WeiJin, LI QiYun, LU Yang, ZHANG ZhengKun, SUI Li. Effect of Interaction Between Beauveria bassiana and Potassium on Tomato Fruit Quality [J]. Scientia Agricultura Sinica, 2025, 58(6): 1131-1144.
[8] LI JianKun, PENG Chao, ZHANG ZiYang, LIANG Xi, WEI MingKang, YANG Qiang, LI BinQi, Muhammad Moaaz Ali, Viola Kayima, CHEN FaXing, DENG HongHong. Dynamics of Fruit Hollowness and Browning and Associated Lignin Accumulation and Its Genome-Wide Identification of Ps4CL Gene Family in Huangguan Plum [J]. Scientia Agricultura Sinica, 2025, 58(4): 759-778.
[9] ZHANG LinLin, GONG Rui, CUI YanLing, ZHONG XiongHui, LI Ye, LI RanHong, QIAN ZongWei. Effect Analysis of SmWRKY30 in Eggplant Resistance to Ralstonia solanacearum by Virus Induced Gene Silencing (VIGS) [J]. Scientia Agricultura Sinica, 2025, 58(3): 548-563.
[10] WANG TongChao, YU NingNing, CUI Dong, REN BaiZhao, ZHAO Bin, LIU Peng, REN Hao, XIONG Wei, ZHANG JiWang. Regulation of Fertilization and Kernel Set Characteristics in Summer Maize by Planting Density Under Drip Fertigation Conditions [J]. Scientia Agricultura Sinica, 2025, 58(24): 5156-5174.
[11] CHU TianShuo, CHEN XiaoAn, ZHU JinJin, WANG Ce, LOU Wei. Effects of Regulated Deficit Irrigation on Growth, Yield and Quality of Gannan Navel Orange During Critical Fertility Period [J]. Scientia Agricultura Sinica, 2025, 58(24): 5247-5258.
[12] GUO TianFa, WU JinLong, QIU QianQian, MA XinChao, WANG LiRong, WU CuiYun. Relationship Between the Formation of Non-Red Color in the Fruit Skin of Xinjiang Local Peach Varieties and the Variation of PpMYB10.1 Promoter [J]. Scientia Agricultura Sinica, 2025, 58(2): 326-338.
[13] QIN Jiaxin, OU LüSuo, XU ChenXi, ZOU YunQian, LU ChengQue, ZHU Feng, XU RangWei, CHEN XiangLing, QIN KeFeng, LI GuoGuo, CHENG YunJiang. Effect of Fluroxypyr-Meptyl on the Quality of Orah Mandarin During On-Tree Preservation [J]. Scientia Agricultura Sinica, 2025, 58(19): 3970-3984.
[14] YI ZeHui, WANG Ying, SONG HuiXia, ZHAO Jing, MAO LiPing. Genome-Wide Identification and Expression Analysis of Peroxiredoxins Gene Family in Asparagus officinalis [J]. Scientia Agricultura Sinica, 2025, 58(18): 3728-3743.
[15] WANG Di, HAN ShouAn, ZHANG Wen, WANG Min, SHI HuiDong, ZHU XueHui, BAI ShiJian, LIU XuPeng, TIAN Jia, XIE Hui. Effects of Different Plant Growth Regulators on Fruit and Raisin Quality of Thompson Seedless Grapes [J]. Scientia Agricultura Sinica, 2025, 58(18): 3767-3782.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!