Scientia Agricultura Sinica ›› 2019, Vol. 52 ›› Issue (24): 4518-4526.doi: 10.3864/j.issn.0578-1752.2019.24.007

• PLANT PROTECTION • Previous Articles     Next Articles

Pathogenicity and Gene Expression Pattern of the Exocrine Protein LtGH61A of Grape Canker Fungus

JunBo PENG,XingHong LI,Wei ZHANG,Ying ZHOU,JinBao HUANG,JiYe YAN()   

  1. Institute of Plant and Environment Protection, Beijing Academy of Agriculture and Forestry Sciences/Beijing Key Laboratory of Environmental Friendly Management of Diseases and Pests of North China Fruits, Beijing 100097
  • Received:2019-06-24 Accepted:2019-07-18 Online:2019-12-16 Published:2020-01-15
  • Contact: JiYe YAN E-mail:jiyeyan@vip.163.com

Abstract:

【Objective】Grape canker disease, caused by Botryosphaeria genus fungi, occurs in a wide range of grape-producing areas in China and seriously threatens the yield and quality of grape. The objective of this study is to analyze the function of a hypothetical exocrine protein, LtGH61A, in grape canker fungus Lasiodiplodia theobromae, and to lay a foundation for in-depth analysis of the pathogenic mechanism and disease control of grape canker fungus.【Method】The signal peptide of LtGH61A protein was predicted by SignalP 4.0. The function of LtGH61A protein was predicted by the homologous comparison and functional annotation. The exocrine characteristic of LtGH61A protein was analyzed by yeast complementary experiment. The quantitative real-time PCR (qRT-PCR) was used to analyze the expression of LtGH61A in vegetative hyphae and different infection processes. The expression of LtGH61A was inhibited through RNA interference (RNAi). The effect of LtGH61A protein on the pathogenicity of L. theobromae was analyzed by in vitro inoculation test of grape shoots. The effect of LtGH61A protein on the hyphal growth rate of L. theobromae was analyzed by comparing the colony diameter.【Result】Amino acid sequence analysis predicts that the N-terminal of the LtGH61A protein contains a signal peptide with a length of 18 amino acids. The gene function annotation suggests that LtGH61A belongs to glycoside hydrolase family 61 (GH61) and can degrade cellulose as a substrate. Yeast complementary experiments showed that the signal peptide of LtGH61A protein could guide the secretion of invertase of yeast YTK12. Compared with the vegetative hyphae, the expression of LtGH61A was increased significantly at the infectious stages, and the mRNA accumulation of LtGH61A at 48 h post inoculation was 19 times of that in the vegetative hyphae. Moreover, RNAi lines were constructed for LtGH61A and two lines RNAi-LtGH61A1 and RNAi-LtGH61A2 were confirmed by qRT-PCR. The results of in vitro inoculation test of wild-type and RNAi transformants on wounded grape shoots showed that the lesion length caused by both RNAi-LtGH61A1 and RNAi-LtGH61A2 was significantly shorter than that of wild type (WT) CSS-01s, which was about 55% of WT, indicating that LtGH61A affected the pathogenicity of L. theobromae. The colony diameter comparison showed that compared with WT, the colony diameter of RNAi-LtGH61A1 and RNAi-LtGH61A2 transformants became smaller, about 85% of WT, indicating that LtGH61A affected the hyphal growth rate of L. theobromae.【Conclusion】LtGH61A affects the pathogenicity and hyphal growth of grape canker pathogen. LtGH61A protein can be secreted outside the cell. The expression level of LtGH61A during infectious stages is significantly increased, suggesting that LtGH61A can destroy the host plant tissue by exerting its own enzyme activity function, thus promoting pathogen infection.

Key words: grape canker fungus, exocrine protein, pathogenicity, expression pattern, qRT-PCR, RNA interference (RNAi)

Table 1

The primers used in this study"

引物名称
Primer name
引物序列
Primer sequence
GH61PCR-f CACCTTCCCTGCCCTTGTTA
GH61PCR-r CGTGCGAGTAGTGGTTGGA
ACTINPCR-f CCAAGTCCAACCGTGAGAAG
ACTINPCR-r GAAGCGTACAGCGACAGAAC
pSUCGH61-f CGGAATTCATGAAGTTCTCTACCACCCT
pSUCGH61-r ATACTCGAGCATGCGGACGTACTTCCA

Fig. 1

The growth of different yeast transformants on YPDA, CMD-W, or YPRAA plates"

Fig. 2

The confirmation of LtGH61A RNAi transformants of L. theobromae"

Fig. 3

The growth rate and pathogenicity of LtGH61A RNAi transformants"

Fig. 4

The expression level of LtGH61A in vegetative hyphae and different infection processes"

[1] 张玮, 李兴红, 郭飞飞, 刘梅, 黄金宝, 燕继晔 . 两种葡萄溃疡病菌双重PCR检测方法的建立与应用. 植物保护学报, 2017,44(4):636-642.
ZHANG W, LI X H, GUO F F, LIU M, HUANG J B, YAN J Y . Establishment and application of duplex PCR assay for grape canker pathogens Botryosphaeria dothidea and Neofusicoccum parvum. Journal of Plant Protection, 2017,44(4):636-642. (in Chinese)
[2] YAN J Y, XIE Y, YAO S W, WANG Z Y, LI X H . Characterization of Botryosphaeria dothidea, the causal agent of grapevine canker in China. Australasian Plant Pathology, 2012,41(4):351-357.
[3] YAN J Y, XIE Y, ZHANG W, WANG Y, LIU J K, HYDE K D, SEEM R C, ZHANG G Z, WANG Z Y, YAO S W, BAI X J, DISSANAYAKE A J, PENG Y L, LI X H . Species of Botryosphaeriaceae involved in grapevine dieback in China. Fungal Diversity, 2013,61(1):221-236.
[4] YAN J Y, LI X H, KONG F F, WANG Z Y, GONG L Z, HE H P . Occurrence of grapevine trunk disease caused by Botryosphaeria rhodina in China. Plant Disease, 2011,95(2):219.
[5] YAN J Y, PENG Y L, XIE Y, LI X H, YAO S W, TANG M L, WANG Z Y . First report of grapevine trunk disease caused by Botryosphaeria obtusa in China. Plant Disease, 2011,95(5):616.
[6] DISSANAYAKE A J, ZHANG W, LIU M, CHUKEATIROTE E, YAN J Y, LI X H, HYDE K D . Lasiodiplodia pseudotheobromae causes pedicel and peduncle discolouration of grapes in China. Australasian Plant Disease Notes, 2015,10:21.
[7] DISSANAYAKE A J, ZHANG W, LI X H, ZHOU Y, CHETHANA T, CHUKEATIROTE E, HYDE K D, YAN J Y, ZHANG G Z, ZHAO W S . First report ofNeofusicoccum mangiferae associated with grapevine dieback in China. Phytopathologia Mediterranea, 2015,54(2):414-419.
[8] ELGOORANI M A, ELMELEIGI M A . Dieback of grapevine by Botryodiplodia theobromae Pat. in Egypt. Phytopathologia Mediterranea, 1972,11(3):210-211.
[9] PHILLIPS A J L . Botryosphaeria dothidea and other fungi associated with excoriose and dieback of grapevines in Portugal. Journal of Phytopathology, 1998,146(7):327-332.
[10] LARIGNON P, FULCHIC R, CERE L, DUBOS B . Observation on black dead arm in French vineyards. Phytopathologia Mediterranea, 2001,40(Suppl.):S336-S342.
[11] PHILLIPS A J L . Botryosphaeria species associated with diseases of grapevines in Portugal. Phytopathologia Mediterranea, 2002,41(1):3-18.
[12] TAYLOR A, HARDY G E, WOOD P, BURGESS T . Identification and pathogenicity of Botiyosphaeria species associated with grapevine decline in Western Australia. Australasian Plant Pathology, 2005,34(2):187-195.
[13] URBEZ-TORRES J R . The status of Botryosphaeriaceae species infecting grapevines. Phytopathologia Mediterranea, 2011,50(Suppl.):S5-S45.
[14] VAN NIEKERK J M, FOURIE P H, HALLEEN F, CROUS P W . Botryosphaeria spp. as grapevine trunk pathogens. Phytopathologia Mediterranea, 2006,45(Suppl.):S43-S54.
[15] ÚRBEZ-TORRES J R, LEAVITT G M, GUERRERO J C, GUEVARA J, GUBLER W D . Identification and pathogenicity of Lasiodiplodia theobromae and Diplodia seriata, the causal agents of bot canker disease of grapevines in Mexico. Plant Disease, 2008,92(4):519-529.
[16] FAN K, WANG J, FU L, ZHANG G F, WU H B, FENG C, QU J L . Baseline sensitivity and control efficacy of pyraclostrobin againstBotryosphaeria dothidea isolates in China. Plant Disease, 2019,103(7):1458-1463.
[17] PAN J L, HAO X, YAO H W, GE K K, MA L, MA W . Matrine inhibits mycelia growth of Botryosphaeria dothidea by affecting membrane permeability. Journal of Forestry Research, 2019,30(3):1105-1113.
[18] TROTEL-AZIZ P, ABOU-MANSOUR E, COURTEAUX B, RABENOELINA F, CLÉMENT C, FONTAINE F, AZIZ A . Bacillus subtilis PTA-271 counteracts Botryosphaeria dieback in grapevine, triggering immune responses and detoxification of fungal phytotoxins. Frontiers in Plant Science, 2019,10:25.
[19] COBOS R, BARREIRO C, MATEOS R M COQUE J J R . Cytoplasmic- and extracellular-proteome analysis ofDiplodia seriata: A phytopathogenic fungus involved in grapevine decline. Proteome Science, 2010,8:46.
[20] PAOLINELLI-ALFONSO M, VILLALOBOS-ESCOBEDO J M, ROLSHAUSEN P, HERRERA-ESTRELLA A, GALINDO-SÁNCHEZ C, LÓPEZ-HERNÁNDEZ J F, HERNANDEZ-MARTINEZ R . Global transcriptional analysis suggests Lasiodiplodia theobromae pathogenicity factors involved in modulation of grapevine defensive response. BMC Genomics, 2016,17:615.
[21] YAN J Y, ZHAO W S, CHEN Z, XING Q K, ZHANG W, CHETHANA K W T, XUE M F, XU J P, PHILLIPS A J L, WANG Y, LIU J H, LIU M, ZHOU Y, JAYAWARDENA R S, MANAWASINGHE I S, HUANG J B, QIAO GH, FU C Y, GUO F F, DISSANAYAKE A J, PENG Y L, HYDE K D, LI X H . Comparative genome and transcriptome analyses reveal adaptations to opportunistic infections in woody plant degrading pathogens of Botryosphaeriaceae. DNA Research, 2018,25(1):87-102.
[22] MARTOS S, ANDOLFI A, LUQUE J, MUGNAI L, SURICO G, EVIDENTE A . Production of phytotoxic metabolites by five species of Botryosphaeriaceae causing decline on grapevines, with special interest in the species Neofusicoccum luteum and N. parvum. European Journal of Plant Pathology, 2008,121(4):451-461.
[23] EVIDENTE A, PUNZO B, ANDOLFI A, CIMMINO A, MELCK D, LUQUE J . Lipophilic phytotoxins produced by Neofusicoccum parvum, a grapevine canker agent. Phytopathologia Mediterranea, 2010,49(1):74-79.
[24] ANDOLFI A, MUGNAI L, LUQUE J, SURICO G, CIMMINO A, EVIDENTE A . Phytotoxins produced by fungi associated with grapevine trunk diseases. Toxins, 2011,3(12):1569-1605.
[25] ABOU-MANSOUR E, DÉBIEUX J L, RAMÍREZ-SUERO M, BÉNARD-GELLON M, MAGNIN-ROBERT M, SPAGNOLO A, CHONG J, FARINE S, BERTSCH C, L'HARIDON F, SERRANO M, FONTAINE F, REGO C, LARIGNON P . Phytotoxic metabolites from Neofusicoccum parvum, a pathogen of Botryosphaeria dieback of grapevine. Phytochemistry, 2015,115:207-215.
[26] VAAJE-KOLSTAD G, HORN S J, VAN AALTEN D M F, SYNSTAD B, EIJSINK V G H . The non-catalytic chitin-binding protein CBP21 from Serratia marcescens is essential for chitin degradation. The Journal of Biological Chemistry, 2005,280(31):28492-28497.
[27] LANGSTON J A, SHAGHASI T, ABBATE E, XU F, VLASENKO E, SWEENEY M D . Oxidoreductive cellulose depolymerization by the enzymes cellobiose dehydrogenase and glycoside hydrolase 61. Applied and Environmental Microbiology, 2011,77(19):7007-7015.
[28] LOMBARD V, GOLACONDA RAMULU H, DRULA E, COUTINHO P M, HENRISSAT B . The carbohydrate-active enzymes database (CAZy) in 2013. Nucleic Acids Research, 2014,42(Database issue):D490-D495.
[29] KARKEHABADI S, HANSSON H, KIM S, PIENS K, MITCHINSON C, SANDGREN M . The first structure of a glycoside hydrolase family 61 member, Cel61B from Hypocrea jecorina, at 1.6 Å resolution. Journal of Molecular Biology, 2008,383(1):144-154.
[30] SALINAS A, VEGA M, LIENQUEO M E, GARCIA A, CARMONA R, SALAZAR O . Cloning of novel cellulases from cellulolytic fungi: Heterologous expression of a family 5 glycoside hydrolase from Trametes versicolor in Pichia pastoris. Enzyme and Microbial Technology, 2011,49(6/7):485-491.
[31] KOSEKI T, MESE Y, FUSHINOBU S, MASAKI K, FUJII T, ITO K, SHIONO Y, MURAYAMA T, IEFUJI H . Biochemical characterization of a glycoside hydrolase family 61 endoglucanase from Aspergillus kawachii. Applied Microbiology and Biotechnology, 2008,77(6):1279-1285.
[32] RAJESHWARI R, JHA G, SONTI R V . Role of an in planta-expressed xylanase of Xanthomonas oryzae pv.oryzae in promoting virulence on rice. Molecular Plant-Microbe Interactions, 2005,18(8):830-837.
[33] JACOBS K A, COLLINS-RACIE L A, COLBERT M, DUCKETT M, GOLDEN-FLEET M, KELLEHER K, KRIZ R, LAVALLIE E R, MERBERG D, SPAULDING V, STOVER J, WILLIAMSON M J, MCCOY J M . A genetic selection for isolating cDNAs encoding secreted proteins. Gene, 1997,198(1/2):289-296.
[34] FANG A, HAN Y Q, ZHANG N, ZHANG M, LIU L J, LI S, LU F, SUN W X . Identification and characterization of plant cell death- inducing secreted proteins from Ustilaginoidea virens. Molecular Plant-Microbe Interactions, 2016,29(5):405-416.
[35] 孔祥久, 石洁, 孔繁芳, 王忠跃, 张昊 . 葡萄霜霉菌候选效应子RXLR5信号肽的鉴定. 植物保护, 2016,42(1):40-44.
KONG X J, SHI J, KONG F F, WANG Z Y, ZHANG H . Identification of the signal peptide of candidate effector protein RXLR5 from Plasmopara viticola. Plant Protection, 2016,42(1):40-44. (in Chinese)
[36] GU B, KALE S D, WANG Q H, WANG D H, PAN Q N, CAO H, MENG Y L, KANG Z S, TYLER B M, SHAN W X . Rust secreted protein Ps87 is conserved in diverse fungal pathogens and contains a RXLR-like motif sufficient for translocation into plant cells. PLoS ONE, 2011,6(11):e27217.
[37] DOU D, KALE S D, WANG X, JIANG R H, BRUCE N A, ARREDONDO F D, ZHANG X, TYLER B M . RXLR-mediated entry of Phytophthora sojae effector Avr1b into soybean cells does not require pathogen-encoded machinery. The Plant Cell, 2008,20(7):1930-1947.
[1] ZHANG Qi, CHEN ErHu, SUN DeHong, TANG PeiAn. Relationship Between Glutathione S-Transferase Genes CfGSTe1 and CfGSTd1 and Ethyl Formate Tolerance in Cryptolestes ferrugineus [J]. Scientia Agricultura Sinica, 2026, 59(5): 1008-1019.
[2] DONG Yu, WU Qian, FENG Xuan, ZHENG YinYing, CUI BaiMing. A Novel Plasmid pEA60 of Erwinia amylovora Enhances the Pathogenicity of Strains by Regulating the Synthesis of Virulence Factors [J]. Scientia Agricultura Sinica, 2026, 59(5): 996-1007.
[3] JIANG Feng, WU ChunYan, WANG YiHao, YANG ZeZhong, GONG Cheng, LUO Chen. Identification and Expression Analysis of the Fatty Acid Elongase Gene Family in Bemisia tabaci MED [J]. Scientia Agricultura Sinica, 2026, 59(4): 793-806.
[4] WEI Ping, PAN JuZhong, ZHU DePing, SHAO ShengXue, CHEN ShanShan, WEI YaQian, GAO WeiWei. The Function of OsDREB1J in Regulating Rice Grain Size [J]. Scientia Agricultura Sinica, 2025, 58(8): 1463-1478.
[5] LIU LuPing, HU XueJie, QI Jin, CHEN Qiang, LIU Zhi, ZHAO TianTian, SHI XiaoLei, LIU BingQiang, MENG QingMin, ZHANG MengChen, HAN TianFu, YANG ChunYan. Cloning of the Promoters and Analysis of Expression Patterns of Maturity Genes E1 and E2 in Soybean [J]. Scientia Agricultura Sinica, 2025, 58(5): 840-850.
[6] CHEN ErHu, TANG JingJie, HU ShunJie, TANG PeiAn. The Roles of Heat Shock Protein Genes CfHsp70-1 and CfHsp70-2 in Enhancing the High-Temperature Tolerance after Heat Acclimation in Cryptolestes ferrugineus [J]. Scientia Agricultura Sinica, 2025, 58(5): 918-928.
[7] CONG QiQi, ZHANG JingYi, MENG XiangLong, DAI PengBo, LI Bo, HU TongLe, WANG ShuTong, CAO KeQiang, WANG YaNan. Identification of Hypovirus in Apple Ring Rot Fungus Botryosphaeria dothidea and Detection of Virus-Carrying Status in China [J]. Scientia Agricultura Sinica, 2025, 58(3): 478-492.
[8] TONG ZhaoYang, LIU WenHua, ZHANG GuoXin, DONG ChunYan, ZHANG YanXia, XU XiaoWei, HE Dong, LIU HeChun, LI Yang, WANG FengTao, FENG Jing, YAO XiaoBo, LIU MeiJin, LIN RuiMing. The Relationship Between Occurrence of Hulless Barley Ear Rot and Population Migration of Grass Mite (Siteroptes spp.) [J]. Scientia Agricultura Sinica, 2025, 58(3): 493-506.
[9] XU DuoDuo, DU QianQian, ZHAO LiXiang, LI Yan, HUANG Gan, LI YongHua, LU JiuXing. Genome-Wide Analysis of AP2/ERF Transcription Factors in Peony [J]. Scientia Agricultura Sinica, 2025, 58(23): 5031-5045.
[10] XIAO ZhuoDan, QIAO JiaZheng, GAO YuLan, SHANG ZhangYin, LIU Huai, WANG Jia. Silencing of Cytochrome P450 Genes CYP6CY53 and CYP302A1 in Aphis craccivora Enhances the Sensitivity to Flonicamid [J]. Scientia Agricultura Sinica, 2025, 58(18): 3664-3675.
[11] YANG WenJuan, GAO JiaCheng, WANG YanTing, LI Yan, GUO Ming, WANG JunCheng, MENG YaXiong, WANG HuaJun, SI ErJing. Function of Effector Pg00778 Regulation on the Pathogenicity of Pyrenophora graminea to Barley [J]. Scientia Agricultura Sinica, 2025, 58(15): 3020-3035.
[12] CHEH ErHu, YUAN GuoQing, CHEN Yan, CHEN MengQiu, SUN ShengYuan, TANG PeiAn. Mitochondrial Protein-Coding Genes Nad5, Nad6 and Atp6 are Involved in Phosphine Resistance of Cryptolestes ferrugineus [J]. Scientia Agricultura Sinica, 2024, 57(9): 1722-1733.
[13] WANG ChengZe, ZHANG Yan, FU Wei, JIA JingZhe, DONG JinGao, SHEN Shen, HAO ZhiMin. Bioinformatics and Expression Pattern Analysis of Maize ACO Gene Family [J]. Scientia Agricultura Sinica, 2024, 57(7): 1308-1318.
[14] DONG ZaiFang, DING TengTeng, SHAN YiXuan, LI HongLian, CHEN LinLin, XING XiaoPing. Autophagy-Related Gene FpAtg3 Involves in Growth and Pathogenicity of Fusarium pseudograminearum [J]. Scientia Agricultura Sinica, 2024, 57(6): 1080-1090.
[15] LUO LiDan, CHEN JiaMing, AN Qi, LIU Lei, SUN QinZhe, LIU Huan, WANG SenShan, SONG LiWen. Effects of Extreme High Temperature on Trehalose Content and Trehalose Transporter Gene in Tetranychus truncatus [J]. Scientia Agricultura Sinica, 2024, 57(6): 1091-1101.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!