Scientia Agricultura Sinica ›› 2021, Vol. 54 ›› Issue (10): 2039-2052.doi: 10.3864/j.issn.0578-1752.2021.10.001

• CROP GENETICS & BREEDING·GERMPLASM RESOURCES·MOLECULAR GENETICS • Previous Articles     Next Articles

OsCSC11 Mediates Dry-Hot Wind/Drought-Induced Ca2+ Signal to Regulate Stamen Development in Rice

REN ZhiJie(),LI Qian,SUN YuJia,KONG DongDong,LIU LiangYu,HOU CongCong(),LI LeGong()   

  1. College of Life Sciences, Capital Normal University/Key Laboratory of Plant Gene Resources and Biotechnology for Carbon Reduction and Environmental Improvement, Beijing Municipal Government, Beijing 100048
  • Received:2021-03-21 Accepted:2021-04-14 Online:2021-05-16 Published:2021-05-24
  • Contact: CongCong HOU,LeGong LI E-mail:renzj0424@163.com;congconghou@cnu.edu.cn;lgli@cnu.edu.cn

Abstract:

【Objective】When rice is occasionally stressed by dry-hot wind (DHW) or drought at flowering stage, the yield greatly decreases due to the rapid water loss in developing gamete cells. During this process, calcium as a universal second messenger mediates cellular signal transduction in response to drought or other stresses. However, the underlying molecular mechanism remains elusive. This study attempts to dissect the physiological and molecular function of Oryza sativa Calcium-permeable Stress-responsive Cation channels (OsCSCs) which will provide a new strategy for studying the stress responsive mechanism to DHW in crops.【Method】Based on the methods of genetics, electrophysiology and bioinformatics, a typical receptor-like-channel named OsCSC11 was identified. The expression pattern of OsCSC11 were analyzed by qRT-PCR and GUS staining. Further, subcellular localization of OsCSC11-GFP was observed in Arabidopsis protoplasts and onion epidermal cells. Meanwhile, the oscsc11 mutants were generated by CRISPR/Cas9 gene editing tool. Finally, the phenotype and physiological functions were analyzed by cytological method. 【Result】Sequence alignment results in DUF221 family revealed that OsCSC11 includes a typical conserved domain and some unique motifs, which belongs to an independent subfamily. OsCSC11 is mainly expressed in anthers and leaves in rice. Further analysis showed that the activity of full-length protein of OsCSC11 which is in a resting state can be activated by the hypertonic solution. However, OsCSC11ΔTM1-3(TM1-3 was truncated in OsCSC11) has constitutive channel activity that specifically mediates divalent cations of calcium and magnesium. Thus, we speculated that TM1-3 is a receptor domain in CSCs/OSCAs channel for sensing DHW stresses, and the rest part of OsCSC11 (OsCSC11ΔTM1-3) generates calcium signal. OsCSC11 and OsCSC11ΔTM1-3 are both localized in the plasma membrane which may be related to the receptor function. In loss of function mutants oscsc11-1 and oscsc11-2, anthers become smaller and wrinkler compared to wild type, and pollen sterility rate reached to 60%-70% and water content dramatically reduced.【Conclusion】OsCSC11 functions in regulating anther water status and pollen development through mediating calcium influx and possibly involves in the primary sensing step under DHW stresses.

Key words: rice (Oryza sativa L.), dry-hot wind/drought, receptor-like channel, abnormal stamen, pollen sterility

Table 1

Primers used in this study"

引物名称
Primer name
引物序列
Primer sequence (5′-3′)
用途
Purpose
CSC11-BamHⅠ-F CGGGATCCATGGGGCCGACCGCGCCGCCGCCGGACGCCG 蛙卵表达载体构建
Vector construction for oocyte expression
CSC11-EcoRⅠ-R GGAATTCTCAGGATTGATACAGGCTCCAATCC
CSC11ΔTM1-3-BamHⅠ-F CGGGATCCATGGAGGACGCCCTTCGCA
ProCSC11- Hind Ⅲ-F CCCAAGCTTTATAGAATGGGTCATCATAGCA p1300-proCSC11-GUS表达载体构建
Construction of of p1300-proCSC11-GUS vector
ProCSC11- BamHⅠ-R CGGGATCCCGCCGGGGGACGGGGACGTGAC
CSC11- EcoRⅠ-F GGAATTCATGGGGCCGACCGCGCCGCCGCCGGACGCCG GFP融合表达载体
GFP-CSC11
expression vector
CSC11-BamHⅠ-R CGGGATCCGGATTGATACAGGCTCCAATCC
CSC11ΔTM1-3-EcoRⅠ-F GGAATTCATGGAGGACGCCCTTCGCA
Target-F GCGGCGGGGAGCCGGAGGCG 基因敲除载体
Gene editing
Target-R CGCCTCCGGCTCCCCGCCGC
CSC11-CRI-F ACCTCGCGTGATCTAGCCCCACC 靶点检测及测序引物
Target detection and sequencing primer
CSC11-CRI-R GCTTCTCTCAAGCTGGAGCTCC
11-qRT-F GGGCATTCCCAAGACGCT qRT-PCR检测引物
Primers used for qRT-PCR
11-qRT-R CCAAGAAATCCTGTTCCGCA
OsACTIN1-F TCCATCTTGGCATCTCTCAG
OsACTIN1-R GTACCCGCATCAGGCATCTG

Fig. 1

The phylogenetic tree of CSCs family in Arabidopsis and rice"

Fig. 2

Protein alignment of OsCSC11 and part of AtCSC members"

Fig. 3

The expression pattern of OsCSC11 A: Expression of OsCSC11 in various organs analyzed by qRT-PCR; Roots, culms, leaves, and sheathes were harvested from WT plants before heading. Anthers and pistils from spikelet hulls were collected two days before fertilization. Numbers of 1, 5, 10, 15 and 20 stand for different lengths (cm) of the heading panicles. B-E: GUS staining of various tissues from ProOsCSC11-GUS transgenic plants. B: Seedlings grow for 1 day, 2 day, 3 day, 4 day and 7 day were represented (scale bar=0.5 cm); C: Rice floret during pollination (scale bar=0.1 cm); D: Anthers (scale bar=0.05 cm); E: Pollens (scale bar=100 μm)"

Fig. 4

Subcellular localization of OsCSC11 Transient expression in Arabidopsis mesophyll protoplasts (A) and onion epidermal cells (B) with 35S-OsCSC11-GFP and 35S-GFP (Scale bar = 5 μm in A, and Scale bar = 50 μm in B)"

Fig. 5

Electrophysiological analysis of OsCSC11 A: Whole-cell recording of OsCSC11-expressing Xenopus laevis oocytes and the water-injected control oocytes perfused with hyperosmotic solution containing 500 mM D-mannitol. The holding potential was at -100 mV. The X-axis represents the recording time and the Y-axis represents the current. The solid and dotted lines indicate traces and 0 μA current, respectively. B: Current amplitudes evoked by the application of hyperosmotic stress (n> 3) C: Prediction of transmembrane helices in OsCSC11 and OsCSC11ΔTM1-3. D: Electrophysiological activity of OsCSC11and OsCSC11ΔTM1-3 in oocytes, and the oocytes injected with water as a control. E: Statistic analysis of the maximum currents at holding potential of -140 mV as in B (n > 5). F: Selectivity analysis of OsCSC11 and OsCSC11ΔTM1-3 (n >5). The data are shown as mean ± SD in B, E and F"

Fig. 6

Diagram of the sgRNA design and identification of oscsc11 mutants A: The diagram of OsCSC11 and the sgRNA. The target and PAM sequences are in blue and red respectively. B: Identification of mutation types in gene-edited plants. The inserted bases are shown in red and the deleted bases are indicated by green dotted lines. +1 means 1-bp-insertion and -2 means 2-bp-deletion. C: The sequencingmap of homozyg mutants. The red arrows indicate insertion or deletion positions"

Fig. 7

Phenotype analysis of the spikelets in wild type and oscsc11 mutant A: The spikelet of WT and oscsc11 at stage of pollination, Scale Bar = 1 cm in A and 0.5 cm in B; C: morphological observation of spikelets, stamen and pistils before pollination, Scale Bar = 0.2 cm in upper panel and 0.1 cm in lower panel; D: The stamen of WT and oscsc11 before pollination, Scale Bar = 0.1 cm; E: The moisture content of mature pollens, every sample contains one hundred spikelets, the data are shown as mean ± SD, n=4"

Fig. 8

I2-KI staining of pollens in wild type and oscsc11 mutants A: The morphological observation of stamen and I2-KI staining of pollen in WT oscsc11-1 and oscsc11-2 one day before flowering. The scale bars are 0.2 cm, 200 μm and 50 μm in the up, middle and bottom panel, respectively. B: Statistic analysis of I2-KI staining. The data are shown as mean ± SD, about 100-200 pollens were counted in each sample"

[1] SANDERS D, BROWNLEE C, HARPER J F. Communicating with calcium. The Plant Cell, 1999,11:691-706.
doi: 10.1105/tpc.11.4.691
[2] GILROY S, TREWAVAS A. Signal processing and transduction in plant cells: The end of the beginning? Nature Reviews Molecular Cell Biology, 2001,2(4):307-314.
doi: 10.1038/35067109
[3] LEE H J, SEO P J. Ca2+ talyzing initial responses to environmental stresses. Trends in Plant Science, 2021,8:S1360-1385.
[4] KUDLA J, BECKER D, GRILL E, HEDRICH R, HIPPLER M, KUMMER U, PARNISKE M, ROMEIS T, SCHUMACHER K. Advances and current challenges in calcium signaling. New Phytologist, 2018,218(2):414-431.
doi: 10.1111/nph.14966
[5] SWARBRECK S M, COLAÇO R, DAVIES J M. Plant calcium- permeable channels. Plant Physiology, 2013,163(2):514-522.
doi: 10.1104/pp.113.220855
[6] HACHEZ C, BESSERER A, CHEVALIER A S, CHAUMONT F. Insights into plant plasma membrane aquaporin trafficking. Trends in Plant Science, 2013,18(6):344-352.
doi: 10.1016/j.tplants.2012.12.003
[7] HOU C C, TIAN W, KLEIST T, HE K, GARCIA V, BAI F, HAO Y L, LUAN S, LI L G. DUF221 proteins are a family of osmosensitive calcium-permeable cation channels conserved across eukaryotes. Cell Research, 2014,24(5):632-635.
doi: 10.1038/cr.2014.14
[8] ZHANG M, WANG D, KANG Y, WU J X, YAO F, PAN C, YAN Z, SONG C, CHEN L. Structure of the mechanosensitive OSCA channels. Nature Structural & Molecular Biology, 2018,25(9):850-858.
doi: 10.1038/s41594-018-0117-6
[9] MURTHY S E, DUBIN A E, WHITWAM T, JOJOA-CRUZ S, CAHALAN S M, MOUSAVI S A R, WARD A B, PATAPOUTIAN A. OSCA/TMEM63 are an evolutionarily conserved family of mechanically activated ion channels. Elife, 2018,7:e41844.
doi: 10.7554/eLife.41844
[10] JOJOA-CRUZ S, SAOTOME K, MURTHY S E, TSUI C C A, SANSOM M S, PATAPOUTIAN A, WARD A B. Cryo-EM structure of the mechanically activated ion channel OSCA1.2. Elife, 2018,7:e41845.
doi: 10.7554/eLife.41845
[11] LI Q, MONTELL C. Mechanism for food texture preference based on grittiness. Current Biology, 2021,31:1-12.
doi: 10.1016/j.cub.2020.09.070
[12] DU H, YE C, WU D, ZANG Y Y, ZHANG L, CHEN C, HE X Y, YANG J J, HU P, XU Z, WAN G, SHI Y S. The cation channel TMEM63B is an osmosensor required for hearing. Cell Report, 2020,31(5):107596.
doi: 10.1016/j.celrep.2020.107596
[13] LANGRIDGE P, REYNOLDS M. Breeding for drought and heat tolerance in wheat. Theoretical and Applied Genetics, 2021, doi: 10.1007/s00122-021-03795-1.
[14] LAWAS L M F, LI X, ERBAN A, KOPKA J, JAGADISH S V K, ZUTHER E, HINCHA D K. Metabolic responses of rice cultivars with different tolerance to combined drought and heat stress under field conditions. Gigascience, 2019, 8(5): giz050.
[15] VAN E S S W . Too hot to handle, the adverse effect of heat stress on crop yield. Physiologia Plantarum, 2020,169(4):499-500.
doi: 10.1111/ppl.v169.4
[16] ZHAO C, LIU B, PIAO S, WANG X, LOBELL D B, HUANG Y, HUANG M, YAO Y, BASSU S, CIAIS P, DURAND J L, ELLIOTT J, EWERT F, JANSSENS I A, LI T, LIN E, LIU Q, MARTRE P, MÜLLER C, PENG S, PEÑUELAS J, RUANE A C, WALLACH D, WANG T, WU D, LIU Z, ZHU Y, ZHU Z, ASSENG S. Temperature increase reduces global yields of major crops in four independent estimates. Proceedings of the National Academy of Sciences of the United States of America, 2017,114(35):9326-9331.
[17] ZHANG C X, FENG B H, CHEN T T, FU W M, LI H B, LI G Y, JIN Q Y, TAO L X, FU G F. Heat stress-reduced kernel weight in rice at anthesis is associated with impaired source-sink relationship and sugars allocation. Environmental and Experimental Botany, 2018,155:718-733.
doi: 10.1016/j.envexpbot.2018.08.021
[18] ARSHAD M S, FAROOQ M, ASCH F, KRISHNA J S V, PRASAD P V V, SIDDIQUE K H M. Thermal stress impacts reproductive development and grain yield in rice. Plant Physiology and Biochemistry, 2017,115:57-72.
doi: 10.1016/j.plaphy.2017.03.011
[19] FU G F, SONG J, XIONG J, LIAO X Y, ZHANG X F, WANG X, LE M K, TAO L X. Thermal resistance of common rice maintainer and restorer lines to high temperature during flowering and early grain filling stages. Rice Science, 2012,19:309-314.
doi: 10.1016/S1672-6308(12)60055-9
[20] SATAKE T, YOSHIDA S. High temperature-induced sterility in Indica Rices at flowering. Japanese Journal of Crop Science, 1978,47:6-17.
doi: 10.1626/jcs.47.6
[21] SAKATA T, OSHINO T, MIURA S, TOMABECHI M, TSUNAGA Y. Auxins reverse plant male sterility caused by high temperatures. Proceedings of the National Academy of Sciences of the United States of America, 2010,107:8569-8574.
[22] 曹珍珍. 高温对水稻花器伤害和籽粒品质影响的相关碳氮代谢机理[D]. 杭州: 浙江大学, 2014.
CAO Z Z. Mechanism of carbon and nitrogen metabolism related to effects of high temperature on floral organ injury and grain quality of rice[D]. Hangzhou: Zhejiang University, 2014. (in Chinese)
[23] MATSUI T, OMASA K, HORIE T. High temperature-induced spikelet sterility of japonica rice at flowering in relation to air temperature, humidity and wind velocity conditions. Japanese Journal of Crop Science, 1997,66(3):449-455.
doi: 10.1626/jcs.66.449
[24] SATAKE T, YOSHIDA S. High temperature-induced sterility in indica rice at flowering. Japanese Journal of Crop Science, 2011,47(1):6-17.
doi: 10.1626/jcs.47.6
[25] MATSUI T, OMASA K, HORIE T. The difference in sterility due to high temperatures during the flowering period among japonica-rice varieties. Plant Production Science, 2001,4(2):90-93.
doi: 10.1626/pps.4.90
[26] ZHAI Y, WEN Z, HAN Y, ZHUO W, WANG F, XI C, LIU J, GAO P, ZHAO H, WANG Y, WANG Y, HAN S. Heterogeneous expression of plasma-membrane-localised OsOSCA1.4 complements osmotic sensing based on hyperosmolality and salt stress in Arabidopsis osca1 mutant. Cell Calcium, 2020,91:102261.
doi: 10.1016/j.ceca.2020.102261
[27] LIVAK K J, SCHMITTGEN T D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method . Methods, 2001,25:402-408.
doi: 10.1006/meth.2001.1262
[28] KOMARI T. Efficient transformation of rice (Oryza sativa L.) mediated by Agrobacterium and sequence analysis of the boundaries of the T-DNA. Plant Journal for Cell & Molecular Biology, 2010,6:271-282.
[29] JEFFERSON R A. The GUS reporter gene system. Nature, 1989,342:837-838.
doi: 10.1038/342837a0
[30] YOO S D, CHO Y H, SHEEN J. Arabidopsis mesophyll protoplasts: A versatile cell system for transient gene expression analysis. Nature Protocol, 2007,2:1565-1572.
doi: 10.1038/nprot.2007.199
[31] EADY C, WELD R, LISTER C. Agrobacterium tumefaciens- mediated transformation and regeneration of onion (Allium cepa L.). Plant Cell Report, 2000,19:376-381.
doi: 10.1007/s002990050743
[32] ZHANG S S, PAN Y J, TIAN W, DONG M Q, ZHU H F, LUAN S, LI L G. Arabidopsis CNGC14 mediates calcium influx required for tip growth in root hairs. Molecular Plant, 2017,10(7):1004-1006.
doi: 10.1016/j.molp.2017.02.007
[33] PAN Y J, CHAI X Y, GAO Q F, ZHOU L M, ZHANG S S, LI L G, LUAN S. Dynamic interactions of plant CNGC subunits and calmodulins drive oscillatory Ca2+ channel activities . Developmental Cell, 2019,48(5):710-725.
doi: 10.1016/j.devcel.2018.12.025
[34] TIAN W, HOU C C, REN Z J, WANG C, ZHAO F G, DAHLBECK D, HU S, ZHANG L Y, NIU Q, LI L G, STASKAWICZ B J, LUAN S. A calmodulin-gated calcium channel links pathogen patterns to plant immunity. Nature, 2019,572(7767):131-135.
doi: 10.1038/s41586-019-1413-y
[35] KUDLA J, BATISTIC O, HASHIMOTO K. Calcium signals: The lead currency of plant information processing. The Plant Cell, 2010,22(3):541-563.
doi: 10.1105/tpc.109.072686
[36] BERRIDGE M J, LIPP P, BOOTMAN M D. The versatility and universality of calcium signalling. Nature Reviews Molecular Cell Biology, 2000,1:11-21.
doi: 10.1038/35036035
[37] DAVENPORT R. Glutamate receptors in plants. Annals of Botany, 2002,90(5):549-557.
doi: 10.1093/aob/mcf228
[38] JHA S K, SHARMA M, PANDEY G K. Role of cyclic nucleotide gated channels in stress management in plants. Current Genomics, 2016,17(4):315-329.
doi: 10.2174/1389202917666160331202125
[39] FORDE B G, ROBERTS M R. Glutamate receptor-like channels in plants: A role as amino acid sensors in plant defence? F1000Prime Reports, 2014,6:37.
[40] WANG X H, FENG C X, TIAN L L, HOU C C, TIAN W, HU B, ZHANG Q, REN Z J, NIU Q, SONG J L, KONG D D, LIU L Y, HE Y K, MA L G, CHU C C, LUAN S, LI L G. A transceptor-channel complex couples nitrate sensing to calcium signaling in Arabidopsis. Molecular Plant, 2021,14(5):774-786.
doi: 10.1016/j.molp.2021.02.005
[41] YUAN F, YANG H, XUE Y, KONG D, YE R, LI C, ZHANG J, THEPRUNGSIRIKUL L, SHRIFT T, KRICHILSKY B, JOHNSON D M, SWIFT G B, HE Y, SIEDOW J N, PEI Z M. OSCA1 mediates osmotic-stress-evoked Ca2+ increases vital for osmosensing in Arabidopsis. Nature, 2014,514(7522):367-371.
doi: 10.1038/nature13593
[42] DENIS V, CYERT M S. Internal Ca2+ release in yeast is triggered by hypertonic shock and mediated by a TRP channel homologue. Journal of Cell Biology, 2002,156:29-34.
[43] CATERINA M J, SCHUMACHER M A, TOMINAGA M, ROSEN T A, LEVINE J D, JULIUS D. The capsaicin receptor: A heat- activated ion channel in the pain pathway. Nature, 1997,389(6653):816-824.
doi: 10.1038/39807
[44] PEIER A M, MOQRICH A, HERGARDEN A C, REEVE A J, ANDERSSON D A, STORY G M, EARLEY T J, DRAGONI I, MCINTYRE P, BEVAN S, PATAPOUTIAN A. A TRP channel that senses cold stimuli and menthol. Cell, 2002,108(5):705-715.
doi: 10.1016/S0092-8674(02)00652-9
[45] MCKEMY D D, NEUHAUSSER W M, JULIUS D. Identification of a cold receptor reveals a general role for TRP channels in thermosensation. Nature, 2002,416(6876):52-58.
doi: 10.1038/nature719
[46] VANNESTE M, SEGAL A, VOETS T, EVERAERTS W. Transient receptor potential channels in sensory mechanisms of the lower urinary tract. Nature Reviews Urology, 2021,18(3):139-159.
doi: 10.1038/s41585-021-00428-6
[47] ZHOUX L, BATIZA A F, LOUKIN S H, PALMER C P, KUNG C, SAIMI Y. The transient receptor potential channel on the yeast vacuole is mechanosensitive. Proceedings of the National Academy of Sciences of the United States of America, 2003,100(12):7105-7110.
[48] ZHANG Y F, MARK A H, JAYARAM C, KEN L MUELLER, BOAZ C, WU D Q, CHARLES S ZUKER, NICHOLAS J P R. Coding of sweet, bitter, and umami tastes: Different receptor cells sharing similar signaling pathways. Cell, 2003,112:293-301.
doi: 10.1016/S0092-8674(03)00071-0
[1] ZHUANG LiHua, LUO Lei, ZHAO ChunFang, WANG JiZhong, ZHANG YaDong, HE Lei. Identification and Gene Mapping of Rice Grain Shape Mutant sgd13 [J]. Scientia Agricultura Sinica, 2025, 58(24): 5097-5109.
[2] ZENG YueHui, ZOU WenGuang, ZHAO FuMing, XIAO ChangChun, HUANG JianHong, MA BinLin, YANG WangXing, WEI XinYu, XU XuMing. Map-Based Cloning and Functional Verification of A Novel Split Glume Gene OsSG2 in Rice (Oryza sativa L.) [J]. Scientia Agricultura Sinica, 2025, 58(11): 2062-2080.
[3] ZHANG BiDong, LIN Hong, ZHU SiYing, LI ZhongCheng, ZHUANG Hui, LI YunFeng. Identification and Candidate Gene Analysis of the ABNORMAL HULL 1 (ah1) Mutant in Rice (Oryza sativa L.) [J]. Scientia Agricultura Sinica, 2024, 57(3): 429-441.
[4] YAN LiuHui, ZHONG Qi, MA ZengFeng, WEI MinYi, LIU Chi, QIN YuanYuan, ZHOU XiaoLong, HUANG DaHui, LU YingPing, QIN Gang, ZHANG YueXiong. Identification and Evolutionary Analysis of the Early Heading Gene OsEHD8 in Common Wild Rice (Oryza rufipogon Giff.) [J]. Scientia Agricultura Sinica, 2024, 57(14): 2703-2716.
[5] ZHU HongHui, LI YingZi, GAO YuanZhuo, LIN Hong, WANG ChengYang, YAN ZiYi, PENG HanPing, LI TianYe, XIONG Mao, LI YunFeng. Map-Based Cloning of the SHORT AND WIDEN GRAIN 1 Gene in Rice (Oryza sativa L.) [J]. Scientia Agricultura Sinica, 2023, 56(7): 1260-1274.
[6] ZHAO ChunFang,ZHAO QingYong,LÜ YuanDa,CHEN Tao,YAO Shu,ZHAO Ling,ZHOU LiHui,LIANG WenHua,ZHU Zhen,WANG CaiLin,ZHANG YaDong. Screening of Core Markers and Construction of DNA Fingerprints of Semi-Waxy Japonica Rice Varieties [J]. Scientia Agricultura Sinica, 2022, 55(23): 4567-4582.
[7] ZHANG YaDong,LIANG WenHua,HE Lei,ZHAO ChunFang,ZHU Zhen,CHEN Tao,ZHAO QingYong,ZHAO Ling,YAO Shu,ZHOU LiHui,LU Kai,WANG CaiLin. Construction of High-Density Genetic Map and QTL Analysis of Grain Shape in Rice RIL Population [J]. Scientia Agricultura Sinica, 2021, 54(24): 5163-5176.
[8] XU ZiYi,CHENG Xing,SHEN Qi,ZHAO YaNan,TANG JiaYu,LIU Xi. Identification and Gene Functional Analysis of Yellow Green Leaf Mutant ygl3 in Rice [J]. Scientia Agricultura Sinica, 2021, 54(15): 3149-3157.
[9] KunNeng ZHOU,JiaFa XIA,Peng YUN,YuanLei WANG,TingChen MA,CaiJuan ZHANG,ZeFu LI. Transcriptome Research of Erect and Short Panicle Mutant esp in Rice [J]. Scientia Agricultura Sinica, 2020, 53(6): 1081-1094.
[10] WANG FangQuan,CHEN ZhiHui,XU Yang,WANG Jun,LI WenQi,FAN FangJun,CHEN LiQin,TAO YaJun,ZHONG WeiGong,YANG Jie. Development and Application of the Functional Marker for the Broad-Spectrum Blast Resistance Gene PigmR in Rice [J]. Scientia Agricultura Sinica, 2019, 52(6): 955-967.
[11] Mu ZHANG, ShuanHu TANG, QiaoYi HUANG, YuWan PANG, Qiong YI, Xu HUANG, Ping LI, HongTing FU. The Nutrient Supply Characteristics of Co-Application of Slow-Release Urea and Common Urea in Double-Cropping Rice [J]. Scientia Agricultura Sinica, 2018, 51(20): 3985-3995.
Viewed
Full text


Abstract

Cited

  Shared   
  Discussed   
No Suggested Reading articles found!