Scientia Agricultura Sinica ›› 2026, Vol. 59 ›› Issue (12): 2740-2749.doi: 10.3864/j.issn.0578-1752.2026.12.015

• ANIMAL SCIENCE·VETERINARY SCIENCE • Previous Articles     Next Articles

Study of Translation Regulation Mediated by Conserved Motifs Within Senecavirus A Genome

LI Yan1,2(), DUAN XiaoXiao2, WANG Jie1, DASHZEVGE Erdenechimeg3, LI ZhiJuan1, WANG QianQian1(), LIU FuXiao1()   

  1. 1 College of Veterinary Medicine, Qingdao Agricultural University, Qingdao 266109, Shandong, China
    2 Qingdao Center for Animal Disease Control & Prevention, Qingdao 266199, Shandong, China
    3 Institute of Veterinary Medicine, Ulaanbaatar 17029, Mongolia
  • Received:2025-09-16 Accepted:2026-04-27 Online:2026-06-16 Published:2026-06-16
  • Contact: WANG QianQian, LIU FuXiao

RichHTML

1

PDF

3

Abstract:

【Objective】Ribosome sequencing (Ribo-seq) technology was employed to analyze key sequences regulating translation elongation in the Senecavirus A (SVA) genome and to evaluate their impact on viral replication, thereby providing a theoretical foundation for elucidating the molecular mechanisms of SVA. Which could lay a foundation for clarifying the role of RNA elements in SVA coding region in translation regulation.【Method】Ribo-seq was performed using rSVA-eGFP as a model to generate a genome-wide translation profile of SVA and to identify ribosome pausing peaks. Synonymous mutations were then designed for the sequences corresponding to these pausing sites, and full-length cDNA recombinant plasmids were constructed. Replication-competent recombinant viruses were subsequently rescued through reverse genetics. The rescued viruses were subjected to serial blind passages, RT-PCR, sequencing, and growth-curve analyses to evaluate the effects of the mutations on viral replication. Representative recombinant viruses were selected for secondary Ribo-seq analysis to elucidate the effects of the modification site on viral replication and protein translation.【Result】Ribo-seq data revealed significant ribosomal translation-stall peaks in VP1, 2C, and 3D genes of SVA, suggesting the presence of key motifs that impede ribosome translocation. To test this hypothesis, synonymous mutations were introduced into these three regions to construct recombinant viruses. The results indicated that only the mutant in the 3D region successfully rescued replication-competent virus, and the introduced mutation remained stable after 20 consecutive passages, with no significant impact on viral growth kinetics. These findings indicated that the motifs in the 3D region were nonessential for viral replication. In contrast, mutations in the VP1 and 2C regions failed to produce viable viruses, demonstrating that the motifs in these regions were essential for viral replication. Further Ribo-seq analysis of the rescued virus revealed that the pausing peaks in both the 2C and 3D regions disappeared after mutation. This suggested that the key motifs in the 2C region, if any, were not the sole determinant of the translation rate of viral proteins, whereas the motif in the 3D region, although not required for viral replication, could modulate the translation efficiency of viral proteins.【Conclusion】Through genome-wide Ribo-seq profiling of SVA, this study identified critical sequence motifs that regulate translational elongation. The motifs in the VP1 and 2C regions were essential for viral replication, while the motif in the 3D region, though non-essential for viral replication, could affect protein translation rates.

Key words: ribosome sequencing, Senecavirus A, reverse genetics, ribosome stalling, translational regulation

Table 1

Synonymous mutation in the Peak1-3 sequence"

峰1 Peak 1（VP1） 峰2 Peak 2（2C） 峰3 Peak 3（3D）
原始序列
Original sequence		 GTCAAGTTCCTGTTTGACCGATCTCGATTACTGAATGTAATTAAGGTA CGGATCAACTACGACTTGACTCTAGAAGTATCTGAGGCCTACAAAAAG TTTGACTCTTCACACGGCACTGGCTCCTTCGAAGCTCTCATCTCT
同义突变序列
Synonymously mutated sequence		 GTGAAATTTTTATTCGATAGGAGCAGGCTTTTAAACGTTATAAAAGTT AGAATTAATTATGATCTCACATTGGAGGTTAGCGAAGCGTATAAGAAA TTCGATAGCAGTCATGGGACAGGGAGTTTTGAGGCATTGATAAGC

Table 2

Primers used for constructing SVA cDNA clones with synonymous mutations"

cDNA克隆
cDNA clone		 正向引物1
FP1 (5′ to 3′)		 反向引物1
RP1 (5′ to 3′)		 正向引物2
FP2 (5′ to 3′)		 反向引物2
RP2 (5′ to 3′)
cD-I aactctagttggacctttgtcat cgtccttctccagaacttttataacgtttaaaagcc cgttataaaagttctggagaaggacgccgtcttccc aattaggaaggtccggccggcca
cD-II aactctagttggacctttgtcat cataattaattctacgagagaccgcagaaggatcag tgcggtctctcgtagaattaattatgatctcacatt aattaggaaggtccggccggcca
cD-III ctagaccctatggatccccaca cggtgaaaaagtggcttatcaatgcctcaaaactcc ggcattgataagccactttttcaccgttgacaatgg gctgatcagcgggtttaaacgg

Fig. 1

Ribosome profiling of rSVA-eGFP genome A: Proportional distribution of genetic elements in SVA-eGFP genome; arrows indicate the junctions between the two genetic elements; B: SVA-eGFP-A to C are representative of three independent experiments, Peaks 1 to 3 correspond to three distinct ribosome pausing sites; C: Sequences of Peak 1 to 3 in SVA genome mapped at single-nucleotide resolution. The sequences corresponding to peaks 1 to 3 are located between bases 2786-2829 (VP1), 5370-5414 (2C) and 7319-7359 (3D) of the SVA genome, respectively"

Fig. 2

Identification, and characterization analysis of replication-competent rSVAs A: Rescue and passaging of rSVA-I to III; B: RT-PCR detection of rSVAs at P5. Two pairs of primers are separately used for amplifying fragments containing regions corresponding to peak 1, peak 2, and peak 3. PCR is simultaneously performed to eliminate the possibility of plasmid contamination, and rSVA-0 is used as a positive control; C: Sanger sequencing chromatogram of RT-PCR product from rSVA-III at P5. Mutation sites are indicated by red letters, and wild-type sites are indicated by black letters; D: Multi-step growth curves of rSVA-III and rSVA-0 at P5; E: Profiling of eGFP expression in rSVA-III-infected cells during twenty blind passages; F: RT-PCR detection of rSVA-III at P10 and P20; G: Sanger sequencing chromatograms of RT-PCR products from rSVA-III at P10 and P20"

Fig. 3

Ribosome profiling of the P5 rSVA-III genome A: SVA-III-A to C are representative of three independent experiments; B: Ribosome accumulation peaks at single-nucleotide resolution"

[1]
WANG H, NIU C X, NONG Z R, QUAN D Q, CHEN Y, OUYANG K, HUANG W J, WEI Z Z. Emergence and phylogenetic analysis of a novel Seneca Valley virus strain in the Guangxi Province of China. Research in Veterinary Science, 2020, 130: 207-211.

doi: S0034-5288(19)31101-4 pmid: 32200161
[2]
朱琳. 猪塞内卡病毒病综述及防控. 畜牧兽医科学(电子版), 2022(21): 148-150.
ZHU L. Review and prevention of Seneca virus disease in pigs. Graziery Veterinary Sciences (Electronic Version), 2022(21): 148-150. (in Chinese)
[3]
TOUSIGNANT S J P, BRUNER L, SCHWARTZ J, VANNUCCI F, ROSSOW S, MARTHALER D G. Longitudinal study of Senecavirus a shedding in sows and piglets on a single United States farm during an outbreak of vesicular disease. BMC Veterinary Research, 2017, 13(1): 277.

doi: 10.1186/s12917-017-1172-7 pmid: 28859639
[4]
FERNANDES M H V, DE LIMA M, JOSHI L R, DIEL D G. A virulent and pathogenic infectious clone of Senecavirus A. The Journal of General Virology, 2021, 102(8): 001643.
[5]
LI Y, LIU T Y, ZHANG Y M, DUAN X X, LIU F X. RNA recombination: non-negligible factor for preventing emergence or reemergence of Senecavirus A. Frontiers in Veterinary Science, 2024, 11: 1357179.

doi: 10.3389/fvets.2024.1357179
[6]
ZHAO D, LI Y, LI Z W, ZHU L J, SANG Y X, ZHANG H, ZHANG F, NI B, LIU F X. Only fourteen 3'-end poly(a)s sufficient for rescuing Senecavirus A from its cDNA clone, but inadequate to meet requirement of viral replication. Virus Research, 2023, 328: 199076.

doi: 10.1016/j.virusres.2023.199076
[7]
LIU F X, WANG Q Q, HUANG Y L, WANG N, SHAN H. A 5-year review of senecavirus a in China since its emergence in 2015. Frontiers in Veterinary Science, 2020, 7: 567792.

doi: 10.3389/fvets.2020.567792
[8]
LI Y, ZHANG L, WANG L, LI J, ZHAO Y W, LIU F X, WANG Q Q. Structure and function of type IV IRES in picornaviruses: A systematic review. Frontiers in Microbiology, 2024, 15: 1415698.

doi: 10.3389/fmicb.2024.1415698
[9]
LIU F X, ZHAO D, WANG N, LI Z W, DONG Y Q, LIU S, ZHANG F, CUI J, MENG H L, NI B, WEI R, SHAN H. Tolerance of senecavirus a to mutations in its kissing-loop or pseudoknot structure computationally predicted in 3′ untranslated region. Frontiers in Microbiology, 2022, 13: 889480.

doi: 10.3389/fmicb.2022.889480
[10]
ZHAO D, WANG Q Q, WANG M Y, LYU L P, LIU S Q, JIANG Y J, ZHOU S N, LIU F X. A putative wild-type or wild-type-like hairpin structure is required within 3′ untranslated region of Senecavirus A for virus replication. Virology, 2023, 585: 72-77.

doi: 10.1016/j.virol.2023.05.008
[11]
MENG H L, WANG X L, WANG L, WANG Q Q, ZHU L J, SANG Y X, LIU F X. Identification of cis-acting replication element in VP2- encoding region of Senecavirus A genome. Veterinary Microbiology, 2023, 280: 109717.

doi: 10.1016/j.vetmic.2023.109717
[12]
WANG X L, MENG H L, DUAN X X, SANG Y X, ZHANG Y M, LI Y, LIU F X. The 3' end of the coding region of senecavirus A contains a highly conserved sequence that potentially forms a stem-loop structure required for virus rescue. Archives of Virology, 2023, 168(10): 256.

doi: 10.1007/s00705-023-05863-x pmid: 37737963
[13]
KUMARI R, MICHEL A M, BARANOV P V. PausePred and Rfeet: Webtools for inferring ribosome pauses and visualizing footprint density from ribosome profiling data. Rna, 2018, 24(10): 1297-1304.

doi: 10.1261/rna.065235.117 pmid: 30049792
[14]
YANG Z L, CAO S, MARTENS C A, PORCELLA S F, XIE Z, MA M, SHEN B, MOSS B. Deciphering poxvirus gene expression by RNA sequencing and ribosome profiling. Journal of Virology, 2015, 89(13): 6874-6886.

doi: 10.1128/JVI.00528-15 pmid: 25903347
[15]
ZHAO J, HUANG Y H, LIUKANG C Y, YANG R H, TANG L H, SUN L, ZHAO Y, ZHANG G Z. Dissecting infectious bronchitis virus-induced host shutoff at the translation level. Journal of Virology, 2024, 98(7): e00830-e00824.
[16]
STERN-GINOSSAR N, INGOLIA N T. Ribosome profiling as a tool to decipher viral complexity. Annual Review of Virology, 2015, 2: 335-349.

doi: 10.1146/virology.2015.2.issue-1
[17]
LIU F X, HUANG Y L, WANG Q Q, SHAN H. Construction of eGFP-tagged senecavirus a for facilitating virus neutralization test and antiviral assay. Viruses, 2020, 12(3): 283.

doi: 10.3390/v12030283
[18]
DUNCAN C D S, JUAN M T. Effects of cycloheximide on the interpretation of ribosome profiling experiments in Schizosaccharomyces pombe. Scientific Reports, 2017, 7: 10331.

doi: 10.1038/s41598-017-10650-1
[19]
DIAMENT A, TULLER T. Estimation of ribosome profiling performance and reproducibility at various levels of resolution. Biology Direct, 2016, 11(1): 24.

doi: 10.1186/s13062-016-0127-4
[20]
BRAR G A, WEISSMAN J S. Ribosome profiling reveals the what, when, where and how of protein synthesis. Nature Reviews Molecular Cell Biology, 2015, 16(11): 651-664.

doi: 10.1038/nrm4069 pmid: 26465719
[21]
LIMBU M S, XIONG T Z, WANG S F. A review of Ribosome profiling and tools used in Ribo-seq data analysis. Computational and Structural Biotechnology Journal, 2024, 23: 1912-1918.

doi: 10.1016/j.csbj.2024.04.051 pmid: 38721586
[22]
IRIGOYEN N, FIRTH A E, JONES J D, CHUNG B Y, SIDDELL S G, BRIERLEY I. High-resolution analysis of coronavirus gene expression by RNA sequencing and ribosome profiling. PLoS Pathogens, 2016, 12(2): e1005473.
[23]
PENZA V, RUSSELL S J, SCHULZE A J. The long-lasting Enigma of polycytidine (polyC) tract. PLoS Pathogens, 2021, 17(8): e1009739.
[24]
LIU F X, WANG N, HUANG Y L, WANG Q Q, SHAN H. Stem II-disrupting pseudoknot does not abolish ability of Senecavirus A IRES to initiate protein expression, but inhibits recovery of virus from cDNA clone. Veterinary Microbiology, 2021, 255: 109024.

doi: 10.1016/j.vetmic.2021.109024
[25]
LIU F X, WANG N, WANG Q, SHAN H. Motif mutations in pseudoknot stem I upstream of start codon in Senecavirus A genome: Impacts on activity of viral IRES and on rescue of recombinant virus. Veterinary Microbiology, 2021, 262: 109223.

doi: 10.1016/j.vetmic.2021.109223
[26]
GRZYBOWSKA E A, WAKULA M. Protein binding to cis-motifs in mRNAs coding sequence is common and regulates transcript stability and the rate of translation. Cells, 2021, 10(11): 2910.

doi: 10.3390/cells10112910
[27]
STEIN K C, FRYDMAN J. The stop-and-go traffic regulating protein biogenesis: How translation kinetics controls proteostasis. Journal of Biological Chemistry, 2019, 294(6): 2076-2084.

doi: 10.1074/jbc.REV118.002814 pmid: 30504455
[28]
GINGOLD H, PILPEL Y. Determinants of translation efficiency and accuracy. Molecular Systems Biology, 2011, 7(1): MSB201114.
[29]
CHARNESKI C A, HURST L D. Positively charged residues are the major determinants of ribosomal velocity. PLoS Biology, 2013, 11(3): e1001508.
[30]
SOMOGYI P, JENNER A J, BRIERLEY I, INGLIS S C. Ribosomal pausing during translation of an RNA pseudoknot. Molecular and Cellular Biology, 1993, 13(11): 6931-6940.

doi: 10.1128/mcb.13.11.6931-6940.1993 pmid: 8413285
[31]
RODNINA M V. The ribosome in action: Tuning of translational efficiency and protein folding. Protein Science, 2016, 25(8): 1390-1406.

doi: 10.1002/pro.2950 pmid: 27198711
[32]
TULLER T, WALDMAN Y Y, KUPIEC M, RUPPIN E, SHERMAN F. Translation efficiency is determined by both codon bias and folding energy. Proceedings of the National Academy of Sciences of the United States of America, 2010, 107(8): 3645-3650.
[33]
KOZAK M. Influences of mRNA secondary structure on initiation by eukaryotic ribosomes. Proceedings of the National Academy of Sciences of the United States of America, 1986, 83(9): 2850-2854.
[34]
CASAS-VILA N, SAYOLS S, PÉREZ-MARTÍNEZ L, SCHEIBE M, BUTTER F. The RNA fold interactome of evolutionary conserved RNA structures in S. cerevisiae. Nature Communications, 2020, 11: 2789.

doi: 10.1038/s41467-020-16555-4
[35]
DOMINGUEZ D, FREESE P, ALEXIS M S, SU A, HOCHMAN M, PALDEN T, BAZILE C, LAMBERT N J, VAN NOSTRAND E L, PRATT G A, YEO G W, GRAVELEY B R, BURGE C B. Sequence, structure, and context preferences of human RNA binding proteins. Molecular Cell, 2018, 70(5): 854-867.e9.

doi: S1097-2765(18)30351-4 pmid: 29883606
[1] LIU ChenXi, ZHAO BingBing, SHI ZhiBin, WANG ShiDa, WANG JingFei. Construction of Infectious Clones for Canine Parvovirus CPV-2c SX-LC Strain and Virus Rescue [J]. Scientia Agricultura Sinica, 2025, 58(17): 3561-3570.
[2] ZHANG XiaoZhan, DONG XuanZhi, LÜ NanNan, LIU YiWen, MA XinTian, WANG LinQing, XIA YanXun, JIANG ZengHai, GUO YunZe, ZHAO PanDeng, SONG YuZhen, YANG DeCheng, BIAN Chuanzhou. Effect of 12 Nucleotides Natural Insertion within the Internal Ribosome Entry Site Core Region on the Replication and Cellular Tropism of Porcine Senecavirus A [J]. Scientia Agricultura Sinica, 2024, 57(7): 1407-1416.
[3] DU BingChen, WANG Ming, LIU ChunGuo, WANG ShiDa, WEI XinYu, LU YaMan, SUN ZhenZhao, LIU ZaiSi, WEI LiLi, WANG JingFei, YANG DeCheng. Construction of Infectious cDNA Clone of GETV SC483 Strain [J]. Scientia Agricultura Sinica, 2023, 56(17): 3479-3486.
[4] WANG Ting-Zhang, HU Wang-Xiong, XU Jian-Hong, XUE Qing-Zhong. Mining Method of the Upstream Open Reading Frames and Their Translational Regulation in the Plant Genomes [J]. Scientia Agricultura Sinica, 2013, 46(16): 3314-3323.
[5] .

Establishment of Reverse Genetics of H1N1 Subtype Swine Influenza Virus and Generation of Cell Culture High-Yield Recombinant Vaccine Candidate

[J]. Scientia Agricultura Sinica, 2009, 42(5): 1797-1804 .
[6] ,,,. Establishment of Reverse Genetics System of Highly Pathogenic H5N1 Avian Influenza Virus A/goose/Guangdong/1/96 [J]. Scientia Agricultura Sinica, 2005, 38(08): 1686-1690 .
Viewed
Full text


Abstract

Cited
  Shared   
  Discussed   
No Suggested Reading articles found!
京ICP备09089781号-30
Copyright 2018 © Editorial office of Scientia Agricultura Sinica
Tel: 86-010-82106279    E-mail: zgnykx@mail.caas.net.cn
Supported by Beijing Magtech Co.Ltd