Journals
  Publication Years
  Keywords
Search within results Open Search
Please wait a minute...
For Selected: Toggle Thumbnails
Molecular characterization of the SAUR gene family in sweet cherry and functional analysis of PavSAUR55 in the process of abscission
HOU Qian-dong, HONG Yi, WEN Zhuang, SHANG Chun-qiong, LI Zheng-chun, CAI Xiao-wei, QIAO Guang, WEN Xiao-peng
2023, 22 (6): 1720-1739.   DOI: 10.1016/j.jia.2023.04.031
Abstract244)      PDF in ScienceDirect      

Small auxin up RNA (SAUR) is a large gene family that is widely distributed among land plants.  In this study, a comprehensive analysis of the SAUR family was performed in sweet cherry, and the potential biological functions of PavSAUR55 were identified using the method of genetic transformation.  The sweet cherry genome encodes 86 SAUR members, the majority of which are intron-less.  These genes appear to be divided into seven subfamilies through evolution.  Gene duplication events indicate that fragment duplication and tandem duplication events occurred in the sweet cherry.  Most of the members mainly underwent purification selection pressure during evolution.  During fruit development, the expression levels of PavSAUR16/45/56/63 were up-regulated, and conversely, those of PavSAUR12/61 were down-regulated.  Due to the significantly differential expressions of PavSAUR13/16/55/61 during the fruitlet abscission process, they might be the candidate genes involved in the regulation of physiological fruit abscission in sweet cherry.  Overexpression of PavSAUR55 in Arabidopsis produced earlier reproductive growth, root elongation, and delayed petal abscission.  In addition, this gene did not cause any change in the germination time of seeds and was able to increase the number of lateral roots under abscisic acid (ABA) treatment.  The identified SAURs of sweet cherry play a crucial role in fruitlet abscission and will facilitate future insights into the mechanism underlying the heavy fruitlet abscission that can occur in this fruit crop.

Reference | Related Articles | Metrics
Genome-wide association and linkage mapping strategies reveal the genetic loci and candidate genes of important agronomic traits in Sichuan wheat
ZHANG Zhi-peng, LI Zhen, HE Fang, LÜ Ji-juan, XIE Bin, YI Xiao-yu, LI Jia-min, LI Jing, SONG Jing-han, PU Zhi-en, MA Jian, PENG Yuan-ying, CHEN Guo-yue, WEI Yu-ming, ZHENG You-liang, LI Wei
2023, 22 (11): 3380-3393.   DOI: 10.1016/j.jia.2023.02.030
Abstract238)      PDF in ScienceDirect      

Increasing wheat yield is a long-term goal for wheat breeders around the world.  Exploiting elite genetic resources and dissecting the genetic basis of important agronomic traits in wheat are the necessary methods for high-yield wheat breeding.  This study evaluated nine crucial agronomic traits found in a natural population of 156 wheat varieties and 77 landraces from Sichuan, China in seven environments over two years.  The results of this investigation of agronomic traits showed that the landraces had more tillers and higher kernel numbers per spike (KNS), while the breeding varieties had higher thousand-kernel weight (TKW) and kernel weight per spike (KWS).  The generalized heritability (H2) values of the nine agronomic traits varied from 0.74 to 0.95.  Structure analysis suggested that the natural population could be divided into three groups using 43 198 single nucleotide polymorphism (SNP) markers from the wheat 55K SNP chip.  A total of 67 quantitative trait loci (QTLs) were identified by the genome-wide association study (GWAS) analysis based on the Q+K method of a mixed linear model.  Three important QTLs were analyzed in this study.  Four haplotypes of QFTN.sicau-7BL.1 for fertile tillers number (FTN), three haplotypes of QKNS.sicau-1AL.2 for KNS, and four haplotypes of QTKW.sicau-3BS.1 for TKW were detected.  FTN-Hap2, KNS-Hap1, and TKW-Hap2 were excellent haplotypes for each QTL based on the yield performance of 42 varieties in regional trials from 2002 to 2013.  The varieties with all three haplotypes showed the highest yield compared to those with either two haplotypes or one haplotype.  In addition, the KASP-AX-108866053 marker of QTL QKNS.sicau-1AL.2 was successfully distinguished between three haplotypes (or alleles) in 63 varieties based on the number of kernels per spike in regional trials between 2018 and 2021.  These genetic loci and reliable makers can be applied in marker-assisted selection or map-based gene cloning for the genetic improvement of wheat yield. 

Reference | Related Articles | Metrics
Farmers’ precision pesticide technology adoption and its influencing factors: Evidence from apple production areas in China
YUE Meng, LI Wen-jing, JIN Shan, CHEN Jing, CHANG Qian, Glyn JONES, CAO Yi-ying, YANG Gui-jun, LI Zhen-hong, Lynn J. FREWER
2023, 22 (1): 292-305.   DOI: 10.1016/j.jia.2022.11.002
Abstract198)      PDF in ScienceDirect      

The research aimed to understand farmers’ willingness to adopt (WTA) and willingness to pay (WTP) for precision pesticide technologies and analyzed the determinants of farmers’ decision-making.  We used a two-stage approach to consider farmers’ WTA and WTP for precision pesticide technologies.  A survey of 545 apple farmers was administered in Bohai Bay and the Loess Plateau in China.  The data were analyzed using the double-hurdle model.  The results indicated that 78.72% of respondents were willing to apply precision pesticide technologies provided by service organizations such as cooperatives and dedicated enterprises, and 69.72% were willing to buy the equipment for using precision pesticide technologies.  The results of the determinant analysis indicated that farmers’ perceived perceptions, farm scale, cooperative membership, access to digital information, and availability of financial services had significant and positive impacts on farmers’ WTA precision pesticide technologies.  Cooperative membership, technical training, and adherence to environmental regulations increased farmers’ WTP for precision pesticide technologies.  Moreover, nonlinear relationships between age, agricultural experience, and farmers’ WTA and WTP for precision pesticide technology services were found.

Reference | Related Articles | Metrics
Genetic diversity analysis and GWAS reveal the adaptive loci of milling and appearance quality of japonica (oryza sativa L.) in Northeast China
XU Xin, YE Jun-hua, YANG Ying-ying, LI Ruo-si, LI Zhen, WANG Shan, SUN Yan-fei, ZHANG Meng-chen, XU Qun, FENG Yue, WEI Xing-hua, YANG Yao-long
2022, 21 (6): 1539-1550.   DOI: 10.1016/S2095-3119(21)63701-2
Abstract387)      PDF in ScienceDirect      
Milling and appearance quality are important contributors to rice grain quality.  Abundant genetic diversity and a suitable environment are crucial for rice improvement.  In this study, we investigated the milling and appearance quality-related traits in a panel of 200 japonica rice cultivars selected from Liaoning, Jilin and Heilongjiang provinces in Northeast China.  Pedigree assessment and genetic diversity analysis indicated that cultivars from Jilin harbored the highest genetic diversity among the three geographic regions.  An evaluation of grain quality indicated that cultivars from Liaoning showed superior milling quality, whereas cultivars from Heilongjiang tended to exhibit superior appearance quality.  Single- and multi-locus genome-wide association studies (GWAS) were conducted to identify loci associated with milling and appearance quality-related traits.  Ninety-nine significant single-nucleotide polymorphisms (SNPs) were detected.  Three common SNPs were detected using the mixed linear model (MLM), mrMLM, and FASTmrMLM methods.  Linkage disequilibrium decay was estimated and indicated three candidate regions (qBRR-1, qBRR-9 and qDEC-3) for further candidate gene analysis.  More than 300 genes were located in these candidate regions.  Gene Ontology (GO) analysis was performed to discover the potential candidate genes.  Genetic diversity analysis of the candidate regions revealed that qBRR-9 may have been subject to strong selection during breeding.  These results provide information that will be valuable for the improvement of grain quality in rice breeding.
Reference | Related Articles | Metrics
Small RNA deep sequencing reveals the presence of multiple viral infections in cucurbit crops in Guangdong, China
LI Zheng-gang, NONG Yuan, Tahir FAROOQ, TANG Ya-fei, SHE Xiao-man, YU Lin, LAN Guo-bing, ZHOU Xue-ping, HE Zi-fu
2022, 21 (5): 1389-1400.   DOI: 10.1016/S2095-3119(21)63661-4
Abstract190)      PDF in ScienceDirect      
Viral diseases are among the most critical damaging factors that impose a global threat to the cucurbit industry.  China is the world’s leading country for the production and consumption of cucurbits.  Guangdong, a province in southern China dominated by the tropical and subtropical climate, favors the survival of different plant viruses and their vectors.  Five main cucurbit crops showing various disease symptoms were surveyed and collected to identify viruses infecting cucurbits in Guangdong during 2018–2020.  In the field, the incidence ranged from 5–30%, or even 60–100% in the case of severely infected cucurbits.  A total of 357 symptomatic samples were collected and subsequently screened for cucurbit viruses by small RNA deep sequencing and assembly (sRSA).  Seventeen virus species belonging to 10 genera were identified in the five main cucurbit crops.  The most common viruses were papaya ringspot virus (PRSV; Potyvirus), zucchini tigre mosaic virus (ZTMV; Potyvirus), zucchini yellow mosaic virus (ZYMV; Potyvirus), and watermelon silver mottle virus (WSMoV; Orthotospovirus), with infection rates of 24.4, 19.0, 17.1, and 14.3%, respectively.  Notably, the most prevalent viruses were melon yellow spot orthotospovirus (MYSV) in cucumber, PRSV in squash, cucumber green mottle mosaic virus (CGMMV; Tobamovirus) in bottle gourd, WSMoV in white gourd, and ZYMV in luffa.  Mixed infections were prevalent, and the types of mixed infections varied substantially in different cucurbit crops.  Moreover, the full-length nucleotide sequences of watermelon green mottle mosaic virus (WGMMV), CGMMV, and watermelon virus A (WVA; Wamavirus) identified in bottle gourd were cloned and analyzed.  This study is the first reporting WGMMV infecting bottle gourd in China mainland.  In summary, the results demonstrate that in Guangdong, the most prevalent viruses belong to potyviruses, orthotospoviruses, and tobamoviruses groups.  The findings will facilitate agricultural researchers and farmers to plan and implement effective disease control strategies aiming at timely detection and management of cucurbit-infecting viral pathogens.

Reference | Related Articles | Metrics
Genome-wide identification, expression and functional analysis of sugar transporters in sorghum (Sorghum bicolor L.) 
XIAO Qian-lin, LI Zhen, WANG Ya-yun, HOU Xian-bin, WEI Xi-mei, ZHAO Xiao, HUANG Lei, GUO Yan-jun, LIU Zhi-zhai
2022, 21 (10): 2848-2864.   DOI: 10.1016/j.jia.2022.07.034
Abstract331)      PDF in ScienceDirect      

Sugar transporters are essential for osmotic process regulation, various signaling pathways and plant growth and development.  Currently, few studies are available on the function of sugar transporters in sorghum (Sorghum bicolor L.).  In this study, we performed a genome-wide survey of sugar transporters in sorghum.  In total, 98 sorghum sugar transporters (SSTs) were identified via BLASTP.  These SSTs were classified into three families based on the phylogenetic and conserved domain analysis, including six sucrose transporters (SUTs), 23 sugars will eventually be exported transporters (SWEETs), and 69 monosaccharide transporters (MSTs).  The sorghum MSTs were further divided into seven subfamilies, including 24 STPs, 23 PLTs, two VGTs, four INTs, three pGlcT/SBG1s, five TMTs, and eight ERDs.  Chromosomal localization of the SST genes showed that they were randomly distributed on 10 chromosomes, and substantial clustering was evident on the specific chromosomes.  Twenty-seven SST genes from the families of SWEET, ERD, STP, and PLT were found to cluster in eight tandem repeat event regions.  In total, 22 SSTs comprising 11 paralogous pairs and accounting for 22.4% of all the genes were located on the duplicated blocks.  The different subfamilies of SST proteins possessed the same conserved domain, but there were some differences in features of the motif and transmembrane helices (TMH).  The publicly-accessible RNA-sequencing data and real-time PCR revealed that the SST genes exhibited distinctive tissue specific patterns.  Functional studies showed that seven SSTs were mainly located on the cell membrane and membrane organelles, and 14 of the SSTs could transport different types of monosaccharides in yeast.  These findings will help us to further elucidate their roles in the sorghum sugar transport and sugar signaling pathways.

Reference | Related Articles | Metrics
An entirely new approach based on remote sensing data to calculate the nitrogen nutrition index of winter wheat
ZHAO Yu, WANG Jian-wen, CHEN Li-ping, FU Yuan-yuan, ZHU Hong-chun, FENG Hai-kuan, XU Xin-gang, LI Zhen-hai
2021, 20 (9): 2535-2551.   DOI: 10.1016/S2095-3119(20)63379-2
Abstract215)      PDF in ScienceDirect      
The nitrogen nutrition index (NNI) is a reliable indicator for diagnosing crop nitrogen (N) status.  However, there is currently no specific vegetation index for the NNI inversion across multiple growth periods.  To overcome the limitations of the traditional direct NNI inversion method (NNIT1) of the vegetation index and traditional indirect NNI inversion method (NNIT2) by inverting intermediate variables including the aboveground dry biomass (AGB) and plant N concentration (PNC), this study proposed a new NNI remote sensing index (NNIRS).  A remote-sensing-based critical N dilution curve (Nc_RS) was set up directly from two vegetation indices and then used to calculate NNIRS.  Field data including AGB, PNC, and canopy hyperspectral data were collected over four growing seasons (2012–2013 (Exp.1), 2013–2014 (Exp. 2), 2014–2015 (Exp. 3), 2015–2016 (Exp. 4)) in Beijing, China.  All experimental datasets were cross-validated to each of the NNI models (NNIT1, NNIT2 and NNIRS).  The results showed that: (1) the NNIRS models were represented by the standardized leaf area index determining index (sLAIDI) and the red-edge chlorophyll index (CIred edge) in the form of NNIRS=CIred edge/(a×sLAIDIb), where “a” equals 2.06, 2.10, 2.08 and 2.02 and “b” equals 0.66, 0.73, 0.67 and 0.62 when the modeling set data came from Exp.1/2/4, Exp.1/2/3, Exp.1/3/4, and Exp.2/3/4, respectively; (2) the NNIRS models achieved better performance than the other two NNI revised methods, and the ranges of R2 and RMSE were 0.50–0.82 and 0.12–0.14, respectively; (3) when the remaining data were used for verification, the NNIRS models also showed good stability, with RMSE values of 0.09, 0.18, 0.13 and 0.10, respectively.  Therefore, it is concluded that the NNIRS method is promising for the remote assessment of crop N status.
Reference | Related Articles | Metrics
Potato/Maize intercropping reduces infestation of potato tuber moth, Phthorimaea operculella (Zeller) by the enhancement of natural enemies
ZHENG Ya-qiang, ZHANG Li-min, CHEN Bin, YAN Nai-sheng, GUI Fu-rong, ZAN Qing-an, DU Guang-zu, HE Shu-qi, LI Zheng-yue, GAO Yu-lin, XIAO Guan-li
2020, 19 (2): 394-405.   DOI: 10.1016/S2095-3119(19)62699-7
Abstract150)      PDF in ScienceDirect      
The potato tuber moth (PTM), Phthorimaea operculella (Zeller), is one of the most economically significant insect pests for potato in both field and storage worldwide.  To evaluate the infestation, reduction of potato yield and the control efficacy for PTM, field tests were conducted in two seasons by intercropping of potato as the host plant with maize as a non-host plant of PTM.  Three intercropping patterns were tested, which were 2 rows of potatoes with either 2, 3, or 4 rows of maize (abbreviated 2P:2M, 2P:3M, and 2P:4M), and the monocropped potato as the control, 2 rows of potatoes, without maize,  (abbreviated 2P:0M).  Results showed that the population and infestation of PTM in the 2P:3M intercropping pattern was significantly lower than those in 2P:2M, 2P:4M and the monocropping pattern of 2P:0M, due to the enhancement of natural enemies.  Cumulative mines and tunneling in potato leaves in 2P:3M intercropping were significantly lower than those in 2P:2M and 2P:4M patterns.  The population of parasitoids and the parasitism rate of PTM in intercropping pattern of 2P:3M were significantly higher than that in intercropping pattern of 2P:2M, 2P:4M and monocropping pattern of 2P:0M.  We conclude that the potato intercropped with maize reduced the adult and larva populations, and reduced the damage from PTM by enhancing the number of parasitoids and the level of parasitism.  The greatest population density of parasitoids and parasitism rate were in the intercropping pattern of 2 rows of potatoes with 3 rows of maize.  These data indicate that the host/non-host intercropping patterns can be used as a biological control tactic against PTM by enhancing the density of natural enemies in the agro-ecosystems.
 
Reference | Related Articles | Metrics
Phosphorylation of sarcoplasmic and myofibrillar proteins in three ovine muscles during postmortem ageing
WANG Ying, LI Xin, LI Zheng, DU Man-ting, ZHU Jie, ZHANG She-qi, ZHANG De-quan
2019, 18 (7): 1643-1651.   DOI: 10.1016/S2095-3119(19)62653-5
Abstract308)      PDF in ScienceDirect      
This study aimed to examine changes in phosphorylation of sarcoplasmic and myofibrillar proteins from longissimus lumborum, semitendinosus, and psoas major muscles during postmortem ageing for 5 d.  These sarcoplasmic and myofibrillar proteins were separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis and stained with phosphorous and protein specific stains.  Myofibril fragmentation index, pH, the content of lactic acid and the relative activity of μ-calpain in three ovine muscles were measured.  These results showed that the relative phosphorylation level of sarcoplasmic and myofibrillar proteins of psoas major muscle were lower compared with longissimus lumborum and semitendinosus muscles (P<0.05).  The pH of psoas major muscle was the lowest at 0.5 h postmortem, and the highest after 12 h postmortem (P<0.05).  In addition, the relative activity of μ-calpain was higher within 5 d postmortem and myofibril fragmentation index was higher after 1 d postmortem in psoas major muscle than those of longissimus lumborum and semitendinosus muscles (P<0.05).  The sarcoplasmic protein phosphorylation may regulate the rate of pH decline to influence the μ-calpain activity and then proteolysis of proteins consequently.  This study gives a new perspective of the mechanism of postmortem meat tenderization.
 
Reference | Related Articles | Metrics
Estimating total leaf nitrogen concentration in winter wheat by canopy hyperspectral data and nitrogen vertical distribution
DUAN Dan-dan, ZHAO Chun-jiang, LI Zhen-hai, YANG Gui-jun, ZHAO Yu, QIAO Xiao-jun, ZHANG Yun-he, ZHANG Lai-xi, YANG Wu-de
2019, 18 (7): 1562-1570.   DOI: 10.1016/S2095-3119(19)62686-9
Abstract223)      PDF in ScienceDirect      
The use of remote sensing to monitor nitrogen (N) in crops is important for obtaining both economic benefit and ecological value because it helps to improve the efficiency of fertilization and reduces the ecological and environmental burden.  In this study, we model the total leaf N concentration (TLNC) in winter wheat constructed from hyperspectral data by considering the vertical N distribution (VND).  The field hyperspectral data of winter wheat acquired during the 2013–2014 growing season were used to construct and validate the model.  The results show that: (1) the vertical distribution law of LNC was distinct, presenting a quadratic polynomial tendency from the top layer to the bottom layer.  (2) The effective layer for remote sensing detection varied at different growth stages.  The entire canopy, the three upper layers, the three upper layers, and the top layer are the effective layers at the jointing stage, flag leaf stage, flowering stages, and filling stage, respectively.  (3) The TLNC model considering the VND has high predicting accuracy and stability.  For models based on the greenness index (GI), mND705 (modified normalized difference 705), and normalized difference vegetation index (NDVI), the values for the determining coefficient (R2), and normalized root mean square error (nRMSE) are 0.61 and 8.84%, 0.59 and 8.89%, and 0.53 and 9.37%, respectively.  Therefore, the LNC model with VND provides an accurate and non-destructive method to monitor N levels in the field.
Reference | Related Articles | Metrics
Global sensitivity analysis of wheat grain yield and quality and the related process variables from the DSSAT-CERES model based on the extended Fourier Amplitude Sensitivity Test method
LI Zhen-hai, JIN Xiu-liang, LIU Hai-long, XU Xin-gang, WANG Ji-hua
2019, 18 (7): 1547-1561.   DOI: 10.1016/S2095-3119(18)62046-5
Abstract207)      PDF in ScienceDirect      
A crop growth model, integrating genotype, environment, and management factor, was developed to serve as an analytical tool to study the influence of these factors on crop growth, production, and agricultural planning.  A major challenge of model application is the optimization and calibration of a considerable number of parameters.  Sensitivity analysis (SA) has become an effective method to identify the importance of various parameters.  In this study, the extended Fourier Amplitude Sensitivity Test (EFAST) approach was used to evaluate the sensitivity of the DSSAT-CERES model output responses of interest to 39 crop genotype parameters and six soil parameters.  The outputs for the SA included grain yield and quality (take grain protein content (GPC) as an indicator) at maturity stage, as well as leaf area index, aboveground biomass, and aboveground nitrogen accumulation at the critical process variables.  The key results showed that: (1) the influence of parameter bounds on the sensitivity results was slight and less than the impacts from the significance of the parameters themselves; (2) the sensitivity parameters of grain yield and GPC were different, and the sensitivity of the interactions between parameters to GPC was greater than those between the parameters to grain yield; and (3) the sensitivity analyses of some process variables, including leaf area index, aboveground biomass, and aboveground nitrogen accumulation, should be performed differently.  Finally, some parameters, which improve the model’s structure and the accuracy of the process simulation, should not be ignored when maturity output as an objective variable is studied.
Reference | Related Articles | Metrics
A rapid approach for isolating a single fungal spore from rice blast diseased leaves
FEI Li-wang, LU Wen-bo, XU Xiao-zhou, YAN Feng-cheng, ZHANG Li-wei, LIU Jin-tao, BAI Yuan-jun, LI Zhen-yu, ZHAO Wen-sheng, YANG Jun, PENG You-liang
2019, 18 (6): 1415-1418.   DOI: 10.1016/S2095-3119(19)62581-5
Abstract298)      PDF in ScienceDirect      
Single spore isolation is a fundamental approach in plant pathology and mycology to isolate and identify plant fungal pathogens from diseased samples.  However, routine single spore isolation procedure is time-consuming and has a high risk of contamination by other microorganisms.  In this study, we developed a rapid approach for isolating a single spore of the fungal pathogen, Pyricularia oryzae, from rice blast diseased leaves in the paddy field with low potential of contamination.  First, rice blast leaves with single lesions were selected in the paddy field, and a single lesion was cut out and pressed and dragged gently across the surface of water agar.  Next, a germinated single spore with a barely visible piece of agar was cut out of water agar with a dissecting needle under a stereomicroscope at approximately 120-fold magnification.  Last, the germinated single spore with water agar was transferred onto oatmeal tomato agar for growth and preservation.  Based on our experience, a skilled technician or student can successfully isolate single spore from over 150 independent diseased samples with nearly no contaminations in a single working day.  This approach is also suitable for isolating single spore from other fungal disease samples that produce abundant aerial conidia.
 
Reference | Related Articles | Metrics
Truncated gRNA reduces CRISPR/Cas9-mediated off-target rate for MSTN gene knockout in bovines
ZHOU Zheng-wei, CAO Guo-hua, LI Zhe, HAN Xue-jie, LI Chen, LU Zhen-yu, ZHAO Yu-hang, LI Xue-ling
2019, 18 (12): 2835-2843.   DOI: 10.1016/S2095-3119(19)62744-9
Abstract91)      PDF in ScienceDirect      
The CRISPR/Cas9 mediates efficient gene editing but has off-target effects inconducive to animal breeding.  In this study, the efficacy of CRISPR/Cas9 vectors containing different lengths of gRNA in reduction of the off-target phenomenon in the bovine MSTN gene knockout fibroblast cell lines was assessed, providing insight into improved methods for livestock breeding.  A 20-bp gRNA was designed for the second exon of the bovine MSTN gene, and CRISPR/Cas9-B was constructed to guide the Cas9 protein to the AGAACCAGGAGAAGATGGACTGG site.  The alternative CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 vectors were constructed using gRNAs truncated by 1, 2, 3 and 5 bp, respectively.  These vectors were then introduced into bovine fetal fibroblasts by the electroporation method, and single cells were obtained by flow cytometry sorting.  PCR was performed for each off-target site.  All samples were sequenced and analyzed, and finally the efficiency of each vector in target and off-target sites was compared.  The CRISPR/Cas9-B vector successfully knocked out the MSTN gene, but the off-target phenomenon was observed.  The efficiencies of CRISPR/Cas-B, CRISPR/Cas9-19, CRISPR/Cas9-18, CRISPR/Cas9-17 and CRISPR/Cas9-15 in triggering gene mutations at MSTN targeting sites were 62.16, 17.39, 7.69, 74.29 and 3.85%, respectively; rates of each at the Off-MSTN-1 locus were 52.86, 0, 0, 8.82 and 0%, respectively; all were 0% at the Off-MSTN-2 locus; rates at the Off-MSTN-3 site were 44.87, 51.72, 86.36, 0 and 50%, respectively.  The efficiency of the CRISPR/Cas9-17 plasmid in the MSTN site was higher than that in the CRISPR/Cas9-B plasmid, and the effect at the three off-target sites was significantly lower.  This study demonstrated that the CRISPR/Cas9-17 plasmid constructed by truncating 3 bp gRNA can effectively reduce the off-target effect without reducing the efficiency of bovine MSTN gene targeting.  This finding will provide more effective gene editing strategy for use of CRISPR/Cas9 technology.
Reference | Related Articles | Metrics
Assessment of suitable reference genes for qRT-PCR analysis in Adelphocoris suturalis
LUO Jing, MA Chao, LI Zhe, ZHU Bang-qin, ZHANG Jiang, LEI Chao-liang, JIN Shuang-xia, J. Joe Hull, CHEN Li-zhen
2018, 17 (12): 2745-2757.   DOI: 10.1016/S2095-3119(18)61926-4
Abstract258)      PDF (1312KB)(318)      
Quantitative reverse transcription polymerase chain reaction (qRT-PCR) is the most commonly-used tool for measurement of gene expression, but its accuracy and reliability depend on appropriate data normalization with the use of one or more stable reference genes.  Adelphocoris suturalis is one of the most destructive pests of cotton, but until recently knowledge of its underlying molecular physiology had been hindered by a lack of molecular resources.  To facilitate research on this pest, we evaluated 12 common housekeeping genes studied in insects (GAPDH, ACT, βACT, TBP, SDH, βTUB, EF1γ, EF1α, EF1δ, RPL32, RPS15, and RPL27) for their expression stability in A. suturalis when subjected to various experimental treatments, including three biotic (developmental stage and sex, tissue type, and metathoracic scent gland for varying developmental stages and sexes) and one abiotic (RNA interference injection) conditions.  Four dedicated algorithms (ΔCt method, geNorm, BestKeeper and NormFinder) were used to analyze gene expression stability.  In addition, RefFinder provided an overall ranking of the stability/suitability of these candidates.  This study is the first to provide a comprehensive list of suitable reference genes for gene expression analyses in A. suturalis, which can serve to facilitate transcript expression study of related biological processes in this and related species.
 
Related Articles | Metrics
Non-target-site and target-site resistance to AHAS inhibitors in American sloughgrass (Beckmannia syzigachne)
WANG Jing-jing, LI Xiang-ju, LI Dan, HAN Yu-jiao, LI Zheng, YU Hui-lin, CUI Hai-lan
2018, 17 (12): 2714-2723.   DOI: 10.1016/S2095-3119(18)62021-0
Abstract285)      PDF in ScienceDirect      
American sloughgrass (Beckmannia syzigachne (Steud.) Fernald) is one of the most competitive and malignant weeds in rice-wheat rotation fields in China.  American sloughgrass populations in the Jiangsu Province of China became less sensitive to acetohydroxyacid synthase (AHAS) inhibitors after repeated application for many years in these areas.  Two suspected resistant American sloughgrass populations (R1 and R2) collected in the field were detected the resistance to inhibitors of AHAS in whole-plant dose-response assays, compared to the susceptible (S) population.  These assays indicated that R1 showed low resistance to mesosulfuron-methyl (3.32-fold), imazapic (2.84-fold) and pyroxsulam (1.55-fold), moderate resistance to flazasulfuron (4.67-fold) and pyribenzoxim (7.41-fold), and high resistance to flucarbazone (11.73-fold).  However, using a combination of the cytochrome P450 inhibitor, malathion, with mesosulfuron-methyl resulted in a reduction in R1 resistance relative to mesosulfuron-methyl alone.  Furthermore, R2 was highly resistant to flazasulfuron (34.90-fold), imazapic (11.30-fold), flucarbazone (49.20-fold), pyribenzoxim (12.94-fold), moderately resistant to mesosulfuron-methyl (9.77-fold) and pyroxsulam (6.26-fold), and malathion had no effect on R2 resistance to mesosulfuron-methyl.  The full-length of AHAS genes was sequenced and the AHAS enzymes were assayed in vitro in order to clarify the mechanism of resistance to AHAS inhibitors in R1 and R2 populations.  The results demonstrated that R2 had a Pro-197-Ser mutation in the AHAS gene, and the sensitivity of R2 to the five AHAS inhibitors was decreased, which may result in R2 resistance to AHAS inhibitors.  There was no mutation in the AHAS gene of R1, and there were no significant differences in enzyme sensitivity between susceptible (S) and resistant (R1) populations.  An enhanced metabolism may be the main mechanism of R1 resistance to AHAS inhibitors.
Reference | Related Articles | Metrics
Effect of pre-culture on virus elimination from in vitro apple by thermotherapy coupled with shoot tip culture
HU Guo-jun, DONG Ya-feng, ZHANG Zun-ping, FAN Xu-dong, REN Fang, LI Zheng-nan
2018, 17 (09): 2015-2023.   DOI: 10.1016/S2095-3119(18)61913-6
Abstract359)      PDF in ScienceDirect      

We evaluated the role of pre-culture on survival rate of in vitro apple plants treated by thermotherapy.  Two apple cultivars, Malus×domestica cv. Pink Lady and Huafu, were used in the experiment and both have widely grown in China and infected with Apple chlorotic leaf spot virus (ACLSV) and Apple stem grooving virus (ASGV).  Results in growth and virus titer of apple plants did not exhibit clear trends during five different periods of pre-culture.  Whilst, pre-culture increased the survival rate of the two cultivars during thermotherapy.  The survival rate of plants pre-cultured for 13 d (P-13d) was 14 and 51% higher than that of P-1d plants for Pink Lady and Huafu, respectively.  Moreover, pre-culture positively influenced regeneration of Huafu plants.  The average survival rate of plants regenerated from P-1d and P-4d was 20% lower than that regenerated from P-7d, P-10d, and P-13d.  The efficiency of virus eradication was determined by reverse-transcription PCR with two primer pairs for each virus, and the detection results showed that pre-culture scarcely affected apple virus elimination.  Despite the fact that the two viruses were hardly detected at 5 d of thermotherapy, no virus-free plants were found in the two cultivars of regenerated apple plantlets after 30-d treatment. 
Reference | Related Articles | Metrics
The characterization of acid and pepsin soluble collagen from ovine bones (Ujumuqin sheep)
GAO Ling-ling, WANG Zhen-yu, LI Zheng, ZHANG Cai-xia, ZHANG De-quan
2018, 17 (03): 704-711.   DOI: 10.1016/S2095-3119(17)61751-9
Abstract727)      PDF in ScienceDirect      
Ovine bones are the major by-products after slaughtered.  The present study was conducted to extract and characterize acid soluble collagens (ASC) and pepsin soluble collagens (PSC) from ovine bones (Ujumuqin sheep).  Ovine bones collagen were identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and liquid chromatography-tandem mass spectrometry (LC-MS/MS) as type I collagen.  The results of Fourier transform infrared (FTIR) spectra analysis testified the existence of triple superhelical structure in both ASC and PSC, showing pepsin did not disrupt the triple helical structure of ovine bones collagen.  Glycine, accounting for one-third of total amino acids, was the major amino acid for ovine bones collagen.  Higher imino acid content was responsible for higher thermal denaturation temperature of ovine bones collagen compared to fish collagens.  The isoelectric point of ASC was lower than PSC due to the higher content of acidic amino acids.  Therefore, this study provides the potential reference for collagen extraction and application of ovine bones by-procduct.
Reference | Related Articles | Metrics
The effect of dehydrogenase enzyme activity in glycolysis on the colour stability of mutton during postmortem storage
XIN Jian-zeng, LI Zheng, LI Xin, LI Meng, WANG Ying, YANG Fu-min, ZHANG De-quan
2017, 16 (11): 2646-2654.   DOI: 10.1016/S2095-3119(16)61622-2
Abstract623)      PDF in ScienceDirect      
This study investigated the influence of activities of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and lactate dehydrogenase-B (LDH-B) on the colour stability of mutton.  From 60 sheep (Bayannur mutton sheep), 15 longissimus dorsi (LD) muscles were selected on the basis of colour stability (R630/580 and a* value) during the storage and classified into three groups (5 for each group) as high colour stability (HCS), intermediate colour stability (ICS) and low colour stability (LCS).  The activities of GAPDH and LDH-B, muscle colour attributes, nicotinamide adenine dinucleuotide (NADH) concentration and lactate concentration were measured.  The samples in HCS had higher activities of GAPDH and LDH-B than the samples in the LCS, and the samples in the HCS group also possessed higher NADH and lower lactate concentration.  The higher activity of dehydrogenase enzyme may result in higher NADH concentrations and colour stability in muscle tissue.  The results suggest that the activity of GAPDH and LDH-B may also play a role in maintaining colour stability.
Reference | Related Articles | Metrics
Global sensitivity analysis of the AquaCrop model for winter wheat under different water treatments based on the extended Fourier amplitude sensitivity test
XING Hui-min, XU Xin-gang, LI Zhen-hai, CHEN Yi-jin, FENG Hai-kuan, YANG Gui-jun, CHEN Zhao-xia
2017, 16 (11): 2444-2458.   DOI: 10.1016/S2095-3119(16)61626-X
Abstract680)      PDF in ScienceDirect      
Sensitivity analysis (SA) is an effective tool for studying crop models; it is an important link in model localization and plays an important role in crop model calibration and application.  The objectives were to (i) determine influential and non-influential parameters with respect to above ground biomass (AGB), canopy cover (CC), and grain yield of winter wheat in the Beijing area based on the AquaCrop model under different water treatments (rainfall, normal irrigation, and over-irrigation); and (ii) generate an AquaCrop model that can be used in the Beijing area by setting non-influential parameters to fixed values and adjusting influential parameters according to the SA results.  In this study, field experiments were conducted during the 2012–2013, 2013–2014, and 2014–2015 winter wheat growing seasons at the National Precision Agriculture Demonstration Research Base in Beijing, China.  The extended Fourier amplitude sensitivity test (EFAST) method was used to perform SA of the AquaCrop model using 42 crop parameters, in order to verify the SA results, data from the 2013–2014 growing season were used to calibrate the AquaCrop model, and data from 2012–2013 and 2014–2015 growing seasons were validated.  For AGB and yield of winter wheat, the total order sensitivity analysis had more sensitive parameters than the first order sensitivity analysis.  For the AGB time-series, parameter sensitivity was changed under different water treatments; in comparison with the non-stressful conditions (normal irrigation and over-irrigation), there were more sensitive parameters under water stress (rainfall), while root development parameters were more sensitive.  For CC with time-series and yield, there were more sensitive parameters under water stress than under no water stress.  Two parameters sets were selected to calibrate the AquaCrop model, one group of parameters were under water stress, and the others were under no water stress, there were two more sensitive parameters (growing degree-days (GDD) from sowing to the maximum rooting depth (root) and the maximum effective rooting depth (rtx)) under water stress than under no water stress.  The results showed that there was higher accuracy under water stress than under no water stress.  This study provides guidelines for AquaCrop model calibration and application in Beijing, China, as well providing guidance to simplify the AquaCrop model and improve its precision, especially when many parameters are used.  
Reference | Related Articles | Metrics
Spatio-temporal changes in rice area at the northern limits of the rice cropping system in China from 1984 to 2013
LI Zhi-peng, LONG Yu-qiao, TANG Peng-qin, TAN Jie-yang, LI Zheng-guo, WU Wen-bin, HU Ya-nan, YANG Peng
2017, 16 (02): 360-367.   DOI: 10.1016/S2095-3119(16)61365-5
Abstract1263)      PDF in ScienceDirect      
Rice area has been expanding rapidly during the past 30 years under the influence of global change in northeastern China, which is the northernmost region of rice cultivation in China.  However, the spatio-temporal dynamic changes in rice area are still unclear, although they may have important policy implications for environmental protection and adaptation to climate change.  In this study, we aimed to identify the dynamic changes of the rice area in Heilongjiang Province of northeastern China by extracting data from multiple Landsat images.  The study used ground quadrats selected from Google Earth and the extraction of a confusion matrix to verify the accuracy of extraction.  The overall accuracy of the extracted rice area was higher than 95% as a result of using the artificial neural network (ANN) classification method.  The results showed that the rice area increased by approximately 2.4×106 ha during the past 30 years at an annual rate of 8.0×104 ha, and most of the increase occurred after 2000.  The central latitude of the rice area shifted northwards from 46 to 47°N during the study period, and moved eastwards from 130 to 133°E.  The rice expansion area accounted for 98% of the total change in rice area, and rice loss was notably rare.  The rice expansion was primarily from dryland.  In addition, rice cultivation in marshland and grassland played a minor role in the rice expansion in this region.
Reference | Related Articles | Metrics
Estimating grassland LAI using the Random Forests approach and Landsat imagery in the meadow steppe of Hulunber, China
LI Zhen-wang, XIN Xiao-ping, TANG Huan, YANG Fan, CHEN Bao-rui, ZHANG Bao-hui
2017, 16 (02): 286-297.   DOI: 10.1016/S2095-3119(15)61303-X
Abstract1178)      PDF in ScienceDirect      
Leaf area index (LAI) is a key parameter for describing vegetation structures and is closely associated with vegetative photosynthesis and energy balance.  The accurate retrieval of LAI is important when modeling biophysical processes of vegetation and the productivity of earth systems.  The Random Forests (RF) method aggregates an ensemble of decision trees to improve the prediction accuracy and demonstrates a more robust capacity than other regression methods.  This study evaluated the RF method for predicting grassland LAI using ground measurements and remote sensing data. 
Parameter optimization and variable reduction were conducted before model prediction.  Two variable reduction methods were examined: the Variable Importance Value method and the principal component analysis (PCA) method.  Finally, the sensitivity of RF to highly correlated variables was tested.  The results showed that the RF parameters have a small effect on the performance of RF, and a satisfactory prediction was acquired with a root mean square error (RMSE) of 0.1956.  The two variable reduction methods for RF prediction produced different results; variable reduction based on the Variable Importance Value method achieved nearly the same prediction accuracy with no reduced prediction, whereas variable reduction using the PCA method had an obviously degraded result that may have been caused by the loss of subtle variations and the fusion of noise information.  After removing highly correlated variables, the relative variable importance remained steady, and the use of variables selected based on the best-performing vegetation indices performed better than the variables with all vegetation indices or those selected based on the most important one.  The results in this study demonstrate the practical and powerful ability of the RF method in predicting grassland LAI, which can also be applied to the estimation of other vegetation traits as an alternative to conventional empirical regression models and the selection of relevant variables used in ecological models.
Reference | Related Articles | Metrics
cDNA cloning and characterization of the carboxylesterase pxCCE016b from the diamondback moth, Plutella xylostella L.
HU Zhen-di, FENG Xia, LIN Qing-sheng, CHEN Huan-yu, LI Zhen-yu, YIN Fei, LIANG Pei, GAO Xi-wu
2016, 15 (05): 1059-1068.   DOI: 10.1016/S2095-3119(15)61278-3
Abstract1668)      PDF in ScienceDirect      
    Carboxylesterase is a multifunctional superfamily and can be found in almost all living organisms. As the metabolic enzymes, carboxylesterases are involved in insecticides resistance in insects for long time. In our previous studies, the enhanced carboxylesterase activities were found in the chlorantraniliprole resistance strain of diamondback moth (DBM). However, the related enzyme gene of chlorantraniliprole resistance has not been clear in this strain. Here, a full-length cDNA of carboxylesterase pxCCE016b was cloned and exogenously expressed in Escherichia coli at the first time, which contained a 1 693 bp open reading frame (ORF) and encoded a protein of 542 amino acids. Sequence analysis showed that this cDNA has a predicted mass of 61.56 kDa and a theoretical isoelectric point value of 5.78. The sequence of deduced amino acid possessed the classical structural features: a type-B carboxylesterase signature 2 (EDCLYLNVYTK), a type-B carboxylesterase serine active site (FGGDPENITIFGESAG) and the catalytic triad (Ser186, Glu316, and His444). The real-time quantitative PCR (qPCR) analysis showed that the expression level of the pxCCE016b was significantly higher in the chlorantraniliprole resistant strain than in the susceptible strain. Furthermore, pxCCE016b was highly expressed in the midgut and epidermis of the DBM larvae. When the 3rd-instar larvae of resistant DBM were exposed to abamectin, alpha-cypermethrin, chlorantraniliprole, spinosad, chlorfenapyr and indoxacarb insecticides, the up-regulated expression of pxCCE016b was observed only in the group treated by chlorantraniliprole. In addition, recombinant vector pET-pxCCE016b was constructed with the most coding region (1 293 bp) and large number of soluble recombinant proteins (less than 48 kDa) were expressed successfully with prokaryotic cell. Western blot analysis showed that it was coded by pxCCE016b. All the above findings provide important information for further functional study, although we are uncertainty whether the pxCCE016b gene is actually involved in chlorantraniliprole resistance.
Reference | Related Articles | Metrics
China agricultural outlook for 2015–2024 based on China Agricultural Monitoring and Early-warning System (CAMES)
XU Shi-wei, LI Gan-qiong, LI Zhe-min
2015, 14 (9): 1889-1902.   DOI: 10.1016/S2095-3119(15)61149-2
Abstract2612)      PDF in ScienceDirect      
The primary goal of Chinese agricultural development is to guarantee national food security and supply of major agricultural products. Hence, the scientific work on agricultural monitoring and early warning as well as agricultural outlook must be strengthened. In this study, we develop the China Agricultural Monitoring and Early-warning System (CAMES) on the basis of a comparative study of domestic and international agricultural outlook models. The system is a dynamic and multi-market partial equilibrium model that integrates biological mechanisms with economic mechanisms. This system, which includes 11 categories of 953 kinds of agricultural products, could dynamically project agricultural market supply and demand, assess food security, and conduct scenario analysis at different spatial levels, time scale levels, and macro-micro levels. Based on the CAMES, the production, consumption, and trade of the major agricultural products in China over the next decade are projected. The following conclusions are drawn: i) The production of major agricultural products will continue to grow steadily, mainly because of the increase in yield. ii) The growth of agricultural consumption will be slightly higher than that of agricultural production. Meanwhile, a high self-sufficiency rate is expected for cereals such as rice, wheat, and maize, with the rate being stable at around 97%. iii) Agricultural trade will continue to thrive. The growth of soybean and milk imports will slow down, but the growth of traditional agricultural exports such as vegetables and fruits is expected to continue.
Reference | Related Articles | Metrics
Edible agro-products quality and safety in China
LI Zhe-min, SU Nian-si, DONG Xiao-xia, YANG Yan-tao, WANG Yu-ting, XIAO Hong-li
2015, 14 (11): 2166-2175.   DOI: 10.1016/S2095-3119(15)61116-9
Abstract2178)      PDF in ScienceDirect      
Ensuring an acceptable level of edible agro-products quality and safety is necessary to provide adequate protection for consumers. It is the first time that we analyzed the edible agro-products quality and safety issues in the supply chain, including production, processing, circulation, and consumption. The results indicate that the agro-products quality and safety levels improves steadily, and the supervision system and standardization system are both enhanced significantly, however, certain challenges still remain in each stage of the supply chain and the entire supervision process. Finally, five recommendations regarding four aspects (production, processing, circulation, and consumption) are concluded.
Reference | Related Articles | Metrics
A New Disease of Cherry Plum Tree with Yellow Leaf Symptoms Associated with a Novel Phytoplasma in the Aster Yellows Group
LI Zheng-nan, ZHANG Lei, TAO Ye, CHI Ming, XIANG Yu , WU Yun-feng
2014, 13 (8): 1707-1718.   DOI: 10.1016/S2095-3119(13)60600-0
Abstract1354)      PDF in ScienceDirect      
A novel phytoplasma was detected in a cherry plum (Prunus cerasifera Ehrh) tree that mainly showed yellow leaf symptom. The tree was growing in an orchard located in Yangling District, Shaanxi Province, China. The leaves started as chlorotic and yellowing along leaf minor veins and leaf tips. Chlorosis rapidly developed to inter-veinal areas with the whole leaf becoming pale yellow in about 1-4 wk. Large numbers of phytoplasma-like bodies (PLBs) were seen under transmission electron microscopy. The majority of the PLBs was spherical or elliptical vesicles, with diameters in range of 0.1-0.6 μm, and distributed in the phloem cells of the infected tissues. A 1246-bp 16S ribosomal RNA (rRNA) gene fragment was amplified from DNA samples extracted from the yellow leaf tissues using two phytoplasma universal primer pairs R16mF2/R16mR1 and R16F2n/R16R2. Phylogenetic analysis using the 16S rRNA gene sequence suggested that the phytoplasma associated with the yellow leaf symptoms belongs to a novel subclade in the aster yellows (AY) group (16SrI group). Virtual and actual restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene fragment revealed that the phytoplasma was distinguishable from all existing 19 subgroups in the AY group (16SrI) by four restriction sites, Hinf I, Mse I, Sau3A I and Taq I. The similarity coefficients of comparing the RFLP pattern of the 16S rRNA gene fragment of this phytoplasma to each of the 19 reported subgroups ranged from 0.73 to 0.87, which indicates the phytoplasma associated with the cherry plum yellow leaf (CPYL) symptoms is probably a distinct and novel subgroup lineage in the AY group (16SrI). In addition, the novel phytoplasma was experimentally transmitted to periwinkle (Catharanthus roseus) plants from the tree with CPYL symptoms and then back to a healthy 1-yr-old cherry plum tree via dodder (Cuscuta odorata) connections.
Reference | Related Articles | Metrics
Influence of Climate and Socio-Economic Factors on the Spatio-Temporal Variability of Soil Organic Matter: A Case Study of Central Heilongjiang Province, China
SHI Shu-qin, CAO Qi-wen, YAO Yan-min, TANG Hua-jun, YANG Peng, WU Wen-bin, XU Heng-zhou, LIU Jia , LI Zheng-guo
2014, 13 (7): 1486-1500.   DOI: 10.1016/S2095-3119(14)60815-7
Abstract1734)      PDF in ScienceDirect      
For the scientific management of farmland, it is significant to understand the spatio-temporal variability of soil organic matter and to study the influences of related factors. Using geostatistical theory, GIS spatial analysis, trend analysis and a Geographically Weighted Regression (GWR) model, this study analyzed the response of soil organic matter to climate and socio-economic factors in central Heilongjiang Province during the past 25 years. Second soil survey data of China for 1979-1985, 2005 field sampling data, climate observations and socio-economic data for 1980-2005 were analyzed. First, soil organic matter in 2005 was spatially interpolated using the Co-Kriging method along with auxiliary data sets of soil type and pH. The spatio-temporal variability was then studied by comparison with the 1980s second soil census data. Next, the temporal trends in climate and socio-economic factors over the past 25 years were investigated. Finally, we examined the variation of the response of soil organic matter to climate and socio-economic factors using the GWR model spatially and temporally. The model showed that 53.82% area of the organic matter content remained constant and 29.39% has decreased during the past 25 years. The impact of precipitation on organic matter content is mainly negative, with increasing absolute values of the regression coefficient. The absolute value of regression coefficient of annual average temperature has decreased, and more areas are now under its negative effects. In addition, the areas of positive regression coefficient of annual sunshine hours have northward shifted, with the increasing absolute value of positive coefficient and decreasing absolute value of negative coefficient. The areas of positive regression coefficient of mechanized farming as a socio-economic factor have westward shifted, with the increasing absolute value of negative coefficient and decreasing absolute value of positive coefficient. The area of regions with the positive regression coefficient of irrigation has expanded. The regions with positive regression coefficient of fertilizer use have shrinked. The positive regression coefficient of mulch film consumption has significantly increased. The regression coefficient of pesticide consumption was mainly positive in the west of the study area, while it was negative to the east. Generally, GWR model is capable to investigate the influence of both climatic and socio-economic factors, avoided the insufficiency of other research based on the single perspective of climatic or socio-economic factors. Therefore, we can conclude that GWR model could provide methodological support for global change research and serve as basic reference for cultivated land quality improvement and agricultural decision making.
Reference | Related Articles | Metrics
Editorial - Systematic Synthesis of Impacts of Climate Change on China’s Crop Production System
TANG Hua-jun, WU Wen-bin, YANG Peng , LI Zheng-guo
2014, 13 (7): 1413-1417.   DOI: 10.1016/S2095-3119(14)60801-7
Abstract1479)      PDF in ScienceDirect      
Reference | Related Articles | Metrics
Biochemical Mechanism of Chlorantraniliprole Resistance in the Diamondback Moth, Plutella xylostella Linnaeus
HU Zhen-di, FENG Xia, LIN Qing-sheng, CHEN Huan-yu, LI Zhen-yu, YIN Fei, LIANG Pei , GAO Xi-wu
2014, 13 (11): 2452-2459.   DOI: 10.1016/S2095-3119(14)60748-6
Abstract1337)      PDF in ScienceDirect      
The insecticide chlorantraniliprole exhibits good efficacy and plays an important role in controlling the diamondback moth, Plutella xylostella Linnaeus. However, resistance to chlorantraniliprole has been observed recently in some field populations. At present study, diamondback moths with resistance to chlorantraniliprole (resistant ratio (RR) was 82.18) for biochemical assays were selected. The assays were performed to determine potential resistance mechanisms. The results showed that the selected resistant moths (GDLZ-R) and susceptible moth could be synergized by known metabolic inhibitors such as piperonyl butoxide (PBO), triphenyl phosphate (TPP) and diethyl-maleate (DEM) at different levels (1.68-5.50-fold and 2.20-2.89-fold, respectively), and DEM showed the maximum synergism in both strains. In enzymes assays, a high level of glutathione-S-transferase (GST) was observed in the resistant moth, in contrast, moths that are susceptible to the insecticide had only 1/3 the GST activity of the resistant moths. The analysis of short-term exposure of chlorantraniliprole on biochemical response in the resistant strain also showed that GST activity was significantly elevated after exposure to a sub-lethal concentration of chlorantraniliprole (about 1/3 LC50, 12 mg L-1) 12 and 24 h, respectively. The results show that there is a strong correlation between the enzyme activity and resistance, and GST is likely the main detoxification mechanism responsible for resistance to chlorantraniliprole in P. xylostella L., cytochrome P450 monooxygenase (P450) and carboxy-lesterase (CarE) are involved in to some extent.
Reference | Related Articles | Metrics
Spatial-Temporal Changes in Grain Production, Consumption and Driving Mechanism in China
XU Shi-wei, WU Jian-zhai, SONG Wei, LI Zhi-qiang, LI Zhe-min , KONG Fan-tao
2013, 12 (2): 374-385.   DOI: 10.1016/S2095-3119(13)60236-1
Abstract1594)      PDF in ScienceDirect      
The spatial-temporal patterns of grain production and consumption have an important influence on the effective national grain supply on condition of tight balance in the total grain amount in China. In this paper, we analyze the spatial-temporal patterns of grain production, consumption and the driving mechanism for their evolution processes in China. The results indicate that both gravity centers of grain production and consumption in China moved toward the northern and eastern regions, almost in the same direction. The coordination of grain production and consumption increased slightly from 1995 to 2007 but decreased from 2000 to 2007. There is a spatial difference between the major districts of output increase and the strong growth potential in grain consumption, which indicates an increasing difficulty in improving the regional coordination of grain production and consumption. The movement of the gravity center of grain production is significantly correlated with regional differences in grain production policy, different economic development models, and spatial disparity of land and water resource use. For grain consumption, the main driving factors include rapid urbanization, the upgrade of food consumption structure, and distribution of food industries.
Reference | Related Articles | Metrics
Prediction Model of Weekly Retail Price for Eggs Based on Chaotic Neural Network
LI Zhe-min, CUI Li-guo, XU Shi-wei, WENG Ling-yun, DONG Xiao-xia, LI Gan-qiong , YU Hai-peng
2013, 12 (12): 2292-2299.   DOI: 10.1016/S2095-3119(13)60610-3
Abstract1424)      PDF in ScienceDirect      
This paper establishes a short-term prediction model of weekly retail prices for eggs based on chaotic neural network with the weekly retail prices of eggs from January 2008 to December 2012 in China. In the process of determining the structure of the chaotic neural network, the number of input layer nodes of the network is calculated by reconstructing phase space and computing its saturated embedding dimension, and then the number of hidden layer nodes is estimated by trial and error. Finally, this model is applied to predict the retail prices of eggs and compared with ARIMA. The result shows that the chaotic neural network has better nonlinear fitting ability and higher precision in the prediction of weekly retail price of eggs. The empirical result also shows that the chaotic neural network can be widely used in the field of short-term prediction of agricultural prices.
Reference | Related Articles | Metrics