JIA-2019-11

2438 Chalisa Chaengsakul et al. Journal of Integrative Agriculture 2019, 18(11): 2435–2445 the method of Lodhi et al . (1994), with modifications. Each dry pellet (DNA or RNA) was dissolved in 50 µL DEPC- treated water and its concentration and quality were initially checked with a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, USA). Total nucleic acid was treated with DNase (Thermo Scientific, Massachusetts, USA) and cDNAsynthesis was carried out using a RevertAid First Strand cDNA Synthesis Kit (Thermo Scientific, Massachusetts, USA). qPCR was performed using a Helixis 5421 (Avenida Encinas, California, USA) with a double- stranded DNA binding dye and Luminaris Color HiGreen qPCRMaster Mix (Thermo Scientific, Massachusetts, USA). Gene-specific primer pairs were designed by the Primer 3 Program (http://bioinfo.ut.ee/primer3-0.4.0/ ). The qPCR analysis was performed to quantify the relative expression of alcohol dehydrogenase ( ADH1 ), alternative oxidase ( AOX1 ), cytochrome c oxidase ( COXc ), and ATPase of Zea mays , including the alcohol dehydrogenase ( ADH1 ) of Aspergillus flavus . The elongation factor 1-alpha ( EF1α ) was used as a reference gene. Details of the primer sequences used for qPCR analysis in the present study are shown in Table 1. 2.6. Statistical analysis The continuous variables were tested using analysis of variance (ANOVA fixed effect model) with completely randomized designs followed by least significant difference (LSD) post hoc tests as well as orthogonal contrasts to identify significant differences amongmeans at a significance level of P <0.05. Homogeneity of variance (Levene test) and normality of data were tested in accordance with the assumptions for ANOVA. The percentage data, such as germination, AA test, and RE test, were angularly transformed before theANOVAwas carried out (transformed using arcsine x /100 ); untransformed values are shown in the table and figures to facilitate comparison. The relative expression of each target gene was calculated using the standard-curve-based method (Larionov et al . 2005). 3. Results 3.1. Seed qualities after cool-dried storage and hot- humid treatments The percentage germination of maize seed stored under ambient conditions, on the laboratory bench, was less than under the controlled conditions (Table 2). Seed vigour was investigated using theAAand radicle emergence (RE) tests. The RE test of seed stored under ambient conditions was significantly less than under the controlled conditions. Seed quality, germination, and vigour decreased with increasing period of storage. To demonstrate trend of seed deterioration after hot- humid treatment, maize seeds were treated with artificial ageing in 100% RH and 42°C for 0, 12, 24, and 48 h. Germination of the treated seed was low compared to the control but there were no significant differences among the seeds stored at either of the two conditions (Table 3). The 48-h treated seed produced lower results in the AA test than the other samples. However, maize seed after hot- humid treatment for 24 and 48 h had poorer vigour than the untreated control seed based on the RE test (Table 3). 3.2. Effect of cool-dried storage and hot-humid treatments on ethanol production In fast ethanol assay, the headspace ethanol range under each set of storage conditions was 16–390 µg L –1 . The results revealed that seed stored under ambient conditions produced more headspace ethanol than under the controlled conditions, especially at 3 and 6 months (Fig. 1). The volume of headspace ethanol under ambient storage was higher than the controlled storage. Interestingly, the trends in ethanol production were similar between storage under ambient and controlled conditions. Ethanol production peaked at 9 months after storage and then reduced after 12 months. Table 1 Detail of primer sequences used for qPCR analysis in the study Gene GenBank accession no. Type Sequence (5´→3´) Annealing temperature (°C) Alcohol dehydrogenase ( ADH1 ) ( Zea mays ) L23548.1 Forward primer GGTTCGACAGTGGCTGTTTT 58 Reverse primer TGTGGTCTTTTGGGTTCACA ATPase ( Zea mays ) NM_001158454.1 Forward primer TGAAGATAAGCAGCGTGGTG 60 Reverse primer TAGGAGCAACAGGAGCGACT Alternative oxidase ( AOX1 ) ( Zea mays ) AY059646.1 Forward primer AAGAAAATGCCTGGCTGCTA 58 Reverse primer CCTTCGTTGCTCCTTTTCAG Cytochrome c oxidase ( COXc ) ( Zea mays ) EU976023.1 Forward primer ACCTTGGCACAAGAGACGAT 59 Reverse primer TGGGCCCATCACTTAAAAAG Alcohol dehydrogenase ( ADH1 ) ( Aspergillus flavus ) L27434.1 Forward primer GCTTCTTTGTCCGGCTACAC 59 Reverse primer AGAACCAAGACCACCACCAG Elongation factor 1-alpha ( EF1α ) ( Zea mays ) U76259.1 Forward primer AGGTCCACCAACCTTGACTG 58 Reverse primer ACGTCCAACAGGGACAGTTC