JIA-2019-11

2507 LI Li-shu et al. Journal of Integrative Agriculture 2019, 18(11): 2505–2513 (10 mmol L –1 ), 1 μL cDNA, 1 μL of each primer (10 μmol L –1 ), 0.16 μL Dream Taq polymerase, and 18.84 μL ddH 2 O. The polymerase chain reaction (PCR) amplification programwas as follows: predenaturation at 95°C for 5 min; 36 cycles of denaturation at 95°C for 40 s, annealing at 57°C for 40 s, and extension at 72°C for 40 s; and final extension at 72°C for 10 min. PCR products were detected by 1.8% agarose gel electrophoresis. The target fragment was ligated into the pMD18-T vector (TaKaRa, Dalian, China) and transformed into competent E . coli DH5α cells. Positive colonies were identified by PCR identification. The recombinant plasmid with the target gene was submitted to Sangon Biotech (Shanghai) Co., Ltd., for sequencing. Identification of nucleotide sequences was established using the National Center for Biotechnology Information (NCBI) basic local alignment tool (BLAST) program (http://www.ncbi.nlm.nih.gov/BLAST) , and the amino acid sequences were analyzed by DNAMAN Software. The basic physical and chemical properties of the protein were calculated by Expasy Param (http://us.expasy.org/tools/ peptide-mass.html). The signal peptides were analyzed by SignalP 4.0, and amino acid sequences from other species were obtained from the NCBI database. Aphylogenetic tree was constructed using MEGA5.0 software and the neighbor- joining (NJ) method. 2.4. Gene expression analysis The expression of MieIF1A-b in different tissues, fruits at various developmental stages and leaves under different stress conditions was analyzed by qRT-PCR. The expression level of the MieIF1A-b gene was detected by using MiGAPDH as an internal control (Luo et al. 2011) and reverse transcription cDNA as a template. PCR was performed in a total volume of 20 μL containing 10 μL SYBR Premix Ex Taq , 0.8 μL of each primer (10 μmol L –1 ), 2 μL cDNA (50 ng), and 6.4 μL nuclease-free water. The PCR program was as follows: 95°C for 30 s; 45 cycles of 5 s at 95°C, 20 s at 60°C; 95°C for the dissolution curve, 15 s at 65°C, and 42°C for cooling. qRT-PCR experiments were performed with SYBR Green PCR Master Mix (TaKaRa) on a Light Cycler ® 480 real-time PCR machine (Roche, Germany). Relative gene expression was evaluated with the 2 −ΔΔC T method (Livak and Schmittgen 2001). Three biological replicates were used for analysis. The expression level was calculated as the average ratio between the relative transcript abundance of the treated and control samples. 2.5. Plasmid construction and plant transformation To construct the 35S: MieIF1A-b plasmid for experiments, we amplified and cloned full-length cDNAsequences containing the open reading frame (ORF) of the MieIF1A-b gene into the vector pBI121, which carries the β-glucuronidase ( GUS ) reporter gene. The primers used are described in Table 1. For plant transformation, the pBI121 recombinant plasmid was transformed into Agrobacterium tumefaciens strain EHA105 by the freeze-thawing method and then transfected into A . thaliana by the floral dip method. Positive transgenic plants were screened by antibiotics and identified by PCR (primers showed in Table 1). We also tested the transgenic generation plants using GUS staining detection; the test was conducted according to kit instructions (Solarbio, Beijing, China). Three transgenic lines (L4, L10, and L21) of T 3 generation, which showed better in PCR and GUS staining were selected for phenotypic observation and salt treatment. Seeds were sowed in 1/2 MS medium (containing 50 mg L –1 kanamycin) and 1/2 MS medium (without kanamycin) for grown 15 d. The seedlings were shifted to different NaCl concentrations (0, 50, 100, and 200 mmol L –1 NaCl) in 1/2 MS medium, and plant growth and seedling livability Table 1 PCR primers in this study Primer ID Primer sequence (5´→3´) Application APU1 GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTTT Reverse transcriptase MieIF1A-b-F ATGCCGAAGAAAAAGGGAAAGG Amplification of ORF sequence MieIF1A-b-R GATCTTATCAATATCTTCATCC Amplification of ORF sequence MiGAPDH-F CTAGTGGTCCAAGTCTCCAAGAAAA Real-time PCR MiGAPDH-R CAAGGGGCTCATCACAAACA Real-time PCR qMieIF1A-b-F ACTTGTTGGGCTTCGTGACT Real-time PCR qMieIF1A-b-R AGACGGGTGCTCTCTGGAA Real-time PCR MieIF1A-b-XbaI-F CACGGGGGACTCTAGAATGCCGAAGAAAAAG Recombinant MieIF1A-b- SamI-R GACCACCCGGGGATCCGATCTTATCAATATC Recombinant M13-F CGCCAGGGTTTTCCCAGTCACGAC PMD-18T universal primer M13-R AGCGGATAACAATTTCACACAGGA PMD-18T universal primer D35S-F GCACAATCCCACTATCCTTCG Bacterium-specific PCR JGUS-R GATCCAGACTGAATGCCCACAG Bacterium-specific PCR The underlined sequences were restrictive endonuclease Xba I and Sam I.