JIA-2019-11

2563 LIU Ying et al. Journal of Integrative Agriculture 2019, 18(11): 2561–2570 the manufacturer’s instructions. Molecular identification of the species was performed by comparing a 616-nt, PCR-amplified fragment of the calmodulin (CaM) gene using the primers cmd5 (CCGAGTACAAGGARGCCTTC) and cmd6 (CCGATRGAGGTCATRACGTGG) and the 556-nt β-tubulin (BenA) gene using the primers Bt2a (GGTAACCAAATCGGTGCTGCTTTC) and Bt2b (ACCCTCAGTGTAGTGACCCTTGGC). Cam and BenA gene were amplified as described in Samson et al . (2014) and Li and Xu (2017). Alignment of sequences of CaM and BenAwas performed using CLUSTALW with reference strains of A . welwitschiae , respectively (syn. CBS 139.54, KC480196.1 and FJ629291.1) (Thompson et al . 1994; Perrone et al . 2011; Hong et al . 2013; Susca et al . 2016). Phylogenetic analysis was performed using the neighbor- joining (NJ) method with MEGA 3.0 (Kumar et al . 2004). 2.2. Cultures of rice plants and the root-knot nematode M. graminicola Seeds of the rice ( Oryza sativa ) variety Nipponbare were obtained from the US Department of Agriculture (GSOR-100). One germinated seed was sown in each polyvinylchloride (PVC) tube containing synthetic absorbent polymer (SAP), and rice seedlings were maintained in a greenhouse at (28±2)°C. Rice plants were irrigated with 20 mL of Hoagland solution twice per week as described in Zhan et al . (2018). A population of M . graminicola isolated from lowland rice in Hanshou County, Hunan Province, China, was maintained on the susceptible rice variety Nipponbare in a greenhouse at (28±2)°C in Beijing. Nematode eggs were separated from the root galls and hatched at room temperature. J2 suspensions were filtered through 25-μm sieves and resuspended in distilled water at a concentration of approximately 200 nematodes mL –1 (Byrd et al . 1966; Zhan et al . 2018). 2.3. Direct effects of A. welwitschiae on nematode behavior Asingle cryobank bead of A . welwitschiae isolates containing approximately 10 7 conidia was taken from a frozen cryobank and placed on a PDB plate for conidial production. After incubating at 28°C in the dark with shaking for 5 d, 5 mL of sterile water was pipetted onto the surface of the plate, and the fungal suspension was then filtered through a fine mesh screen to separate conidia from hyphae. The conidial suspension was then adjusted to a concentration of 10 7 (AW2017), 2×10 6 (5×AW2017), or 10 6 (10×AW2017) conidia mL –1 with water to analyze the toxicity to eggs and J2 nematodes. In vitro ovicidal test An in vitro test was conducted to determine whether conidial suspension of A . welwitschiae affect egg hatching of M . graminicola as described by Su and Mulla (1998), with slight modification. Root galls were macerated in a Waring blender with 1% NaOCl. Eggs were collected on a 0.25-μm sieve and rinsed with sterile water several times. Briefly, approximately 200 eggs were placed in a 24-well culture plate containing 1 mL of conidial suspension or liquid PDB medium. A treatment with only liquid PDB medium was included as the negative control. The plates were covered and incubated at 25°C for 4 and 8 d. Then, Lugol’s iodine solution was dropped into each well to stop egg hatching, and the percentage of hatching eggs was counted under a microscope and calculated with SAS Software (Saikia et al . 2013). The experiment was performed three times with six replicates each. In vitro larvicidal test Another in vitro test was conducted to determine whether conidial suspension of A . welwitschiae are toxic to M . graminicola juveniles. Approximately 200 J2s were placed in a 6-well culture plate containing 1 mL of conidial suspension or liquid PDB medium with different concentrations. After 3 d, the dead/alive nematodes in each well were counted under a stereomicroscope with stimulation by one drop of 1 mol L –1 NaOH (Chen and Dickson 2000). The experiment was performed three times with six replicates each. Attraction test The effect of conidial suspension on the attraction of M . graminicola to rice roots was evaluated in a 10 cm×5 cm×2 cm plastic chamber. The chamber was divided into six equal 1.5-cm segments with 600-μm plastic sieves and lled with approximately 100 mL of SAP each. Three 2-week-old rice seedlings were soaked in either a 10 6 conidia mL –1 suspension of A . welwitschiae (AW2017- treated plants) or liquid PDB medium (Control A) for 30 min and then transplanted at opposite ends of the chamber. Then, 1 mL of nematode suspension containing ca . 800 J2s was applied in the center of the chamber. In another control chamber, rice plants were directly transplanted in the opposite ends of the chamber (Control B and C without AW2017), and nematodes were inoculated as described above. After incubation in the greenhouse for 7 d as described above, the chambers were disassembled, and the SAP was collected at 1.5-cm intervals. The nematodes were collected on a 25-μm sieve by wet sieving (Padgham and Sikora 2007). Root samples at opposite ends of the chamber were stained with acid fuchsin, and the nematodes inside the roots were counted under a stereomicroscope as described by Nahar et al . (2011). Nematode numbers in roots and/or in SAPs were used to analyze the attraction of M . graminicola to rice roots. The experiment was conducted twice, and each treatment contained four replicates.