JIA-2019-11

2551 LI Liu et al. Journal of Integrative Agriculture 2019, 18(11): 2549–2560 targeting to the CP gene of ASPV were utilized for the RT- PCR detection of ASPV. Meanwhile, primer pairs ASGV-U/ ASGV-2 (5´-CCCGCTGTTGGATTTGATACACCTC-3´/ 5 ´ -GGAATTTCACACGACTCCTAACCCTCC - 3 ´ ) specific for ASGV (James 1999) and ACLSV-52/ ACLSV-53 (5´-CAGACCCTTATTGAAGTCGAA-3´/5´- GGCAACCCTGGAACAGA-3´) specific for ACLSV (German et al . 1990) were also included in the assays. 2.3. Determination of complete genome sequence of ASPV Initially, a primer set F7/R7 (5´-CCTTATTACCACCC ATTAGGT-3´/5´-GGGATCAACTTTACTAAAAGCAT-3´) designed basing on multiple alignments of ASPV sequences available in GenBank was used to amplify a 1 317-bp fragment (f7) containing the ASPV CP gene. Then, primer sets used to amplify other 6 fragments (f1–f6) were designed basing on the obtained CP gene sequence and sequences conserved in the genomes of all ASPV isolates available in GenBank (Table 1). To overcame inconvenient associated with intra-isolate sequence diversity and avoid mistakes during sequence assembling, adjacent amplicons were overlapped for more than 150 bp. To obtain the 5´ terminal sequence, primers 5´ RACE Out R1 and 5´ RACE Out R2 were designed based on the obtained sequence of fragment f1 and a random primer mixture pd(N)6 was used for cDNAsynthesis. The 5´ RACE reactions were attempted using an Invitrogen GeneRacer Kit (Invitrogen, USA) according to the manufacturer’s instructions. To obtain the 3´ terminal sequence, primers 3-Out-F1 and 3-Out-F2 were designed based on the obtained sequence of fragment f7. A common primer M4-T (Chen et al . 2002) was used for reverse transcription, primer set 3-Out-F1/M4 was used for the first round of amplification and primer set 3-Out-F2/M4 was used for the second round of amplification in semi-nested PCR reactions. Composition of the PCR reaction mixtures and the associated PCR conditions were similar to those mentioned above. In PCR solutions, LA Taq polymerase (TaKaRa, Dalian, China) was used to facilitate PCR reactions, and 40 µmol L –1 of each dNTP was used in a 25-µL reaction volume. For PCR reactions, the annealing step was performed for 45 s at 54–56°C (depending on the primer set used in each reaction), and the extension step was performed for 3–4 min (depending on the sizes of the PCR products) at 72°C. PCR products were gel-purified, inserted into the vector pMD18-T (TaKaRa, Dalian, China) and transformed into Escherichia coli DH5α following the manufacturer’s instructions. To obtain a view of molecular composition intra the isolate, at least three positive clones of each product were sequenced at a commercial sequencing service (Shanghai Sangon Biological Engineering & Technology and Service Co., Ltd., Shanghai, China). The Table 1 Primers designed for RT-PCR amplification of Apple stem pitting virus isolate ASPV-LYC genome Fragment Primer 1) Primer sequence (5´→3´) 2) Location (nt) 3) Product size (bp) f1 F1 GCAGAGGAAGTAATCGCATC 84–1 479 1 396 R1 CGGTGAAGTTAACAACATCCC f2 F2 ACTCTTAAGAAGCCAGACCT 1 068–2 910 1 843 R2 TGTTGCATAGGCACATGTCA f3 F3 TCCTTATGCCHTTTGGATT 2 530–4 338 1 809 R3 ATTTGCTAGTTTTCTTTCCACCAG f4 F4 TAGAGTTTCAAAYAGYGCVA 3 971–5 774 1 804 R4 TTTTGCACTTCTAAATCTGT f5 F5 ATTGGAGACATTACTACCGA 5 334–7 064 1 731 R5 AGAAACAGTCTGATTCCC f6 F6 CTTGTAATTTTAATAATGGAAACTGTGC 6 669–8 052 1 384 R6 AGCAACTGGCGAGCTGGTG f7 F7 CCTTATTACCACCCATTAGGT 7 886–9 202 1 317 R7 GGGATCAACTTTACTAAAAGCAT 3´ UTR 3-Out-F1 CCTTATTACCACCCATTAGGT 7 817 1 489 3-Out-F2 AGAACCTGCTGATGGGCTTG 8 961 345 M4 GTTTTCCCAGTCACGAC M4-T GTTTTCCCAGTCACGAC(T) 15 5´ UTR 5´ RACE Out F1 CATGGCTACATGCTGACAGCCTA 879 5´ RACE Out R1 GCGTTGTGATTCTTCCAGTCCT 830 5´ RACE In F2 CGCGGATCCACAGCCTACTGATGATCAGTCGATG 568 5´ RACE In R2 TCAAAGCCAGTCCTTCTATCACA 507 1) F, forward primer; R, reverse primer. 2) H is A or C or T; R is A or G; V is A or C or G; W is A or T and Y is C or T. 3) The locations refer to nucleotide positions corresponding to the genome sequence of ASPV-LYC.