JIA-2018-09

1934 HAN Jiao et al. Journal of Integrative Agriculture 2018, 17(9): 1932–1945 Both the transgenic lines and the wild type were cultured in hydroponics to investigate the changes of molecular responses, the physiological metabolism, and transcriptome profiles in the transgenic rice under phosphorus deficiency, and thus evaluating possible regulatory role of the McPht gene in promoting the phosphate uptake. Our data showed that the overexpressions of the McPht gene might confer an adaptive modulation in enhancing the uptake and transport of phosphate in the transgenic rice under phosphorus deficiency. 2. Materials and methods 2.1. Plant materials and stress treatments Rice seeds from T 2 generation of the transgenic rice and the wild type were germinated on the glass culture dishes by fresh water in dark at 30°C for 4 d, and transplanted into a net plastic plates mounting in the containers, and continuously cultured in a growth chamber at 28°C with 70% humidity for 1 wk (Zheng et al . 2013). Uniform seedlings were selected and transferred to the box containing 10 L of fresh Hoagland’s nutrient solution for further culture in a greenhouse at 28°C with 70–80% relative humidity and light 12 h/dark 12 h for 1 wk. The rice seedlings of 1-wk-old were separately subjected to the nutrient solution of 4 µmol L –1 P 2 O 5 (phosphorus deficiency) or the nutrient solution of 12.5 mmol L –1 P 2 O 5 (sufficient phosphorus), and continuously cultured for 4 wk, and plant samples were collected for RNA extraction and physiological measurements. The seeds of M. crystallinum L. were sowed in the vermicular and peat soil mixture of 1:1, and cultured at 23°C with relative humidity of 70% and 14 h light/10 h dark for 4 wk in a growth chamber. M. crystallinum seedlings of the 4-wk-old were subjected to phosphorus deficiency for 2 wk at the same culture condition. All treatments were designed by three biological replicates in this study. 2.2. Plant transformation The McPht cDNA fragments were obtained by PCR using the specific primer (Table 1), and inserted into the Bam HI and Pst I sites of a pCAMBIA1305 expression vector. The resulting construct of McPht :: pCAMBIA1305 was transformed into Agrobacterium tumefaciens GV3101, and the transformants were used to infect callus of Kitaake rice ( O. sativa japonica L.). The infected callus was cultured under sterile condition, and the generating seedlings were transplanted in the mixture of vermicular and peat soils (1:2), and all calluses were continually cultured for regeneration and further selected on the MS medium containing hygromycin by standard protocols (Matsumoto et al . 2009), and three transgenic rice lines of T 2 generation with stable hereditary were selected for subsequent experiments. 2.3. RNA extraction and quantitative RT-PCR Total RNA of plants were extracted with the Easy Table 1 Gene-specific primers used in this study Item Gene Primer (5´→3´) Expression vector McPht ::pCAMBIA1305 Forward: CAAGGGATCCATGGCGGTCTTTGAAAAC Reverse: CCAGCTGCAGCACACCAGTTGGTGGCAG Quantitative PCR McPht Forward: GGTTTGCAGCTTGGTGTGAG Reverse: TCACCAACAGTTGCACCCTT Actin Forward: CTGACAGGATGAGCAAGGAG Reverse: GGCAATCCACATCTGCTGGA McActin Forward: GTGATCTCCTTGCTCATACG Reverse: GGnACTGGAATGGTnAAGG Os04g0448800 Forward: ATGGCCGTCGTCTCCGAGAGC Reverse: CTGCATGTTGCACTTGACGAG Os02g0602300 Forward: ATGCAAGCTAAAGAATCCAAA Reverse: TGTGCCTTGTTTGATGGCCAC Os07g0650600 Forward: ATGATGGCCGCCGGTGGCCAC Reverse: CCTCGTGGCTTCATGGAAAAT Os02g0106100 Forward: ATGGAGACCCGGGACGACGTC Reverse: GGGATCGTTCATCCAGTTCC Os08g0157500 Forward: ATGGGTTCTACAGCCGCCGAC Reverse: GCTCTCCATGAGGACCTTGTC Os03g0348200 Forward: ATGGCCTCTTCAAGTTGTACAG Reverse: TAACCCTTGCTGCCTCAGCAAG Os10g0190800 Forward: ATGCTCCTCCTCCGCCACC Reverse: AACCTCGAGGAGGTGGTCG Subcellular localization McPht ::GFP Forward: CCAAAGCTGCAGATGGCGGTCTTTGAAAAC Reverse: CCAAAGCCATGGCACACCAGTTGGTGGCAG