JIA-2018-09

2056 ZHANG Bai-zhong et al. Journal of Integrative Agriculture 2018, 17(9): 2054–2065 the methods of Lu et al. (2007) with slight modifications. Imidacloprid was dissolved in acetone and then diluted with distilled water (LC 10 = 0.01 mg L –1 ). The wheat seedlings with aphids were dipped into the insecticide solution for 10 s. Control groups treated with distilled water were collected at the same time points as their imidacloprid-treated counterparts. The surviving third-instar nymphs were collected at 24 h after imidacloprid challenge. Aphids snap frozen in the liquid nitrogen before stored at –80°C for RNA extraction. The experiment was replicated at least three times. 2.4. Reference gene selection and primer design Eight ever used reference genes were selected, elongation fator 1 beta ( Ef1β ), TATA box binding protein ( TBP ), alpha-tubulin ( α-TUB ), 18S ribosomal ( 18S ), 28S ribosomal ( 28S ), glyceraldehyde-3-phosphate ( GAPDH ), actin ( ACT ), and ribosomal protein L18 ( RPL18 ). PCR primers for RT-qPCR were designed using primer3 input (http://primer3.ut.ee/) . The primers were designed on the basis of sequences (Appendix A). Details for the primers used in this study are listed in Table 1. 2.5. RNA extraction and cDNA synthesis Total RNA was isolated from S. graminum samples using TRIzol reagent. Sample RNA concentrations were measured using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, USA) at 260 nm. After total RNA (1.0 μg per sample) was treated with DNase I (Fermentas, USA) to remove possible genomic DNA contamination, first-strand cDNA was synthesized in a 20-μL reaction system using a First Strand cDNA Synthesis Kit (Fermentas, USA) with oligo(dT) 18 as the primer. 2.6. RT-qPCR RT-qPCR reactions were performed in a 20-μL mixture containing 1 μL of cDNA, 10 μL of SYBR Green RT-qPCR SuperMix-UDG, 0.15-μL ofeachprimer,and8.7μLofH 2 O. Theamplification efficiency of the target genes and reference genes were estimated using E=10 (−1/Sope) −1, where the slope was derived from the plot of Table 1 Primer paris used for RT-qPCR analysis of candidate reference genes, as well as two target genes, HSP70 and SgraCYP18A1 Gene Gene name Gene ID Tm (°C) Sequence (5´→3´) Efficiency (%) Product length (bp) R 2 Ef1β Elongation fator 1 beta Cluster-32023.14868 58.83 F: GCTGCTATGTCGACACTTTGA 91.3 142 0.992 59.03 R: CATCTAAGCTGGTTCCATTAGCT TBP TATA box binding protein Cluster-32023.12684 58.88 F: CCCGAGTTACATCCTGGTGT 102.9 124 0.999 59.48 R: GCTCGATTGCCTGGTAAACA α-TUB Alpha-tubulin CL647.Contig2 58.81 F: AAGCTTTGCCCATCTCATCG 95.8 116 0.995 59.12 R: TGTGGCCACCGAAGAAGTAT 18S 18S ribosomal Cluster-32023.22261 58.17 F: GTCTTCCGGCAACATCAACA 97.5 94 0.994 58.60 R: TGAGGCCCAAAAGTATACCCA 28S 28S ribosomal Cluster-25903.1 58.94 F: GCCATGTTGACCGTTCGAAT 101.6 102 0.998 59.09 R: ATACTGTGCGCGACTCTCTT GAPDH Glyceraldehyde-3-phosphate Cluster-32023.80441 59.03 F: CATGATTGGCAAAGGATCCGT 108.2 119 0.993 59.52 R: CATGATTGGCAAAGGATCCGT ACT Actin Cluster-32023.1858 58.93 F: ATCTTCTCCCTGTTGGCCTT 99.8 101 0.995 58.95 R: TGGCACCACACCTTCTACAA RPL18 Ribosomal protein L18 Cluster-5404.0 58.99 F: CGAGCTGGACAACATACTGC 95.6 93 0.990 59.11 R: TTCTCCTCCGTGAAGTGACC HSP70 Heat shock protein 70 CL1087.Contig4 58.75 F: AAGCAGACCCAAACGTTCAC 98.6 127 0.991 59.63 R: GTATGCCGGTCAAGTCGAAC SgraCYP18A1 Cytochrome P450 Unigene3515 58.96 F: ACCGGCAAGTTCAGCAAATT 103.3 146 0.996 59.10 R: ACCCACAACCGAATCGATCT GST Glutathione S -transferase CL2721.Contig3 60.18 F: GCAAAGGAGGTGGGGAAGTT 95.9 137 0.998 59.18 R: CATTTCTGGAGGCTTGCTGG