JIA-2018-09

2017 HU Guo-jun et al. Journal of Integrative Agriculture 2018, 17(9): 2015–2023 pair that allowed for the specific amplification of mRNA corresponding to the mitochondrial nad 5 (Ma et al. 2008) gene was used as an internal control (Table 1). 2.5. Pre-culture and thermotherapy Shoots approximately 6.0 mm long were excised from in vitro cultures and were placed into culture bottles containing fresh MS medium. The plantlets were pre-cultured in a growth room for 1, 4, 7, 10, and 13 d, respectively and plant materials were collected after each pre-culture period. After pre-culture, the culture bottles were moved into a heated chamber. The temperature was raised at 3°C d –1 , then the cultivated temperatures were as follows: 27, 30, 33, and 37°C, and the thermotherapy periods were recorded when the temperature reached 37°C. The duration of all thermotherapy treatments was 30 d. Plant materials were collected at different culture temperatures of 27, 30, 33, and 37°C, and collected at 37°C for 0, 1, 5, 10, 15, 20, 25, and 30 d of thermotherapy, respectively. The growth and heights of the in vitro apple plants were observed periodically to evaluate the effects of the different treatments. In total, 45 shoots were used for each treatment. Meristem tips approximately 1.0 mm long were dissected from apical shoots after treatments and cultured on the same basic MS medium as that described above. Cultures from the same source kept in a standard growth room were used as controls. After three cycles of sub-culture, RT-PCR was conducted to detect viruses, and the efficiency of virus elimination was calculated as follows: Number of virus-free plants/Number of initial shoots. 3. Results 3.1. Effect of pre-culture on growth of in vitro apple plantlets All in vitro Pink Lady and Huafu plants survived and grewed Table 1 Oligonucleotide primers used in reverse transcription PCR (RT-PCR) assays to detect apple viruses Virus 1) Primer Sequence (5´→3´) Position (nt) Size (bp) Reference ACLSV A53 GGCAACCCTGGAACAGA 6 875–6 891 358 Cieslinska et al. (1995) A52 CAGACCCTTATTGAAGTCGAA 7 212–7 232 ACF1 TGGAGTCCATCTTCGCGAAC 6 913–6 922 590 Hu et al. (2015a) ACR1 CTCTTTCATGGGTTCAAGAG 7 522–7 503 ASGV H5873 CCCGCTGTTGGATTTGATACACCTC 5 872–5 896 524 Clover et al. (2003) C6396 CTGCAAGACCGCGACCAAGTTT 6 373–6 396 AGF1 ATGAGTTTGGAAGACGTGC 5 640–5 658 713 Hu et al. (2015a) AGR1 GACTAACCCTCCAGTTCC 6 338–6 353 ASPV ASP-C CTCTTGAACCAGCTGATGGC 8 993–9 012 264 Kudela et al. (2009) ASP-A ATAGCCGCCCCGGTTAGGTT 9 237–9 256 ASPF1 AGCGGTTGCCTATTTTTGCTCC 3 480–3 501 291 Malinowski et al. (1998) ASPR5 GTGAGGTCAAAGATGCTGAAACC 3 748–3 770 Nad F GATGCTTCTTGGGGCTTCTTGT 968–987 1836–1 838 181 Menzel et al. (2002) R CTCCAGTCACCAACATTGGCATA 1 973–1 995 1) ACLSV, Apple chlorotic leaf spot virus ; ASGV, Apple stem grooving virus ; ASPV, Apple stem pitting virus . Table 2 Survival rate after pre-culture, thermotherapy and shoot tip culture Duration of pre-culture 1) No. of treated plants Percentage of surviving plants after pre-culture (%) No. of dissected shoots No. of surviving shoots (rate, %) Pink Lady P-1d 45 100 5 2 (40.0) P-4d 45 100 18 9 (50.0) P-7d 45 100 8 2 (25.0) P-10d 45 100 10 3 (30.0) P-13d 45 100 16 7 (43.8) Huafu P-1d 45 100 14 2 (14.3) P-4d 45 100 24 5 (20.8) P-7d 45 100 32 23 (71.9) P-10d 45 100 25 12 (48.0) P-13d 45 100 37 24 (64.9) 1) P-1d, P-4d, P-7d, P-10d, and P-13d, pre-cultured for 1, 4, 7, 10, and 13 d, respectively.